Search Results
Advanced search
75 variant records found | [show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
| OMIA ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Type of Variant | Deleterious? | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| OMIA 000328-9940 | sheep | White Dorper | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 5 | g.1938399G>T | c.424G>T | p.(E142*) | XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) | 2012 | 22497338 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 000328-9940 | sheep | White Dorper | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 5 | g.2088231G>A | c.805G>A | p.(V269M) | XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) | 2015 | 25354687 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 000662-9940 | sheep | Romney Marsh | Motor neuron disease, lower | AGTPBP1 | missense | yes | Oar_rambouillet_v1.0 | 2 | g.35795594G>C | c.2909G>C | p.(R970P) | protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively | 2012 | 22588130 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001672-9940 | sheep | Zwartbles | Type 1 Primary Hyperoxaluria | AGXT | missense | yes | Oar_rambouillet_v1.0 | 1 | g.801189C>T | c.584G>A | p.(C195Y) | NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) | 2020 | 33003365 | |||
| OMIA 000201-9940 | sheep | Merino | White fleece | ASIP | Wt | insertion, gross (>20) | no | Oar_rambouillet_v1.0 | 13 | a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH | 2008 | 18493018 | |||||
| OMIA 000201-9940 | sheep | Recessive black | ASIP | a | missense | no | Oar_rambouillet_v1.0 | 13 | g.66474980T>A | c.376T>A | p.(C126S) | Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 | 2008 | 18493018 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 000201-9940 | sheep | Recessive black | ASIP | a | deletion, small (<=20) | no | Oar_rambouillet_v1.0 | 13 | g.66475132_66475136del | published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site | 2002 | 12354151 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| OMIA 001885-9940 | sheep | Lacaune | Fecundity, Lacaune, FecL | B4GALNT2 | regulatory | no | Oar_v3.1 | 11 | g.36938224T>A | rs588626728 | 2013 | 24086150 | |||||
| OMIA 001885-9940 | sheep | Lacaune | Fecundity, Lacaune, FecL | B4GALNT2 | regulatory | no | Oar_v3.1 | 11 | g.37034573A>G | 2013 | 24086150 | ||||||
| OMIA 001079-9940 | sheep | Norwegian White | Yellow fat | BCO2 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 15 | g.25024133C>T | c.196C>T | p.(Q66*) | Oar_v3.1 position is g.21947481C>T | rs1090867485 | 2010 | 20122251 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| OMIA 001719-9940 | sheep | Belclare Irish Cambridge | Fecundity, Belclare | BMP15 | FecX(B) | missense | no | Oar_rambouillet_v1.0 | X | g.56594843C>A | c.1100G>T | p.(S367I) | 2004 | 14627550 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001799-9940 | sheep | Olkuska | Fecundity, Olkuska | BMP15 | FecX(O) | missense | no | Oar_rambouillet_v1.0 | X | g.56594934T>G | c.1009A>C | p.(N337H) | Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001357-9940 | sheep | Lacaune | Fecundity, Lacaune | BMP15 | FecX(L) | missense | no | Oar_rambouillet_v1.0 | X | g.56594981C>T | c.962G>A | p.(C321Y) | cDNA position based on NP_001108239.1 | 2007 | 17038554 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001798-9940 | sheep | Grivette | Fecundity, Grivette | BMP15 | FecX(Gr) | missense | no | Oar_rambouillet_v1.0 | X | g.56594993G>A | c.950C>T | p.(T317I) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 000386-9940 | sheep | Romney Marsh | Fecundity, Inverdale | BMP15 | FecX(I) | missense | no | Oar_rambouillet_v1.0 | X | g.56595047A>T | c.896T>A | p.(V299D) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | rs398521635 | 2000 | 10888873 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 001350-9940 | sheep | Romney Marsh | Fecundity, Hanna | BMP15 | FecX(H) | nonsense (stop-gain) | no | Oar_rambouillet_v1.0 | X | g.56595072G>A | c.871C>T | p.(Q291*) | previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively | rs413916687 | 2000 | 10888873 | |
| OMIA 000384-9940 | sheep | Irish Cambridge | Fecundity, Galway | BMP15 | FecX(G) | nonsense (stop-gain) | no | Oar_rambouillet_v1.0 | X | g.56595225G>A | c.718C>T | p.(Q239*) | rs425019156 | 2004 | 14627550 | ||
| OMIA 001800-9940 | sheep | Rasa Aragonesa | Fecundity, Rasa Aragonesa | BMP15 | FecX® | deletion, small (<=20) | no | Oar_rambouillet_v1.0 | X | g.56595467_56595483del173 | c.460_476del17 | p.(W154Nfs*55) | published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively | 2008 | 18355397 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 002107-9940 | sheep | Tunisian Barbarine | Fecundity, Barbarine | BMP15 | FecX(Bar) | complex rearrangement | no | Oar_rambouillet_v1.0 | X | g.[56600937insG; 56600945_56600947delTAG; 56600948C>A] | c.[301G>T; 302_304delCTA; 310insC] | p.(A101Cfs*113) | "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 | 2017 | 28506298 | ||
| OMIA 000383-9940 | sheep | Booroola Han, small-tailed | Fecundity, Booroola | BMPR1B | FecB(B) | missense | no | Oar_rambouillet_v1.0 | 6 | g.34010859T>C | c.914A>G | p.(Q305R) | Position on Oar_v3.1: g.29382188T>C | rs418841713 | 2001 | 11259271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 000698-9940 | sheep | Rasa Aragonesa | Myotonia | CLCN1 | missense | yes | Oar_rambouillet_v1.0 | 4 | g.115541101G>A | c.277G>A | p.(E93K) | Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. cDNA and protein position predicted using Variant Effect Predictor ENSOART00020002372.1 | rs401726021 | 2015 | 25744800 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001482-9940 | sheep | Borderdale | Neuronal ceroid lipofuscinosis, 5 | CLN5 | splicing | yes | Oar_rambouillet_v1.0 | 10 | g.56313269G>A | c.571+1G>A | rs422165326 | 2008 | 17988881 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001443-9940 | sheep | South Hampshire | Neuronal ceroid lipofuscinosis | CLN6 | deletion, gross (>20) | yes | Oar_rambouillet_v1.0 | 7 | deletion of exon 1 | 2013 | 23338040 | ||||||
| OMIA 001443-9940 | sheep | Merino | Neuronal ceroid lipofuscinosis, 6 | CLN6 | missense | yes | Oar_rambouillet_v1.0 | 7 | g.16039510G>A | c.184C>T | p.(R62C) | protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively | rs399747319 | 2006 | 17046213 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001481-9940 | sheep | Awassi | Achromatopsia-2 (day blindness) | CNGA3 | missense | yes | Oar_rambouillet_v1.0 | 3 | g.108958871C>T | c.1618G>A | p.(G540S) | 2017 | 28282490 | Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001481-9940 | sheep | Awassi | Achromatopsia-2 (day blindness) | CNGA3 | nonsense (stop-gain) | yes | Oori1 scaffold00739 | 3 | g.263324C>T | c.706C>T | p.(R236*) | In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" | 2010 | 19874885 | |||
| OMIA 001354-9940 | sheep | Muscular hypertrophy (double muscling), Callipyge | DLK1 | regulatory | unknown | Oar_rambouillet_v1.0 | 18 | g.66187430A>G | "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) | rs10721113 | 2002 | 12368241 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | ||||
| OMIA 001542-9940 | sheep | Corriedale | Hypophosphatemic rickets, autosomal recessive, 1 | DMP1 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 6 | g.112910614C>T | c.433C>T | p.(R145*) | Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. | 2011 | 21747952 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001765-9940 | sheep | Cameroon | Waardenburg syndrome, type 4A | EDNRB | deletion, gross (>20) | yes | Oar_rambouillet_v1.0 | 10 | "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" | 2012 | 23300849 | ||||||
| OMIA 000437-9940 | sheep | Swiss Alpine | Haemophilia A | F8 | delins, small (<=20) | yes | Oar_rambouillet_v1.0 | X | g.8630107del10ins11 | c.3107del10ins11 | The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon | 2010 | 19943872 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001723-9940 | sheep | Romney Marsh | Familial episodic ataxia | FGF14 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 10 | g.88095843G>A | c.46C>T | p.(Q16*) | Oar_v3.1 position is g.77593415 | 2017 | 29253853 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001703-9940 | sheep | Suffolk | Chondrodysplasia, Spider lamb | FGFR3 | missense | yes | Oar_rambouillet_v1.0 | 6 | 128784747A>T | c.1719T>A | p.(V700E) | 2006 | 16441300 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 000405-9940 | sheep | Southdown | Gaucher disease, type | GBA | missense | yes | Oar_rambouillet_v1.0 | 1 | g.111561271C>T | c.1142G>A | p.(C381Y) | Oar_v3.1 position is g.103978212C>T | rs429928390 | 2017 | 29023809 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 000385-9940 | sheep | Cheviot | Fecundity, Thoka, FecG | GDF9 | FecG(T) | missense | no | Oar_rambouillet_v1.0 | 5 | g.46545130T>G | c.1279A>C | p.(S427R) | Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively | 2009 | 19713444 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001801-9940 | sheep | Belclare Irish Cambridge | Fecundity, High fertility, FecG | GDF9 | FecG(H) | missense | no | Oar_rambouillet_v1.0 | 5 | g.46545225G>A | c.1184C>T | p.(S395F) | Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively | 2004 | 14627550 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001763-9940 | sheep | Norwegian White | Fecundity, Norwegian White Sheep | GDF9 | missense | no | Oar_rambouillet_v1.0 | 5 | g.46545298C>T | c.1111G>A | p.(V371M) | Oar_v3.1 position is g.41841285C>T, protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively | rs403536877 | 2013 | 23280002 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001559-9940 | sheep | Brazilian Santa Inês Mexican Pelibuey | Fecundity, Embrapa, FecG | GDF9 | FecG(E) | missense | no | Oar_rambouillet_v1.0 | 5 | g.46545375A>C | c.1034T>G | p.(F345C) | Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively | rs1092755620 | 2020 | 31961953 20528846 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 001961-9940 | sheep | Ile de France | Fecundity, Vacaria, FecG | GDF9 | FecG(V) | missense | no | Oar_rambouillet_v1.0 | 5 | g.46545466G>A | c.943C>T | p.(R315C) | Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively | 2014 | 25039891 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 000402-9940 | sheep | Romney Marsh | Gangliosidosis, GM1 | GLB1 | missense | yes | Oar_rambouillet_v1.0 | 19 | g.8003247C>A | c.686G>T | p.(C299F) | cDNA position based on ENSOART00020038844.1 | 2012 | Reference not in PubMed; see OMIA 000402-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001461-9940 | sheep | Jacob | Gangliosidosis, GM2, type I (B variant) | HEXA | splicing | yes | Oar_rambouillet_v1.0 | 7 | g.20584348C>G | c.1330G>C | The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. | 2010 | 20817517 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001952-9940 | sheep | Altay | Microtia | HMX1 | duplication | yes | Oar_rambouillet_v1.0 | 6 | He et al. (2020): "a 76 bp duplication of HMX1" (duplication of 76bp segment 6:126893417-126893492) | 2020 | 31691317 | ||||||
| OMIA 000806-9940 | sheep | Polyceraty | HOXD1 | deletion, small (<=20) | no | Oar_rambouillet_v1.0 | 2 | g.144548739_144548742del | "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) | 2021 | 33528505 | ||||||
| OMIA 002229-9940 | sheep | Valle del Belice | Hypotrichosis | HR | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 2 | g.45703202C>T | c.1312C>T | p.(Q438*) | Oar_v3.1 position is g.43224867C>T | rs423413166 | 2003 | 12927087 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001528-9940 | sheep | Romane | Fleece variation, woolly | IRF2BP2 | insertion, gross (>20) | no | Oar_rambouillet_v1.0 | 25 | insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene | 2017 | 28379502 | ||||||
| OMIA 001948-9940 | sheep | Mouton Vendeen | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 11 | g.7412626C>T | c.2653C>T | p.(R885*) | c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 | 2020 | 33225458 | |||
| OMIA 001948-9940 | sheep | Churra | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, small (<=20) | yes | Oar_rambouillet_v1.0 | 11 | g.7425460_7425463del | c.4412_4415del | Oar_v3.1: g.54849767_54849770del | 2015 | 25955497 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001678-9940 | sheep | German Blackheaded Mutton | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | deletion, small (<=20) | yes | Oar_rambouillet_v1.0 | 12 | g.68856318delCA | c.2746delCA | p.(A928*) | FM872310 c.2746delCA | 2011 | 21573221 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001694-9940 | sheep | Polypay | Resistance to lentivirus | LOC105603932 | regulatory | no | Oar_rambouillet_v1.0 | 20 | g.32931861_32931862delAT | Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). | rs397514112 | 2013 | 24303974 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001505-9940 | sheep | Swedish Landrace | Neuronal ceroid lipofuscinosis, 10 | LOC443060 | missense | yes | Oar_rambouillet_v1.0 | 21 | g.51583020G>A | c.883G>A | p.(D295N) | published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively | 2000 | 10856224 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001199-9940 | sheep | Valle del Belice | Recessive pheomelanism | MC1R | e | missense | no | Oar_rambouillet_v1.0 | 14 | g.15487353C>T | c.199C>T | p.(R67C) | 2010 | Reference not in PubMed; see OMIA 001199-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001199-9940 | sheep | Corriedale Dala Damara Merino | Dominant black | MC1R | E^D | missense | no | Oar_rambouillet_v1.0 | 14 | g.15487372T>A | c.218T>A | p.(M73K) | 1999 | 9892731 | c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001199-9940 | sheep | Massese | Dominant black | MC1R | E^D | missense | no | Oar_rambouillet_v1.0 | 14 | g.15487515G>A | c.361G>A | p.(D121N) | 1999 | 9892731 | c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001199-9940 | sheep | Gotland Gute Värmland | Dominant black | MC1R | missense | no | Oar_rambouillet_v1.0 | 14 | g.15487606G>A | c.452G>A | p.(R151Q) | 2019 | 31475378 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 000031-9940 | sheep | Jacob | Lilac | MLPH | nonsense (stop-gain) | no | Oar_rambouillet_v1.0 | 1 | g.3580535C>A | p.(E14*) | Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) | 2020 | 32512769 | ||||
| OMIA 001426-9940 | sheep | Texel | Muscular hypertrophy (double muscling), Texel | MSTN | regulatory | yes | Oar_rambouillet_v1.0 | 2 | g.129065977G>A | c.*1232G>A | "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" | rs408469734 | 2006 | 16751773 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 001595-9940 | sheep | Merino | Brachygnathia, cardiomegaly and renal hypoplasia syndrome | OBSL1 | deletion, small (<=20) | yes | Oar_rambouillet_v1.0 | 2 | g.236304072delG | c.1716delC | p.(V573Wfs*119) | XM_027965226.1:c.1716delC | 2020 | 32933480 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | ||
| OMIA 002227-9940 | sheep | Istrian Pramenka | Otocephaly | OTX2 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 7 | g.71478714G>A | c.265C>T | p.(R89*) | Paris et al. (2020): XM_015097088.2:c.265C > T | 2020 | 31969185 | |||
| OMIA 000649-9940 | sheep | Texel | Microphthalmia | PITX3 | missense | yes | Oar_rambouillet_v1.0 | 22 | g.25497953C>G | c.338G>C | p.(R113P) | Oar_v3.1 position is g.22045744C>G | 2010 | 20084168 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| OMIA 002105-9940 | sheep | Swaledale | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | nonsense (stop-gain) | yes | Oar_rambouillet_v1.0 | 3 | g.230750869G>A | c.1186C>T | p.(Q396*) | Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. | 2020 | 33159255 | |||
| OMIA 002105-9940 | sheep | Swaledale | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | splicing | unknown | Oar_rambouillet_v1.0 | 3 | g.230766713T>C | c.336-2A>G | p.(L71Wfs*3) | Oar_rambouillet_v1.0: g.230766713T>C; XM_012175630.3: c.336-2A>G; XP_012031020.2: p.Leu71TrpfsTer3 (Letko et al., 2020) | 2020 | 33159255 | |||
| OMIA 000944-9940 | sheep | Ile de France Romanov | Resistance to scrapie | PRNP | V | missense | yes | Oar_rambouillet_v1.0 | 13 | g.48675389C>T | c.407C>T | p.(A136V) | Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs591379086 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 000944-9940 | sheep | Norwegian breeds | Resistance to scrapie, Nor98 type | PRNP | F | missense | yes | Oar_rambouillet_v1.0 | 13 | g.48675403C>T | c.421C>T | p.(L141F) | Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs598580733 | 2005 | 15604451 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 000944-9940 | sheep | Ile de France Romanov | Resistance to scrapie | PRNP | H | missense | yes | Oar_rambouillet_v1.0 | 13 | g.48675443G>A | c.461G>A | p.(R154H) | Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs605048948 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 000944-9940 | sheep | Suffolk | Resistance to scrapie | PRNP | Q | missense | yes | Oar_rambouillet_v1.0 | 13 | g.48675494G>A | c.512G>A | p.(R171Q) | Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively | rs160575103 | 1990 | 1969635 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| OMIA 001139-9940 | sheep | Glycogen storage disease V | PYGM | splicing | yes | Oar_rambouillet_v1.0 | 21 | g.44787090C>T | c.2380-1G>A | a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 | rs402505013 | 1997 | 9267848 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 001867-9940 | sheep | Churra | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | yes | Oar_rambouillet_v1.0 | 4 | g.50313243_50313273del | c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 000483-9940 | sheep | Numerous breeds | Polled | RXFP2 | insertion, gross (>20) | no | Oar_rambouillet_v1.0 | 10 | "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" | 2015 | 26103004 | ||||||
| OMIA 001400-9940 | sheep | Texel | Chondrodysplasia, Texel | SLC13A1 | deletion, small (<=20) | yes | Oar_rambouillet_v1.0 | 4 | g.95624809delA | c.334delT | Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 | 2012 | 22742499 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| OMIA 002176-9940 | sheep | Coopworth Perendale | Meckel-like hepatorenal fibrocystic dysplasia syndrome | TMEM67 | haplotype | yes | Oar_rambouillet_v1.0 | 9 | g.[91651651A>C; 91651669A>T] | c.[2042T>A; 2060T>G] | p.[(I681N);(I687S)] | Published as c.[2050T>A; 2068T>G]; protein and cDNA positions in the table are based on XP_012039520.2 and XM_012184130.2, respectively. | rs1086155906; rs1088172192 | 2017 | 28487520 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 002285-9940 | sheep | Merino | Ovine congenital progressive muscular dystrophy | TNNT1 | deletion, small (<=20) | yes | Oar_rambouillet_v1.0 | 14 | g.66970247delG | c.614+1delG | "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) is a splice variant | 2020 | 32819427 | ||||
| OMIA 001249-9940 | sheep | Brown | TYRP1 | missense | no | Oar_rambouillet_v1.0 | 2 | c.2240C>G | p.(A???V) | 2013 | 23451726 | ||||||
| OMIA 001249-9940 | sheep | Valais Red | Brown | TYRP1 | b^VS1 | deletion, small (<=20) | no | Oar_rambouillet_v1.0 | 2 | g.87540706_87540707delGA | c.86_87delGA | p.(E29Vfs*5) | NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) | 2019 | 31571241 | ||
| OMIA 001249-9940 | sheep | Soay | Tawny (light brown) | TYRP1 | b^Soay | missense | no | Oar_rambouillet_v1.0 | 2 | g.87545636G>T | c.869G>T | p.(C290F) | rs402624085 | 2007 | 17254985 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| OMIA 001249-9940 | sheep | Valais Red | Brown | TYRP1 | b^VS2 | nonsense (stop-gain) | no | Oar_rambouillet_v1.0 | 2 | g.87549195C>T | c.1066C>T | p.(R356*) | NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) | rs1085637427 | 2019 | 31571241 | |
| OMIA 001176-9940 | sheep | German Blackface | Porphyria cutanea tarda | urod | missense | yes | Oar_rambouillet_v1.0 | 1 | g.20327971T>C | c.392T>C | p.(L131P) | Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively | rs429214636 | 2005 | 16026339 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| Overall Statistics | |
|---|---|
| Total number of variants | 75 |
| Variants with genomic location | 75 (100.0% ) |
| Variants in a variant database, i.e. with rs ID | 25 (33.3%) |
| Variant Type | Count | Percent |
|---|---|---|
| complex rearrangement | 1 | 1.3% |
| deletion, gross (>20) | 3 | 4.0% |
| deletion, small (<=20) | 9 | 12.0% |
| delins, small (<=20) | 1 | 1.3% |
| duplication | 1 | 1.3% |
| haplotype | 1 | 1.3% |
| insertion, gross (>20) | 3 | 4.0% |
| missense | 33 | 44.0% |
| nonsense (stop-gain) | 14 | 18.7% |
| regulatory | 5 | 6.7% |
| splicing | 4 | 5.3% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1990 | 1 | 1.3% |
| 1991 | 0 | 0.0% |
| 1992 | 0 | 0.0% |
| 1993 | 2 | 2.7% |
| 1994 | 0 | 0.0% |
| 1995 | 0 | 0.0% |
| 1996 | 0 | 0.0% |
| 1997 | 1 | 1.3% |
| 1998 | 0 | 0.0% |
| 1999 | 2 | 2.7% |
| 2000 | 3 | 4.0% |
| 2001 | 1 | 1.3% |
| 2002 | 2 | 2.7% |
| 2003 | 1 | 1.3% |
| 2004 | 3 | 4.0% |
| 2005 | 2 | 2.7% |
| 2006 | 3 | 4.0% |
| 2007 | 2 | 2.7% |
| 2008 | 4 | 5.3% |
| 2009 | 1 | 1.3% |
| 2010 | 6 | 8.0% |
| 2011 | 3 | 4.0% |
| 2012 | 5 | 6.7% |
| 2013 | 9 | 12.0% |
| 2014 | 1 | 1.3% |
| 2015 | 4 | 5.3% |
| 2016 | 0 | 0.0% |
| 2017 | 6 | 8.0% |
| 2018 | 0 | 0.0% |
| 2019 | 3 | 4.0% |
| 2020 | 9 | 12.0% |
| 2021 | 1 | 1.3% |