You are here: OMIA / Search / OMIA:002547 / taurine cattle

OMIA:002547-9913 : Haplotype with homozygous deficiency HH25, RIOX1-related in Bos taurus (taurine cattle)

Categories: Mortality / aging (incl. embryonic lethal)

Links to possible relevant human trait(s) and/or gene(s) in OMIM: 611919 (gene)

Mendelian trait/disorder: yes

Mode of inheritance: Autosomal recessive

Disease-related: yes

Key variant known: yes

Year key variant first reported: 2022

Inheritance: Häfliger et al. (2022) reported a 75% deficiency of homozygotes for this haplotype in Swiss Holsteins.

Markers: Based on strong evidence from Swiss Holsteins, Häfliger et al. (2022) reported RIOX1; c.396_425delGGC GCA GAC CCC GGC GGC ACG CTT GGT GGA as a likely causal variant for haplotype H25.

Breed: Holstein-Friesian, Switzerland (Cattle) (VBO_0003139).
Breeds in which the phene has been documented. (If a likely causal variant has been documented for the phene, see the variant table breeds in which the variant has been reported).

Associated gene:

Symbol Description Species Chr Location OMIA gene details page Other Links
RIOX1 Bos taurus 10 NC_037337.1 (84937977..84940480) RIOX1 Homologene, Ensembl , NCBI gene

Variants

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID Breed(s) Variant Phenotype Gene Allele Type of Variant Source of Genetic Variant Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
1442 Holstein-Friesian, Switzerland (Cattle) Haplotype HH25 deficiency RIOX1 deletion, gross (>20) Naturally occurring variant ARS-UCD1.2 10 g.84938408_84938437del c.396_425del p.(A133_E142del) NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA 2022 35361830
Download table as CSV

Cite this entry

Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2022). OMIA:002547-9913: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70

Reference

2022 Häfliger, I.M., Spengeler, M., Seefried, F.R., Drögemüller, C. :
Four novel candidate causal variants for deficient homozygous haplotypes in Holstein cattle. Sci Rep 12:5435, 2022. Pubmed reference: 35361830. DOI: 10.1038/s41598-022-09403-6.

Edit History


  • Created by Frank Nicholas on 04 Apr 2022
  • Changed by Frank Nicholas on 04 Apr 2022