OMIA:001867-9940 : Lissencephaly and cerebellar hypoplasia, RELN-related in Ovis aries (sheep) |
In other species: dog
Categories: Nervous system phene
Links to possible relevant human trait(s) and/or gene(s) in OMIM: 257320 (trait) , 600514 (gene)
Links to relevant human diseases in MONDO:
Single-gene trait/disorder: yes
Mode of inheritance: Autosomal recessive
Disease-related: yes
Key variant known: yes
Year key variant first reported: 2013
Cross-species summary: Renamed from 'Lissencephaly and cerebellar hypoplasia' to 'Lissencephaly and cerebellar hypoplasia, RELN-related' [22/09/2023]
Species-specific symbol: LCH
History: Pérez et al. (2013) provided the first report in the peer-reviewed literature of this disorder in a particular breed of sheep.
Inheritance: As reported by Pérez et al. (2013), "The analysis of the three pedigrees, including 14 affected [Churra or Spanish Churro] animals . . . was consistent with a monogenic autosomal recessive inheritance".
Mapping: By conducting a GWAS/homozygosity-mapping analysis on 7 affected and 33 normal Churra sheep, each genotyped with the OvineSNP50 SNP Chip (yielding 47,864 informative SNPs), Suárez-Vega et al. (2013) mapped this disorder to a 4.8Mb region on chromosome OAR4.
Molecular basis:
Sequencing of the most likely functional candidate gene in the candidate region (see Mapping section) enabled Suárez-Vega et al. (2013) to identify the causative mutation in Churra sheep: "a deletion of 31 bp (c.5410_5440del) [omia.variant:673] in predicted exon 36 of RELN, resulting in a premature termination codon. A functional analysis of this mutation revealed decreased levels of RELN mRNA and a lack of reelin protein in the brain cortex and blood of affected lambs."
Manning et al. (2024) reported lissencephaly and cerebellar hypoplasia in three Dorset-cross lambs and identified the likely causal variant: "Whole-genome sequencing analysis and prediction of variant effects identified a missense variant of interest in the candidate gene reelin (RELN; NC_040255.1:g.50288685C>T; NM_001306121.1:c.7088G>A; NP_001293050.1:p.(R2363H)) [omia.variant:1663] with a deleterious Sorting Intolerant from Tolerant (SIFT) score. anger sequencing identified that the variant segregated with LCH disease in the 3 affected individuals, their sire, and 6 unaffected flock members."
Clinical features:
Pérez et al. (2013) reported this disorder in "42 newborn lambs from a pure Churra breed flock, with clinical signs of weakness, inability to walk, difficulty in sucking and muscular rigidity observed immediately after birth. All the lambs showed near-total agyria with only a rudimentary formation of few sulci and gyri, and a severe cerebellar hypoplasia."
Affected Dorset-cross lambs reported by Manning et al. (2024) "were unable to walk and had reduced vision, and one lamb developed a hypermetric gait and intention tremors."
Pathology:
As explained by Pérez et al. (2013), "The pathological features reported are consistent with the type LCH-b (lissencephaly with cerebellar hypoplasia group b) defined in human medicine".
Manning et al. (2024) identified that affected Dorset-cross "lambs had diffuse pachygyria with reduction in white matter, mild bilateral ventriculomegaly of the lateral ventricles, and a markedly hypoplastic cerebellum. Histologically, there was disorganization of neurons within the cerebral cortex and hippocampus. The cerebellar vermis had disorganized, thin, and hypocellular gray matter with frequent ectopic Purkinje cells, while identifiable folia were largely absent within the hemispheres. ... Within the cerebellum, immunohistochemistry demonstrated marked dysplasia."
Breeds:
Poll Dorset (Sheep) (VBO_0001557),
Spanish Churro (Sheep) (VBO_0001619).
Breeds in which the phene or likely causal variants have been documented. If a likely causal variant has been documented, see variant-specific breed information in the variant table. (Breed information may be incomplete).
Associated gene:
| Symbol | Description | Species | Chr | Location | OMIA gene details page | Other Links |
|---|---|---|---|---|---|---|
| RELN | reelin | Ovis aries | 4 | NC_056057.1 (46693920..46157799) | RELN | Ensembl, NCBI gene |
Variants
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1663 | Poll Dorset (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_Rambouillet_v1.0 | 4 | NC_040255.1:g.50288685C>T | NM_001306121.1:c.7088G>A | NP_001293050.1:p.(R2363H) | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | 39394905 | |||
| 673 | Spanish Churro (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.50313243_50313273del | NM_001306121.1:c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
* Variant pathogenicity for single gene diseases as evaluated by an expert panel of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.
Clinical synopsis/links to phenotypes
Contact us
If you notice anything missing or in need of change, please contact us at: [email protected].
Cite this entry
Nicholas, F. W., Tammen, I., & Sydney Informatics Hub. (2025). OMIA:001867-9940: Online Mendelian Inheritance in Animals (OMIA) [dataset]. https://omia.org/. https://doi.org/10.25910/2AMR-PV70
References
Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.
| 2024 | Manning, L.K., Winkenwerder, E., Baskind, L., Eager, K.L.M., Willet, C.E., Porebski, B., O'Rourke, B.A., Tammen, I., Gimeno, M., Pinczowski, P. : |
| A novel missense variant in the RELN gene in sheep with lissencephaly and cerebellar hypoplasia. Vet Pathol 62:522-531, 2024. Pubmed reference: 39394905. DOI: 10.1177/03009858241283501. | |
| 2013 | Pérez, V., Suárez-Vega, A., Fuertes, M., Benavides, J., Delgado, L., Ferreras, M.C., Arranz, J.J. : |
| Hereditary lissencephaly and cerebellar hypoplasia in Churra lambs. BMC Vet Res 9:156, 2013. Pubmed reference: 23938146. DOI: 10.1186/1746-6148-9-156. | |
| Suárez-Vega, A., Gutiérrez-Gil, B., Cuchillo-Ibáñez, I., Sáez-Valero, J., Pérez, V., García-Gámez, E., Benavides, J., Arranz, J.J. : | |
| Identification of a 31-bp deletion in the RELN gene causing lissencephaly with cerebellar hypoplasia in sheep. PLoS One 8:e81072, 2013. Pubmed reference: 24260534. DOI: 10.1371/journal.pone.0081072. |
Edit History
- Created by Frank Nicholas on 16 Aug 2013
- Changed by Frank Nicholas on 16 Aug 2013
- Changed by Frank Nicholas on 24 Nov 2013
- Changed by Imke Tammen2 on 14 Oct 2024
- Changed by Imke Tammen2 on 28 Jan 2025
- Changed by Imke Tammen2 on 10 Apr 2025