OMIA 001867-9940 : Lissencephaly and cerebellar hypoplasia in Ovis aries |
Symbol | Description | Species | Chr | Location | OMIA gene details page | Other Links |
---|---|---|---|---|---|---|
RELN | reelin | Ovis aries | 4 | NC_056057.1 (46693920..46157799) | RELN | Homologene, Ensembl, NCBI gene |
Variants
By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
OMIA Variant ID | Breed(s) | Variant Phenotype | Gene | Allele | Type of Variant | Source of Genetic Variant | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Inferred EVA rsID | Year Published | PubMed ID(s) | Acknowledgements |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
673 | Churra | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | Naturally occurring variant | Oar_rambouillet_v1.0 | 4 | g.50313243_50313273del | c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
References
Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.
2013 | Pérez, V., Suárez-Vega, A., Fuertes, M., Benavides, J., Delgado, L., Ferreras, M.C., Arranz, J.J. : | |
Hereditary lissencephaly and cerebellar hypoplasia in Churra lambs. BMC Vet Res 9:156, 2013. Pubmed reference: 23938146. DOI: 10.1186/1746-6148-9-156. | ||
Suárez-Vega, A., Gutiérrez-Gil, B., Cuchillo-Ibáñez, I., Sáez-Valero, J., Pérez, V., García-Gámez, E., Benavides, J., Arranz, J.J. : | ||
Identification of a 31-bp deletion in the RELN gene causing lissencephaly with cerebellar hypoplasia in sheep. PLoS One 8:e81072, 2013. Pubmed reference: 24260534. DOI: 10.1371/journal.pone.0081072. |
Edit History
- Created by Frank Nicholas on 16 Aug 2013
- Changed by Frank Nicholas on 16 Aug 2013
- Changed by Frank Nicholas on 24 Nov 2013