OMIA 001867-9940 : Lissencephaly and cerebellar hypoplasia in Ovis aries

In other species: dog , domestic cat , cattle , goat

Possibly relevant human trait(s) and/or gene(s)s (MIM numbers): 257320 (trait) , 600514 (gene)

Mendelian trait/disorder: yes

Mode of inheritance: Autosomal Recessive

Considered a defect: yes

Key variant known: yes

Year key variant first reported: 2013

Species-specific symbol: LCH

History: Pérez et al. (2013) provided the first report in the peer-reviewed literature of this disorder in a particular breed of sheep.

Inheritance: As reported by Pérez et al. (2013), "The analysis of the three pedigrees, including 14 affected animals . . . was consistent with a monogenic autosomal recessive inheritance".

Mapping: By conducting a GWAS/homozygosity-mapping analysis on 7 affected and 33 normal Churra sheep, each genotyped with the OvineSNP50 SNP Chip (yielding 47,864 informative SNPs), Suárez-Vega et al. (2013) mapped this disorder to a 4.8Mb region on chromosome OAR4.

Molecular basis: Sequencing of the most likely functional candidate gene in the candidate region (see Mapping section) enabled Suárez-Vega et al. (2013) to identify the causative mutation: "a deletion of 31 bp (c.5410_5440del) in predicted exon 36 of RELN, resulting in a premature termination codon. A functional analysis of this mutation revealed decreased levels of RELN mRNA and a lack of reelin protein in the brain cortex and blood of affected lambs."

Clinical features: Pérez et al. (2013) reported this disorder in "42 newborn lambs from a pure Churra breed flock, with clinical signs of weakness, inability to walk, difficulty in sucking and muscular rigidity observed immediately after birth. All the lambs showed near-total agyria with only a rudimentary formation of few sulci and gyri, and a severe cerebellar hypoplasia."

Pathology: As explained by Pérez et al. (2013), "The pathological features reported are consistent with the type LCH-b (lissencephaly with cerebellar hypoplasia group b) defined in human medicine".

Breed: Churra.

Associated gene:

Symbol Description Species Chr Location OMIA gene details page Other Links
RELN reelin Ovis aries 4 NC_056057.1 (46693920..46157799) RELN Homologene, Ensembl, NCBI gene


By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID Breed(s) Variant Phenotype Gene Allele Type of Variant Source of Genetic Variant Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Inferred EVA rsID Year Published PubMed ID(s) Acknowledgements
673 Churra Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) Naturally occurring variant Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.


Note: the references are listed in reverse chronological order (from the most recent year to the earliest year), and alphabetically by first author within a year.
2013 Pérez, V., Suárez-Vega, A., Fuertes, M., Benavides, J., Delgado, L., Ferreras, M.C., Arranz, J.J. :
Hereditary lissencephaly and cerebellar hypoplasia in Churra lambs. BMC Vet Res 9:156, 2013. Pubmed reference: 23938146. DOI: 10.1186/1746-6148-9-156.
Suárez-Vega, A., Gutiérrez-Gil, B., Cuchillo-Ibáñez, I., Sáez-Valero, J., Pérez, V., García-Gámez, E., Benavides, J., Arranz, J.J. :
Identification of a 31-bp deletion in the RELN gene causing lissencephaly with cerebellar hypoplasia in sheep. PLoS One 8:e81072, 2013. Pubmed reference: 24260534. DOI: 10.1371/journal.pone.0081072.

Edit History

  • Created by Frank Nicholas on 16 Aug 2013
  • Changed by Frank Nicholas on 16 Aug 2013
  • Changed by Frank Nicholas on 24 Nov 2013