Search Results
Advanced search
Link to this search: https://omia.org/results/?search_type=advanced&gb_species_id=9940&result_type=variant&defect=yes&singlelocus=yes&characterised=yes
57 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | AVCG Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 318 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.1938399G>T | XM_027969213.1:c.424G>T | XP_027825014.1:p.(E142*) | XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) | 2012 | 22497338 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 857 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.2088231G>A | XP_027825015.1:c.673G>A | XP_027825015.1:p.(V225M) | Published as g.1862883G>A / (V15M), previously listed in OMIA as XM_012156230:c.805G>A, XP_012011620:p.Val269Met based on Joller et al., 2017; coordinates in this table updated to a recent reference genome [10/06/2025] | 2015 | 25354687 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1750 | OMIA:001562-9940 | sheep | Persian (Sheep) | Pulmonary hypoplasia with anasarca | ADAMTS3 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Oarv3.1 | 6 | NC_019463.1:g.87124344del | XM_012180125.1:c.2055+3del | XP_012035515.1:p.(V680_V685del) | the variant results in the activation of a cryptic splice site within exon 14 | 2024 | 39409761 | |||
| 233 | OMIA:000662-9940 | sheep | Romney Marsh (Sheep) | Motor neuron disease, lower | AGTPBP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.35795594G>C | XM_015093043.2:c.2909G>C | XP_014948529.2:p.(R970P) | protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively | 2012 | 22588130 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1252 | OMIA:001672-9940 | sheep | Zwartbles (Sheep) | Type 1 Primary Hyperoxaluria | AGXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.801189C>T | XM_027966918.1:c.584G>A | XP_027822719.1:p.(C195Y) | NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) | 2020 | 33003365 | |||
| 1486 | OMIA:002162-9940 | sheep | Hypophosphatasia | ALPL | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.260716094G>C | XM_027965561.1:c.1077C>G | XP_027821362.1:p.(I359M) | XM_027965561.1; XP_027821362.1 | 2018 | 30446691 | ||||
| 1828 | OMIA:001492-9940 | sheep | Merino (Sheep) | Axonopathy, segmental | ALS2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 2 | NC_056055.1:g.204020069-204020070del | NC_056055.1:g.204020069-204020070del | XP_011998058.1:p.(L1380Gfs*17) | 2025 | 41131452 | ||||
| 1333 | OMIA:001079-9940 | sheep | spælsau (Sheep) | yellow fat | BCO2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) | 2021 | 34193038 | ||||||||
| 320 | OMIA:001079-9940 | sheep | spælsau (Sheep) | Yellow fat | BCO2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 15 | NC_040266.1:g.25024133C>T | XM_012095240.3:c.196C>T | XP_011950630.2:p.(Q66*) | Oar_v3.1 position is g.21947481C>T | rs1090867485 | 2010 | 20122251 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1403 | OMIA:002342-9940 | sheep | Blanc Du Massif Central (Sheep) Lacaune (Sheep) | Ciliary dyskinesia, primary (respiratory failure) | CCDC65 | LDHH6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.147207999C>A | XM_004006389.4:c.521G>T | XP_004006438.1:p.(E111*) | XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A | rs1085624756 | 2021 | 35052387 | |
| 1479 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | substitution | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57192317C>A | NM_001009781.1:c.1621G>T | NP_001009781.1:p.(G541*) | NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence | 2021 | 34632318 | |||
| 1478 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | deletion, small (<=20) | deletion (in-frame) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57218683_57218685del | NM_001009781.1:c.1518_1520del | NP_001009781.1:p.(F507del) | NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence | 2021 | 34632318 | |||
| 1664 | OMIA:000698-9940 | sheep | Merino (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 4 | NC_056057.1:g.107930611C>T | XM_004008136.5:c.844C>T | XP_004008185.4:p.(P282S) | rs3487175777 | 2024 | 39765607 | |||
| 245 | OMIA:000698-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.115541101G>A | XM_004008136.4:c.277G>A | XP_004008185.4:p.(E93K) | Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. | rs401726021 | 2015 | 25744800 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 389 | OMIA:001482-9940 | sheep | Borderdale, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.56313269G>A | NM_001082595.1:c.571+1G>A | rs422165326 | 2008 | 17988881 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 671 | OMIA:001443-9940 | sheep | South Hampshire, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis | CLN6 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | deletion of exon 1 | 2013 | 23338040 | |||||||
| 234 | OMIA:001443-9940 | sheep | Merino (Sheep) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.16039510G>A | NM_001040289.1:c.184C>T | NP_001035379.1:p.(R62C) | protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively | rs399747319 | 2006 | 17046213 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1016 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.108958871C>T | XM_027965914.1:c.1618G>A | XP_027821715.1:p.(G540S) | 2017 | 28282490 | Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 317 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oori1 scaffold00739 | 3 | g.263324C>T | c.706C>T | p.(R236*) | In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" | 2010 | 19874885 | |||
| 1838 | OMIA:002127-9940 | sheep | Charollais (Sheep) | Osteogenesis imperfecta, type II | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 11 | NC_056064.1:g.36197409G>A | XM_027974705.2:c.1189G>A | XP_027830506.1:p.(G397S) | 2025 | 40999323 | ||||
| 1836 | OMIA:001926-9940 | sheep | Charollais (Sheep) | Achondrogenesis type II | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 3 | NC_056056.1:g.138610131G > A | XM_042246797.1:c.2908G > A | XP_042102731.1:p.(G970S) | 2025 | 40999323 | ||||
| 905 | OMIA:001505-9940 | sheep | Roslagsfår, Sweden (Sheep) | Neuronal ceroid lipofuscinosis, 10 | CTSD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.51583020G>A | XM_027959254.1:c.883G>A | XP_027815055.1:p.(D295N) | published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively | 2000 | 10856224 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 908 | OMIA:001542-9940 | sheep | Corriedale (Sheep) | Hypophosphatemic rickets, autosomal recessive, 1 | DMP1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.112910614C>T | XM_012180327.3:c.433C>T | XP_012035717.1:p.(R145*) | Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. | 2011 | 21747952 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 930 | OMIA:001765-9940 | sheep | West African Dwarf (Sheep) | Waardenburg syndrome, type 4A | EDNRB | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" | 2012 | 23300849 | |||||||
| 621 | OMIA:000437-9940 | sheep | Weißes Alpenschaf, Switzerland (Sheep) | Haemophilia A | F8 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.86301507_86301516delinsTAATTAATACC | NM_001172550.1:c.3107_3116delinsGGTATTAATTA | The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon | 2010 | 19943872 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries [21/09/06]. After checking the cDNA sequence in Fig. 3 of the paper, IT updated c. coordinates from c.3108_3117delinsGGTATTAATTA to c.3107_3116delinsGGTATTAATTA [10/06/2025]. Published as c.3107del10ins11. | ||||
| 941 | OMIA:001723-9940 | sheep | Romney Marsh (Sheep) | Familial episodic ataxia | FGF14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.88095843G>A | XM_027973760.1:c.214C>T | XP_027829561.1:p.(Q72*) | Oar_v3.1 position is g.77593415, published as c.46C>T & p.(Q16*), coordinates in this table updated to reflect recent transcript and protein information | 2017 | 29253853 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 225 | OMIA:001703-9940 | sheep | Suffolk (Sheep) | Chondrodysplasia, Spider lamb | FGFR3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.128784747A>T | XM_027971315.1:c.2093T>A | XP_027827116.1:p.(V698E) | published as c.1719T>A; p.(V700E); updated to HGVS nomenclature [10/04/2026] | 2006 | 16441300 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 231 | OMIA:002621-9940 | sheep | South Down (Sheep) | Gaucher disease, type | GBA | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.111561271C>T | XM_004002580.4:c.1142G>A | XP_004002629.2:p.(C381Y) | Oar_v3.1 position is g.103978212C>T | rs429928390 | 2017 | 29023809 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 230 | OMIA:000402-9940 | sheep | Romney Marsh (Sheep) | Gangliosidosis, GM1 | GLB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 19 | NC_040270.1:g.8003247C>A | XM_015102219.2:c.686G>T | XP_014957705.2:p.(C299F) | 2012 | Reference not in PubMed; see OMIA 000402-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 387 | OMIA:001461-9940 | sheep | Jacob (Sheep) | Gangliosidosis, GM2, type I (B variant) | HEXA | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.20584348C>G | NM_001126343.1:c.1330G>C | The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. | 2010 | 20817517 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1153 | OMIA:001952-9940 | sheep | Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) | Microtia | HMX1 | duplication | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 6 | g.114173249_114173324dup | He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). | 2020 | 31691317 | ||||||
| 319 | OMIA:002229-9940 | sheep | Valle del Belice, Italy (Sheep) | Hypotrichosis | HR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.45703202C>T | XM_027964354.1:c.1312C>T | XP_027820155.1:p.(Q438*) | Oar_v3.1 position is g.43224867C>T | rs423413166 | 2003 | 12927087 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1272 | OMIA:001948-9940 | sheep | Mouton vendéen, France (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7412626C>T | XM_027974087.1:c.2791C>T | XP_027829888.1:p.(R931*) | Published as OAR11_v4.0, g.54799925G>A / p.Arg885* | 2020 | 33225458 | |||
| 543 | OMIA:001948-9940 | sheep | Spanish Churro (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7425460_7425463del | XM_027974087.1:c.4412_4415del | Oar_v3.1: g.54849767_54849770del | 2015 | 25955497 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| 1781 | OMIA:002269-9940 | sheep | Bleu Du Maine (Sheep) | Junctional epidermolysis bullosa | LAMB3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 12 | NC_056065.1:g.73166198delG | XM_042229255.1:c.3051 + 1delG | XP_042085189.1:p.(V1018Ffs*12) | the 1-bp deletion affects the first nucleotide of intron 20 at the exon/intron boundary and mary result in altered splicing of exon 20 | 2025 | 40100311 | |||
| 507 | OMIA:001678-9940 | sheep | German Blackheaded Mutton (Sheep) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 12 | NC_040263.1:g.68856318_68856319del | NM_001142358.1:c.2746_2747del | NP_001135830.1:p.(A928*) | FM872310 c.2746delCA | 2011 | 21573221 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1637 | OMIA:002371-9940 | sheep | Kerry Hill (Sheep) | Microcephaly, MFSD2A-related | MFSD2A | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 1 | NC_056054.1:g.14577421dup | XM_004001833.5:c.285dup | XP_004001882.2:p.(D96Rfs*9) | XM_004001833.5; XP_004001882.2 | 2024 | 37921236 | |||
| 1690 | OMIA:002849-9940 | sheep | Manech Tête Rousse, France (Sheep) | Methylmalonyl-CoA mutase deficiency | MMUT | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 20 | NC_040271.1:g.23776347G>A | XM_004018875.4:c.1225C>T | XP_004018923.1:p.(Q409*) | 2024 | 38424485 | ||||
| 1242 | OMIA:001595-9940 | sheep | Merino (Sheep) | Brachygnathia, cardiomegaly and renal hypoplasia syndrome | OBSL1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.236304072del | XM_027965226.1:c.1716del | XP_027821027.1:p.(V573Wfs*119) | XM_027965226.1:c.1716delC | 2020 | 32933480 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC | ||
| 1141 | OMIA:002227-9940 | sheep | Istrska pramenka (Sheep) | Otocephaly | OTX2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.71478714G>A | XM_015097088.2:c.265C>T | XP_014952574.2:p.(R89*) | Paris et al. (2020): XM_015097088.2:c.265C > T | 2020 | 31969185 | |||
| 1461 | OMIA:002552-9940 | sheep | Pancreatic agenesis | PDX1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.33940517_33940724del | XM_027973895.1:c.195_403del | XM_027973895.1; 208bp deletion | 2017 | 29234093 | ||||||
| 232 | OMIA:000649-9940 | sheep | Texel (Sheep) | Microphthalmia | PITX3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 22 | NC_040273.1:g.25497953C>G | NM_001178053.1:c.338G>C | NP_001171524.1:p.(R113P) | Oar_v3.1 position is g.22045744C>G | 2010 | 20084168 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1267 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230750869G>A | XM_027968104.1:c.1186C>T | XP_027823905.1:p.(Q396*) | Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. | 2021 | 33159255 | |||
| 1266 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230766713T>C | XM_004006987.4:c.336-2A>G | XP_012031020.2:p.(L71Wfs*3) | 2021 | 33159255 | ||||
| 1353 | OMIA:001504-9940 | sheep | Neuronal ceroid lipofuscinosis, 1 | PPT1 | delins, small (<=20) | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.15235231_15235231delinsTTA | XP_004001885.2:p.(R151*) | 2019 | 31289301 | ||||||
| 1553 | OMIA:002693-9940 | sheep | Cheviot (Sheep) | Achondroplasia, PRICKLE1-related | PRICKLE1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3 | 10 bp deletion in the open reading frame | 2016 | Reference not in PubMed; see OMIA 002693-9940 for reference details | ||||||||
| 388 | OMIA:001139-9940 | sheep | Merino (Sheep) | Glycogen storage disease V | PYGM | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.44787090C>T | NM_001009192.2:c.2380-1G>A | a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 | rs402505013 | 1997 | 9267848 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1663 | OMIA:001867-9940 | sheep | Poll Dorset (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_Rambouillet_v1.0 | 4 | NC_040255.1:g.50288685C>T | NM_001306121.1:c.7088G>A | NP_001293050.1:p.(R2363H) | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | 39394905 | |||
| 673 | OMIA:001867-9940 | sheep | Spanish Churro (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.50313243_50313273del | NM_001306121.1:c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 506 | OMIA:001400-9940 | sheep | Texel (Sheep) | Chondrodysplasia, Texel | SLC13A1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.95624809del | XM_004008022.4:c.334del | Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 | 2012 | 22742499 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation. | ||||
| 1707 | OMIA:002862-9940 | sheep | Manech Tête Rousse, France (Sheep) | Haplotype with homozygous deficiency, SLC33A1-related | SLC33A1 | MTRDHH2 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.252649023dupG | XM_012100950.3:c.735dupG | XP_011956340.1:p.(R246Afs*3) | 2024 | 38922751 | |||
| 1608 | OMIA:002755-9940 | sheep | South Down (Sheep) | Congenital photosensitivity and hyperbilirubinaemia | SLCO1B3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 3 | NC_019460.1:g.193691915C>T | XM_012175224.1:c.1318G>A | XP_012030614.1:p.(G440R) | XM_012175224.1; XP_012030614.1 | 2018 | 29688779 | |||
| 1578 | OMIA:000975-9940 | sheep | Tail, short | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 8 | NC_040259.1:g.95879358C>A | XM_027972732.1:c.334G>T | XP_027828533.1:p.G112W | The gene is also called TBXT | 2018 | 35948368 29208649 | ||||
| 1595 | OMIA:002370-9940 | sheep | North Country Cheviot (Sheep) | Motor neuron disease, TMCO6-related | TMCO6 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 5 | NC_056058.1:g.49438388_49438391del | XM_012178620.3:c.645_648del | XP_012034010.1:p.(L215Ffs*34) | XP_012034010.1 | 2023 | 37488055 | |||
| 1042 | OMIA:002176-9940 | sheep | Coopworth (Sheep) Perendale (Sheep) | Meckel-like hepatorenal fibrocystic dysplasia syndrome | TMEM67 | haplotype | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 9 | NC_040260.1:g.[91651651A>C;91651669A>T] | XM_012184130.2:c.[2042T>A;2060T>G] | XP_012039520.2:p.[(I681N);(I687S)] | Published as c.[2050T>A; 2068T>G] | rs1086155906; rs1088172192 | 2017 | 28487520 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1238 | OMIA:002285-9940 | sheep | Merino (Sheep) | Ovine congenital progressive muscular dystrophy | TNNT1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.66970247del | XM_027978800.1:c.746+1del | Published as "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) | 2020 | 32819427 | |||||
| 906 | OMIA:001176-9940 | sheep | Scottish Blackface (Sheep) | Porphyria cutanea tarda | UROD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.20327971T>C | NM_001012341.1:c.392T>C | NP_001012341.1:p.(L131P) | Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively | rs429214636 | 2005 | 16026339 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.
| Overall Statistics | |
|---|---|
| Total number of variants | 57 |
| Variants with genomic location | 55 (96.5% ) |
| Variants in a variant database, i.e. with rs ID | 11 (19.3%) |
| Variant Type | Count | Percent |
|---|---|---|
| deletion, gross (>20) | 4 | 7.0% |
| deletion, small (<=20) | 11 | 19.3% |
| delins, small (<=20) | 2 | 3.5% |
| duplication | 3 | 5.3% |
| haplotype | 1 | 1.8% |
| insertion, gross (>20) | 1 | 1.8% |
| substitution | 35 | 61.4% |
| Variant Effect | Count | Percent |
|---|---|---|
| deletion (in-frame) | 1 | 1.8% |
| frameshift | 7 | 12.3% |
| missense | 19 | 33.3% |
| nonsense (stop-gain) | 14 | 24.6% |
| splicing | 5 | 8.8% |
| unknown | 11 | 19.3% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1997 | 1 | 1.8% |
| 1998 | 0 | 0.0% |
| 1999 | 0 | 0.0% |
| 2000 | 1 | 1.8% |
| 2001 | 0 | 0.0% |
| 2002 | 0 | 0.0% |
| 2003 | 1 | 1.8% |
| 2004 | 0 | 0.0% |
| 2005 | 1 | 1.8% |
| 2006 | 2 | 3.5% |
| 2007 | 0 | 0.0% |
| 2008 | 1 | 1.8% |
| 2009 | 0 | 0.0% |
| 2010 | 5 | 8.8% |
| 2011 | 2 | 3.5% |
| 2012 | 5 | 8.8% |
| 2013 | 2 | 3.5% |
| 2014 | 0 | 0.0% |
| 2015 | 3 | 5.3% |
| 2016 | 1 | 1.8% |
| 2017 | 5 | 8.8% |
| 2018 | 3 | 5.3% |
| 2019 | 1 | 1.8% |
| 2020 | 6 | 10.5% |
| 2021 | 6 | 10.5% |
| 2022 | 0 | 0.0% |
| 2023 | 1 | 1.8% |
| 2024 | 6 | 10.5% |
| 2025 | 4 | 7.0% |