Search Results

Advanced search

92 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Type of Variant Source of Genetic Variant Deleterious? Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Inferred EVA rsID Year Published PubMed ID(s) Acknowledgements
318 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.1938399G>T c.424G>T p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
857 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.2088231G>A c.805G>A p.(V269M) XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
233 OMIA:000662-9940 sheep Romney Marsh (Sheep) Motor neuron disease, lower AGTPBP1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.35795594G>C c.2909G>C p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1252 OMIA:001672-9940 sheep Zwartbles (Sheep) Type 1 Primary Hyperoxaluria AGXT missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.801189C>T c.584G>A p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
1486 OMIA:002162-9940 sheep Hypophosphatasia ALPL missense Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 2 g.260716094G>C c.1077C>G p.(I359M) XM_027965561.1; XP_027821362.1 2018 30446691
714 OMIA:000201-9940 sheep Merino (Sheep) White fleece ASIP Wt insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 13 a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH 2008 18493018
1112 OMIA:000201-9940 sheep Recessive black ASIP a missense Naturally occurring variant no Oar_rambouillet_v1.0 13 g.66474980T>A c.376T>A p.(C126S) Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 2008 18493018 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1111 OMIA:000201-9940 sheep Recessive black ASIP a deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 13 g.66475132_66475136del published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site 2002 12354151 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
439 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 regulatory Naturally occurring variant no Oar_v3.1 11 g.36938224T>A c.766+2831A>T ENSOART00000006875.1:c.766+2831A>T ENSOART00000006877.1:c.781+2831A>T rs588626728 2013 24086150
440 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 regulatory Naturally occurring variant no Oar_v3.1 11 g.37034573A>G 2013 24086150
1333 OMIA:001079-9940 sheep Spælsau yellow fat BCO2 insertion, gross (>20) Naturally occurring variant yes 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
320 OMIA:001079-9940 sheep Gammelnorsk spaelsau, Norway (Sheep) Yellow fat BCO2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 15 g.25024133C>T c.196C>T p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
244 OMIA:002306-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, Belclare BMP15 FecX(B) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594843C>A c.1100G>T p.(S367I) 2004 14627550 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
238 OMIA:002306-9940 sheep Olkuska (Sheep) Fecundity, Olkuska BMP15 FecX(O) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594934T>G c.1009A>C p.(N337H) Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
236 OMIA:002306-9940 sheep Lacaune (Sheep) Fecundity, Lacaune BMP15 FecX(L) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594981C>T c.962G>A p.(C321Y) cDNA position based on NP_001108239.1 2007 17038554 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
237 OMIA:002306-9940 sheep Grivette (Sheep) Fecundity, Grivette BMP15 FecX(Gr) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594993G>A c.950C>T p.(T317I) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
235 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Inverdale BMP15 FecX(I) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595047A>T c.896T>A p.(V299D) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively rs398521635 2000 10888873 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
335 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Hanna BMP15 FecX(H) nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595072G>A c.871C>T p.(Q291*) previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively rs413916687 2000 10888873
334 OMIA:002306-9940 sheep Cambridge (Sheep) Fecundity, Galway BMP15 FecX(G) nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595225G>A c.718C>T p.(Q239*) rs425019156 2004 14627550
521 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity, Rasa Aragonesa BMP15 FecX(R) deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595467_56595483del c.460_476del p.(W154Nfs*55) published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively 2008 18355397 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
755 OMIA:002306-9940 sheep Tunisian Barbary (Sheep) Fecundity, Barbarine BMP15 FecX(Bar) complex rearrangement Naturally occurring variant no Oar_rambouillet_v1.0 X g.[56600937insG;56600945_56600947del;56600948C>A] c.[301G>T;302_304delCTA;310insC] p.(A101Cfs*113) "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 2017 28506298
1341 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity BMP15 FecX(RA) missense Naturally occurring variant unknown Oar_v3.1 X g.50970948C>T c.1172C>T p.(T400I) protein position based on ENSOART00000010201 2020 31927415
1345 OMIA:002306-9940 sheep Blanc Du Massif Central (Sheep) Noir du Velay, France (Sheep) Fecundity BMP15 FecX(N) regulatory Naturally occurring variant unknown Oar_v3.1 X g.50977717T>A 2020 32636872
241 OMIA:000383-9940 sheep Booroola (Sheep) Small Tailed Han, China (Sheep) Fecundity, Booroola BMPR1B FecB(B) missense Naturally occurring variant no Oar_rambouillet_v1.0 6 g.34010859T>C c.914A>G p.(Q305R) Position on Oar_v3.1: g.29382188T>C rs418841713 2001 11259271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1403 OMIA:002342-9940 sheep Blanc Du Massif Central (Sheep) Lacaune (Sheep) Ciliary dyskinesia, primary (respiratory failure) CCDC65 LDHH6 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.147207999C>A c.521G>T p.(E111*) XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A rs1085624756 2021 35052387
1479 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR nonsense (stop-gain) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 4 g.57192317C>A c.1621G>T p.(G541*) NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence 2021 34632318
1478 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR deletion, small (<=20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 4 g.57218683_57218685del c.1518_1520del p.(F507del) NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence 2021 34632318
245 OMIA:000698-9940 sheep Rasa Aragonesa, Spain (Sheep) Myotonia CLCN1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.115541101G>A c.277G>A p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. cDNA and protein position predicted using Variant Effect Predictor ENSOART00020002372.1 rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
389 OMIA:001482-9940 sheep Borderdale, New Zealand (Sheep) Neuronal ceroid lipofuscinosis, 5 CLN5 splicing Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.56313269G>A c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
671 OMIA:001443-9940 sheep South Hampshire, New Zealand (Sheep) Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
234 OMIA:001443-9940 sheep Merino (Sheep) Neuronal ceroid lipofuscinosis, 6 CLN6 missense Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.16039510G>A c.184C>T p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1016 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.108958871C>T c.1618G>A p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
317 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 nonsense (stop-gain) Naturally occurring variant yes Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
914 OMIA:001354-9940 sheep Muscular hypertrophy (double muscling), Callipyge DLK1 regulatory Naturally occurring variant unknown Oar_rambouillet_v1.0 18 g.66187430A>G "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) rs10721113 2002 12368241 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
908 OMIA:001542-9940 sheep Corriedale (Sheep) Hypophosphatemic rickets, autosomal recessive, 1 DMP1 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.112910614C>T c.433C>T p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1550 OMIA:002687-9940 sheep Fleece variation, wool density EDAR regulatory Naturally occurring variant no Oar_v4.0 3 g.61927840T>C the T allele is associated denser wool production in fine wool sheep rs408766096 2023 37137429
930 OMIA:001765-9940 sheep West African Dwarf (Sheep) Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
621 OMIA:000437-9940 sheep Weißes Alpenschaf, Switzerland (Sheep) Haemophilia A F8 delins, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 X g.86301507_86301516delinsTAATTAATACC c.3108_3117delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. 210906 After checking the cDNA sequence in Fig. 3 of the paper, FN concluded that the 10bp deletion starts at c.3108 and ends at c.3117 and that the 11bp inserted sequence is GGTATTAATTA. Thus the HGVS-consistent notation is c.3108_3117delinsGGTATTAATTA, instead of c.3107del10ins11.
941 OMIA:001723-9940 sheep Romney Marsh (Sheep) Familial episodic ataxia FGF14 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.88095843G>A c.46C>T p.(Q16*) Oar_v3.1 position is g.77593415 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
225 OMIA:001703-9940 sheep Suffolk (Sheep) Chondrodysplasia, Spider lamb FGFR3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.128784747A>T c.1719T>A p.(V700E) 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
231 OMIA:002621-9940 sheep South Down (Sheep) Gaucher disease, type GBA missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.111561271C>T c.1142G>A p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
239 OMIA:002362-9940 sheep Wicklow Cheviot (Sheep) Fecundity, Thoka, FecG GDF9 FecG(T) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545130T>G c.1279A>C p.(S427R) Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively 2009 19713444 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
242 OMIA:002362-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, High fertility, FecG GDF9 FecG(H) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545225G>A c.1184C>T p.(S395F) Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively 2004 14627550 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
243 OMIA:002362-9940 sheep Gammelnorsk spaelsau, Norway (Sheep) Fecundity, Norwegian White Sheep GDF9 FecG(F) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545298C>T c.1111G>A p.(V371M) Oar_v3.1 position is g.41841285C>T, protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively rs403536877 2013 23280002 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
240 OMIA:002362-9940 sheep Pelibuey, Mexico (Sheep) Santa Ines, Brazil (Sheep) Fecundity, Embrapa, FecG GDF9 FecG(E) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545375A>C c.1034T>G p.(F345C) Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively rs1092755620 2011 20528846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1407 OMIA:002362-9940 sheep Icelandic (Sheep) Fecundity, Loa, FecG GDF9 FecG(L) deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545396_46545399del p.(N337Rfs*26) Oar_v3.1 position is g.41841383_41841386del 2021 34967038
246 OMIA:002362-9940 sheep Ile-De-France (Sheep) Fecundity, Vacaria, FecG GDF9 FecG(V) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545466G>A c.943C>T p.(R315C) Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively 2014 25039891 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
230 OMIA:000402-9940 sheep Romney Marsh (Sheep) Gangliosidosis, GM1 GLB1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 19 g.8003247C>A c.686G>T p.(C299F) cDNA position based on ENSOART00020038844.1 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
387 OMIA:001461-9940 sheep Jacob (Sheep) Gangliosidosis, GM2, type I (B variant) HEXA splicing Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.20584348C>G c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1153 OMIA:001952-9940 sheep Altay Fat-Rumped, China (Sheep) Microtia HMX1 duplication Naturally occurring variant yes Oar_rambouillet_v1.0 6 He et al. (2020): "a 76 bp duplication of HMX1" (duplication of 76bp segment 6:126893417-126893492) 2020 31691317
1285 OMIA:000806-9940 sheep Polyceraty HOXD1 deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.144548739_144548742del "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) 2021 33528505
319 OMIA:002229-9940 sheep Valle del Belice, Italy (Sheep) Hypotrichosis HR nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.45703202C>T c.1312C>T p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
805 OMIA:001528-9940 sheep INRA 401, France (Sheep) Fleece variation, woolly IRF2BP2 insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 25 insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene 2017 28379502
1272 OMIA:001948-9940 sheep Mouton vendéen, France (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7412626C>T c.2653C>T p.(R885*) c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 2020 33225458
543 OMIA:001948-9940 sheep Spanish Churro (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7425460_7425463del c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1549 OMIA:002687-9940 sheep Fleece variation, fine wool KRT74 missense Naturally occurring variant no Oar_v4.0 3 g.133486008C>A c.367C>A p.(H123N) XM_004006324.3; XP_004006373.1; the C allele is associated with wool fineness rs427563779 2023 37137429
507 OMIA:001678-9940 sheep German Blackheaded Mutton (Sheep) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 12 g.68856318_68856319del c.2746_2747del p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
915 OMIA:001694-9940 sheep Polypay (Sheep) Resistance to lentivirus LOC105603932 regulatory Naturally occurring variant no Oar_rambouillet_v1.0 20 g.32931861_32931862del Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). rs397514112 2013 24303974 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
905 OMIA:001505-9940 sheep Roslagsfår, Sweden (Sheep) Neuronal ceroid lipofuscinosis, 10 LOC443060 missense Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.51583020G>A c.883G>A p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1110 OMIA:001199-9940 sheep Valle del Belice, Italy (Sheep) Recessive pheomelanism MC1R e missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487353C>T c.199C>T p.(R67C) 2010 Reference not in PubMed; see OMIA 001199-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
229 OMIA:001199-9940 sheep Corriedale (Sheep) Dala (Sheep) Damara (Sheep) Merino (Sheep) Dominant black MC1R E^D missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487372T>A c.218T>A p.(M73K) 1999 9892731 c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
228 OMIA:001199-9940 sheep Massese, Italy (Sheep) Dominant black MC1R E^D missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487515G>A c.361G>A p.(D121N) 1999 9892731 c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1108 OMIA:001199-9940 sheep Gute (Sheep) Swedish Fur (Sheep) Värmlandsfår, Sweden (Sheep) Dominant black MC1R missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487606G>A c.452G>A p.(R151Q) 2019 31475378 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1217 OMIA:000031-9940 sheep Jacob (Sheep) Lilac MLPH nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 1 g.3580535C>A p.(E14*) Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) 2020 32512769
435 OMIA:000683-9940 sheep Texel (Sheep) Muscular hypertrophy (double muscling), Texel MSTN regulatory Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.129065977G>A c.*1232G>A "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" rs408469734 2006 16751773 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1242 OMIA:001595-9940 sheep Merino (Sheep) Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.236304072del c.1716del p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
1141 OMIA:002227-9940 sheep Istrska pramenka (Sheep) Otocephaly OTX2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.71478714G>A c.265C>T p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
1461 OMIA:002552-9940 sheep Pancreatic agenesis PDX1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 10 g.33940517_33940724del c.195_403del XM_027973895.1; 208bp deletion 2017 29234093
232 OMIA:000649-9940 sheep Texel (Sheep) Microphthalmia PITX3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 22 g.25497953C>G c.338G>C p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1267 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.230750869G>A c.1186C>T p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
1266 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 splicing Naturally occurring variant unknown Oar_rambouillet_v1.0 3 g.230766713T>C c.336-2A>G p.(L71Wfs*3) Oar_rambouillet_v1.0: g.230766713T>C; XM_012175630.3: c.336-2A>G; XP_012031020.2: p.Leu71TrpfsTer3 (Letko et al., 2020) 2021 33159255
1353 OMIA:001504-9940 sheep Neuronal ceroid lipofuscinosis, 1 PPT1 delins, small (<=20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 1 g.15235231_15235231delinsTTA p.(R151X) 2019 31289301
1553 OMIA:002693-9940 sheep Cheviot (Sheep) Achondroplasia, PRICKLE1-related PRICKLE1 deletion, small (<=20) Naturally occurring variant yes 3 10 bp deletion in the open reading frame 2016 Reference not in PubMed; see OMIA 002693-9940 for reference details
823 OMIA:000944-9940 sheep Ile-De-France (Sheep) Romanov (Sheep) Resistance to scrapie PRNP V missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675389C>T c.407C>T p.(A136V) Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs591379086 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
825 OMIA:000944-9940 sheep Resistance to scrapie, Nor98 type PRNP F missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675403C>T c.421C>T p.(L141F) Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs598580733 2005 15604451 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
824 OMIA:000944-9940 sheep Ile-De-France (Sheep) Romanov (Sheep) Resistance to scrapie PRNP H missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675443G>A c.461G>A p.(R154H) Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs605048948 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
822 OMIA:000944-9940 sheep Suffolk (Sheep) Resistance to scrapie PRNP Q missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675494G>A c.512G>A p.(R171Q) Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively rs160575103 1990 1969635 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
388 OMIA:001139-9940 sheep Glycogen storage disease V PYGM splicing Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.44787090C>T c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
673 OMIA:001867-9940 sheep Spanish Churro (Sheep) Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
926 OMIA:000483-9940 sheep Polled RXFP2 insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 10 "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" 2015 26103004
506 OMIA:001400-9940 sheep Texel (Sheep) Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.95624809del c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
1608 OMIA:002755-9940 sheep South Down (Sheep) Congenital photosensitivity and hyperbilirubinaemia SLCO1B3 missense Naturally occurring variant yes Oar_v3.1 3 g.193691915C>T c.1318G>A p.(G440R) XM_012175224.1; XP_012030614.1 2018 29688779
1420 OMIA:001744-9940 sheep Elevated milk leukocytes count SOCS2 missense Naturally occurring variant unknown Oar_rambouillet_v1.0 3 g.139302270C>T c.286C>T p.(R96C) Oar_v3.1 position g.129722200C>T, transcripts XM_027967202.1, ENSOART00020018904.1:c.286C>T ENSOARP00020015648.1:p.Arg96Cys rs868996547 2015 26658352
1578 OMIA:000975-9940 sheep Tail, short T missense Naturally occurring variant unknown c.334C>A p.G112W The gene is also called TBXT 2022 35948368 29208649
1595 OMIA:002370-9940 sheep North Country Cheviot (Sheep) Motor neuron disease, TMCO6-related TMCO6 deletion, small (<=20) Naturally occurring variant yes ARS-UI_Ramb_v2.0 5 g.49438388_49438391del c.645_648del p.(L215Ffs*34) XP_012034010.1 2023 37488055
1042 OMIA:002176-9940 sheep Coopworth (Sheep) Perendale (Sheep) Meckel-like hepatorenal fibrocystic dysplasia syndrome TMEM67 haplotype Naturally occurring variant yes Oar_rambouillet_v1.0 9 g.[91651651A>C;91651669A>T] c.[2042T>A;2060T>G] p.[(I681N);(I687S)] Published as c.[2050T>A; 2068T>G]; protein and cDNA positions in the table are based on XP_012039520.2 and XM_012184130.2, respectively. rs1086155906; rs1088172192 2017 28487520 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1238 OMIA:002285-9940 sheep Merino (Sheep) Ovine congenital progressive muscular dystrophy TNNT1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 14 g.66970247del c.614+1del "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) is a splice variant 210906 to conform with HGVS notation, FN deleted the "G" from g.66970247delG and c.614+1delG 2020 32819427
227 OMIA:001249-9940 sheep Brown TYRP1 missense Naturally occurring variant no Oar_rambouillet_v1.0 2 c.2240C>G p.(A???V) 2013 23451726
1127 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS1 deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87540706_87540707del c.86_87del p.(E29Vfs*5) NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) 2019 31571241 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA
226 OMIA:001249-9940 sheep Soay (Sheep) Tawny (light brown) TYRP1 b^Soay missense Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87545636G>T c.869G>T p.(C290F) rs402624085 2007 17254985 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1128 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS2 nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87549195C>T c.1066C>T p.(R356*) NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) rs1085637427 2019 31571241
906 OMIA:001176-9940 sheep Scottish Blackface (Sheep) Porphyria cutanea tarda urod missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.20327971T>C c.392T>C p.(L131P) Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively rs429214636 2005 16026339 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
Overall Statistics
Total number of variants 92
Variants with genomic location 89 (96.7% )
Variants in a variant database, i.e. with rs ID 29 (31.5%)
Variant Type Count Percent
complex rearrangement 1 1.1%
deletion, gross (>20) 4 4.3%
deletion, small (<=20) 13 14.1%
delins, small (<=20) 2 2.2%
duplication 1 1.1%
haplotype 1 1.1%
insertion, gross (>20) 4 4.3%
missense 39 42.4%
nonsense (stop-gain) 16 17.4%
regulatory 7 7.6%
splicing 4 4.3%
Year First Reported Count Percent
1990 1 1.1%
1991 0 0.0%
1992 0 0.0%
1993 2 2.2%
1994 0 0.0%
1995 0 0.0%
1996 0 0.0%
1997 1 1.1%
1998 0 0.0%
1999 2 2.2%
2000 3 3.3%
2001 1 1.1%
2002 2 2.2%
2003 1 1.1%
2004 3 3.3%
2005 2 2.2%
2006 3 3.3%
2007 2 2.2%
2008 4 4.3%
2009 1 1.1%
2010 6 6.5%
2011 3 3.3%
2012 5 5.4%
2013 9 9.8%
2014 1 1.1%
2015 5 5.4%
2016 1 1.1%
2017 7 7.6%
2018 3 3.3%
2019 4 4.3%
2020 9 9.8%
2021 8 8.7%
2022 0 0.0%
2023 3 3.3%