Search Results

Advanced search

79 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

OMIA ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Type of Variant Source of Genetic Variant Deleterious? Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Inferred EVA rsID Year Published PubMed ID(s) Acknowledgements
OMIA 000328-9940 sheep White Dorper Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.1938399G>T c.424G>T p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000328-9940 sheep White Dorper Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.2088231G>A c.805G>A p.(V269M) XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000662-9940 sheep Romney Marsh Motor neuron disease, lower AGTPBP1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.35795594G>C c.2909G>C p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001672-9940 sheep Zwartbles Type 1 Primary Hyperoxaluria AGXT missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.801189C>T c.584G>A p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
OMIA 000201-9940 sheep Merino White fleece ASIP Wt insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 13 a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH 2008 18493018
OMIA 000201-9940 sheep Recessive black ASIP a missense Naturally occurring variant no Oar_rambouillet_v1.0 13 g.66474980T>A c.376T>A p.(C126S) Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 2008 18493018 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000201-9940 sheep Recessive black ASIP a deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 13 g.66475132_66475136del published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site 2002 12354151 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001885-9940 sheep Lacaune Fecundity, Lacaune, FecL B4GALNT2 regulatory Naturally occurring variant no Oar_v3.1 11 g.36938224T>A rs588626728 2013 24086150
OMIA 001885-9940 sheep Lacaune Fecundity, Lacaune, FecL B4GALNT2 regulatory Naturally occurring variant no Oar_v3.1 11 g.37034573A>G 2013 24086150
OMIA 001079-9940 sheep Spælsau yellow fat BCO2 insertion, gross (>20) Naturally occurring variant yes 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
OMIA 001079-9940 sheep Norwegian White Yellow fat BCO2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 15 g.25024133C>T c.196C>T p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002306-9940 sheep Belclare Irish Cambridge Fecundity, Belclare BMP15 FecX(B) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594843C>A c.1100G>T p.(S367I) 2004 14627550 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Olkuska Fecundity, Olkuska BMP15 FecX(O) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594934T>G c.1009A>C p.(N337H) Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Lacaune Fecundity, Lacaune BMP15 FecX(L) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594981C>T c.962G>A p.(C321Y) cDNA position based on NP_001108239.1 2007 17038554 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Grivette Fecundity, Grivette BMP15 FecX(Gr) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56594993G>A c.950C>T p.(T317I) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Romney Marsh Fecundity, Inverdale BMP15 FecX(I) missense Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595047A>T c.896T>A p.(V299D) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively rs398521635 2000 10888873 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Romney Marsh Fecundity, Hanna BMP15 FecX(H) nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595072G>A c.871C>T p.(Q291*) previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively rs413916687 2000 10888873
OMIA 002306-9940 sheep Irish Cambridge Fecundity, Galway BMP15 FecX(G) nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595225G>A c.718C>T p.(Q239*) rs425019156 2004 14627550
OMIA 002306-9940 sheep Rasa Aragonesa Fecundity, Rasa Aragonesa BMP15 FecX(R) deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 X g.56595467_56595483del c.460_476del p.(W154Nfs*55) published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively 2008 18355397 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002306-9940 sheep Tunisian Barbarine Fecundity, Barbarine BMP15 FecX(Bar) complex rearrangement Naturally occurring variant no Oar_rambouillet_v1.0 X g.[56600937insG;56600945_56600947del;56600948C>A] c.[301G>T;302_304delCTA;310insC] p.(A101Cfs*113) "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 2017 28506298
OMIA 002306-9940 sheep Rasa Aragonesa Fecundity BMP15 FecX(RA) missense Naturally occurring variant unknown Oar_v3.1 X g.50970948C>T c.1172C>T p.(T400I) protein position based on ENSOART00000010201 2020 31927415
OMIA 002306-9940 sheep Blanche du Massif Central Noire du Velay Fecundity BMP15 FecX(N) regulatory Naturally occurring variant unknown Oar_v3.1 X g.50977717T>A 2020 32636872
OMIA 000383-9940 sheep Booroola Han, small-tailed Fecundity, Booroola BMPR1B FecB(B) missense Naturally occurring variant no Oar_rambouillet_v1.0 6 g.34010859T>C c.914A>G p.(Q305R) Position on Oar_v3.1: g.29382188T>C rs418841713 2001 11259271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000698-9940 sheep Rasa Aragonesa Myotonia CLCN1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.115541101G>A c.277G>A p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. cDNA and protein position predicted using Variant Effect Predictor ENSOART00020002372.1 rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001482-9940 sheep Borderdale Neuronal ceroid lipofuscinosis, 5 CLN5 splicing Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.56313269G>A c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001443-9940 sheep South Hampshire Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
OMIA 001443-9940 sheep Merino Neuronal ceroid lipofuscinosis, 6 CLN6 missense Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.16039510G>A c.184C>T p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001481-9940 sheep Awassi Achromatopsia-2 (day blindness) CNGA3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.108958871C>T c.1618G>A p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 001481-9940 sheep Awassi Achromatopsia-2 (day blindness) CNGA3 nonsense (stop-gain) Naturally occurring variant yes Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
OMIA 001354-9940 sheep Muscular hypertrophy (double muscling), Callipyge DLK1 regulatory Naturally occurring variant unknown Oar_rambouillet_v1.0 18 g.66187430A>G "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) rs10721113 2002 12368241 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 001542-9940 sheep Corriedale Hypophosphatemic rickets, autosomal recessive, 1 DMP1 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.112910614C>T c.433C>T p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001765-9940 sheep Cameroon Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
OMIA 000437-9940 sheep Swiss Alpine Haemophilia A F8 delins, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 X g.86301507_86301516delinsTAATTAATACC c.3108_3117delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. 210906 After checking the cDNA sequence in Fig. 3 of the paper, FN concluded that the 10bp deletion starts at c.3108 and ends at c.3117 and that the 11bp inserted sequence is GGTATTAATTA. Thus the HGVS-consistent notation is c.3108_3117delinsGGTATTAATTA, instead of c.3107del10ins11.
OMIA 001723-9940 sheep Romney Marsh Familial episodic ataxia FGF14 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.88095843G>A c.46C>T p.(Q16*) Oar_v3.1 position is g.77593415 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001703-9940 sheep Suffolk Chondrodysplasia, Spider lamb FGFR3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.128784747A>T c.1719T>A p.(V700E) 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000405-9940 sheep Southdown Gaucher disease, type GBA missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.111561271C>T c.1142G>A p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002362-9940 sheep Cheviot Fecundity, Thoka, FecG GDF9 FecG(T) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545130T>G c.1279A>C p.(S427R) Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively 2009 19713444 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002362-9940 sheep Belclare Irish Cambridge Fecundity, High fertility, FecG GDF9 FecG(H) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545225G>A c.1184C>T p.(S395F) Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively 2004 14627550 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002362-9940 sheep Norwegian White Fecundity, Norwegian White Sheep GDF9 FecG(F) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545298C>T c.1111G>A p.(V371M) Oar_v3.1 position is g.41841285C>T, protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively rs403536877 2013 23280002 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002362-9940 sheep Brazilian Santa Inês Mexican Pelibuey Fecundity, Embrapa, FecG GDF9 FecG(E) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545375A>C c.1034T>G p.(F345C) Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively rs1092755620 2011 20528846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002362-9940 sheep Ile de France Fecundity, Vacaria, FecG GDF9 FecG(V) missense Naturally occurring variant no Oar_rambouillet_v1.0 5 g.46545466G>A c.943C>T p.(R315C) Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively 2014 25039891 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000402-9940 sheep Romney Marsh Gangliosidosis, GM1 GLB1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 19 g.8003247C>A c.686G>T p.(C299F) cDNA position based on ENSOART00020038844.1 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001461-9940 sheep Jacob Gangliosidosis, GM2, type I (B variant) HEXA splicing Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.20584348C>G c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001952-9940 sheep Altay Microtia HMX1 duplication Naturally occurring variant yes Oar_rambouillet_v1.0 6 He et al. (2020): "a 76 bp duplication of HMX1" (duplication of 76bp segment 6:126893417-126893492) 2020 31691317
OMIA 000806-9940 sheep Polyceraty HOXD1 deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.144548739_144548742del "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) 2021 33528505
OMIA 002229-9940 sheep Valle del Belice Hypotrichosis HR nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.45703202C>T c.1312C>T p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001528-9940 sheep Romane Fleece variation, woolly IRF2BP2 insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 25 insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene 2017 28379502
OMIA 001948-9940 sheep Mouton Vendeen Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7412626C>T c.2653C>T p.(R885*) c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 2020 33225458
OMIA 001948-9940 sheep Churra Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7425460_7425463del c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001678-9940 sheep German Blackheaded Mutton Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 12 g.68856318_68856319del c.2746_2747del p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001694-9940 sheep Polypay Resistance to lentivirus LOC105603932 regulatory Naturally occurring variant no Oar_rambouillet_v1.0 20 g.32931861_32931862del Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). rs397514112 2013 24303974 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001505-9940 sheep Swedish Landrace Neuronal ceroid lipofuscinosis, 10 LOC443060 missense Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.51583020G>A c.883G>A p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Valle del Belice Recessive pheomelanism MC1R e missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487353C>T c.199C>T p.(R67C) 2010 Reference not in PubMed; see OMIA 001199-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Corriedale Dala Damara Merino Dominant black MC1R E^D missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487372T>A c.218T>A p.(M73K) 1999 9892731 c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Massese Dominant black MC1R E^D missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487515G>A c.361G>A p.(D121N) 1999 9892731 c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Gotland Gute Värmland Dominant black MC1R missense Naturally occurring variant no Oar_rambouillet_v1.0 14 g.15487606G>A c.452G>A p.(R151Q) 2019 31475378 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000031-9940 sheep Jacob Lilac MLPH nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 1 g.3580535C>A p.(E14*) Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) 2020 32512769
OMIA 001426-9940 sheep Texel Muscular hypertrophy (double muscling), Texel MSTN regulatory Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.129065977G>A c.*1232G>A "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" rs408469734 2006 16751773 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001595-9940 sheep Merino Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.236304072del c.1716del p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
OMIA 002227-9940 sheep Istrian Pramenka Otocephaly OTX2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.71478714G>A c.265C>T p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
OMIA 000649-9940 sheep Texel Microphthalmia PITX3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 22 g.25497953C>G c.338G>C p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002105-9940 sheep Swaledale Neuroaxonal dystrophy, PLA2G6-related PLA2G6 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.230750869G>A c.1186C>T p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
OMIA 002105-9940 sheep Swaledale Neuroaxonal dystrophy, PLA2G6-related PLA2G6 splicing Naturally occurring variant unknown Oar_rambouillet_v1.0 3 g.230766713T>C c.336-2A>G p.(L71Wfs*3) Oar_rambouillet_v1.0: g.230766713T>C; XM_012175630.3: c.336-2A>G; XP_012031020.2: p.Leu71TrpfsTer3 (Letko et al., 2020) 2021 33159255
OMIA 001504-9940 sheep Neuronal ceroid lipofuscinosis, 1 PPT1 delins, small (<=20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 1 g.15235231_15235231delinsTTA p.(R151X) 2019 31289301
OMIA 000944-9940 sheep Ile de France Romanov Resistance to scrapie PRNP V missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675389C>T c.407C>T p.(A136V) Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs591379086 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Norwegian breeds Resistance to scrapie, Nor98 type PRNP F missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675403C>T c.421C>T p.(L141F) Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs598580733 2005 15604451 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Ile de France Romanov Resistance to scrapie PRNP H missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675443G>A c.461G>A p.(R154H) Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs605048948 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Suffolk Resistance to scrapie PRNP Q missense Naturally occurring variant yes Oar_rambouillet_v1.0 13 g.48675494G>A c.512G>A p.(R171Q) Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively rs160575103 1990 1969635 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001139-9940 sheep Glycogen storage disease V PYGM splicing Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.44787090C>T c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001867-9940 sheep Churra Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000483-9940 sheep Numerous breeds Polled RXFP2 insertion, gross (>20) Naturally occurring variant no Oar_rambouillet_v1.0 10 "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" 2015 26103004
OMIA 001400-9940 sheep Texel Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.95624809del c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
OMIA 002176-9940 sheep Coopworth Perendale Meckel-like hepatorenal fibrocystic dysplasia syndrome TMEM67 haplotype Naturally occurring variant yes Oar_rambouillet_v1.0 9 g.[91651651A>C;91651669A>T] c.[2042T>A;2060T>G] p.[(I681N);(I687S)] Published as c.[2050T>A; 2068T>G]; protein and cDNA positions in the table are based on XP_012039520.2 and XM_012184130.2, respectively. rs1086155906; rs1088172192 2017 28487520 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002285-9940 sheep Merino Ovine congenital progressive muscular dystrophy TNNT1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 14 g.66970247del c.614+1del "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) is a splice variant 210906 to conform with HGVS notation, FN deleted the "G" from g.66970247delG and c.614+1delG 2020 32819427
OMIA 001249-9940 sheep Brown TYRP1 missense Naturally occurring variant no Oar_rambouillet_v1.0 2 c.2240C>G p.(A???V) 2013 23451726
OMIA 001249-9940 sheep Valais Red Brown TYRP1 b^VS1 deletion, small (<=20) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87540706_87540707del c.86_87del p.(E29Vfs*5) NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) 2019 31571241 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA
OMIA 001249-9940 sheep Soay Tawny (light brown) TYRP1 b^Soay missense Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87545636G>T c.869G>T p.(C290F) rs402624085 2007 17254985 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001249-9940 sheep Valais Red Brown TYRP1 b^VS2 nonsense (stop-gain) Naturally occurring variant no Oar_rambouillet_v1.0 2 g.87549195C>T c.1066C>T p.(R356*) NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) rs1085637427 2019 31571241
OMIA 001176-9940 sheep German Blackface Porphyria cutanea tarda urod missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.20327971T>C c.392T>C p.(L131P) Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively rs429214636 2005 16026339 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
Overall Statistics
Total number of variants 79
Variants with genomic location 78 (98.7% )
Variants in a variant database, i.e. with rs ID 25 (31.6%)
Variant Type Count Percent
complex rearrangement 1 1.3%
deletion, gross (>20) 3 3.8%
deletion, small (<=20) 9 11.4%
delins, small (<=20) 2 2.5%
duplication 1 1.3%
haplotype 1 1.3%
insertion, gross (>20) 4 5.1%
missense 34 43.0%
nonsense (stop-gain) 14 17.7%
regulatory 6 7.6%
splicing 4 5.1%
Year First Reported Count Percent
1990 1 1.3%
1991 0 0.0%
1992 0 0.0%
1993 2 2.5%
1994 0 0.0%
1995 0 0.0%
1996 0 0.0%
1997 1 1.3%
1998 0 0.0%
1999 2 2.5%
2000 3 3.8%
2001 1 1.3%
2002 2 2.5%
2003 1 1.3%
2004 3 3.8%
2005 2 2.5%
2006 3 3.8%
2007 2 2.5%
2008 4 5.1%
2009 1 1.3%
2010 6 7.6%
2011 3 3.8%
2012 5 6.3%
2013 9 11.4%
2014 1 1.3%
2015 4 5.1%
2016 0 0.0%
2017 6 7.6%
2018 0 0.0%
2019 4 5.1%
2020 9 11.4%
2021 4 5.1%