Search Results
Advanced search
Link to this search: https://omia.org/results/?search_type=advanced&gb_species_id=9913&result_type=variant&defect=yes&singlelocus=yes&characterised=yes
262 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1126 | OMIA:002238-9913 | taurine cattle | Shorthorn (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.103016791A>G | c.6776T>C | p.(L2259P) | NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) | rs5334475100 | 2019 | 31568573 | ||
| 1220 | OMIA:002238-9913 | taurine cattle | Polled Hereford (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.103043495_103043496insG | c.5689_5690insC | p.(S1784Ifs*33) | BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) | rs3423092881 | 2020 | 32567073 | ||
| 195 | OMIA:002238-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.103030489T>C | NM_001191294.2:c.5804A>G | NP_001178223.2:p.(H1935R) | previously listed in OMIA as ARS-UCD1.2:g.103025585T>C, g. coordinates have been corrected after review of original paper and incorrectly assigned EVA rs ID has been removed [29/08/2024] | 2008 | 18344998 | |||
| 1477 | OMIA:002561-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Infertility | ABHD16B | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 13 | NC_037340.1:g.53957903G>A | NM_001038541.2:c.652C>T | NP_001033630.1:p.(Q218*) | ENSBTAT00000045249.4; ENSBTAP00000055253.1 | rs468948776 | 2020 | 31963602 | ||
| 429 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) | Bulldog calf | ACAN | BD2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20377856C>T | c.-198C>T | rs3423095877 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 590 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) Highland (Cattle) | Bulldog calf | ACAN | BD1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20422104_20422105insGGCA | c.2266_2267insGGCA | Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1419 | OMIA:002226-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH34 | ACSL5 | BH34 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.32940521C>G | NM_001075650.1:c.528C>G | NP_001069118.1:p.(N176K) | NM_001075650.1 | rs5357452907 | 2021 | 34915862 | |
| 486 | OMIA:000328-9913 | taurine cattle | Belgian Blue (Cattle) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.2017035_2017051delinsAGC | c.464_480delinsAGC | 1999 | 10417273 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||||
| 1163 | OMIA:001562-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Pulmonary hypoplasia and anasarca syndrome | ADAMTS3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.87462016G>A | NM_001192797.1:c.1222C>T | NP_001179726.1:p.(H408T) | NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) | rs5334475098 | 2020 | 32069517 | ||
| 935 | OMIA:001511-9913 | taurine cattle | Angus (Cattle) | Contractual arachnodactyly (Fawn calf syndrome) | ADAMTSL3 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 21 | "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" | 2014 | Reference not in PubMed; see OMIA 001511-9913 for reference details | ||||||||
| 1435 | OMIA:002535-9913 | taurine cattle | Original Swiss Brown (Cattle) | Congenital cataract | ADAMTSL4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.20146737C>T | NM_001101061.1:c.2327G>A | NP_001094531.1:p.(R776H) | NM_001101061.1; NP_001094531.1 | rs5353205567 | 2022 | 35233794 | ||
| 934 | OMIA:002135-9913 | taurine cattle | Angus (Cattle) | Arthrogryposis multiplex congenita, AGRN-related | AGRN | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 16 | A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) | 2011 | Reference not in PubMed; see OMIA 002135-9913 for reference details | ||||||||
| 1629 | OMIA:002788-9913 | taurine cattle | Holstein Friesian (Cattle) | Subfertility, AK9-related | AK9 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 9 | g.40620329A>G | rs457222030 | 2021 | 34028060 | |||||
| 764 | OMIA:001009-9913 | taurine cattle | Shorthorn (Cattle) | Tibial hemimelia | ALX4 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | Deletion of 45,694 bp including exon 1 of ALX4 | 2012 | Reference not in PubMed; see OMIA 001009-9913 for reference details | ||||||||
| 763 | OMIA:001009-9913 | taurine cattle | Galloway (Cattle) | Tibial hemimelia | ALX4 | ALX4dup-GAU / ALX4dup-LfL | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 15 | NC_037342.1:g.74384919_74384938dup | NM_001030304.1:c.713_732dup | NP_001025475.1:p.(Q245fs) | Initially reported as g.75154399_75154418dup in UMD3.1 and g.74384916_74384935dup in ARS-UCD1.2.. Updated to current coordinates after publication of a correction by the authors (PMID: 39298916) [23/09/2024]. The variant is now identical to a variant reported by Buitkamp et al. (2023, PMID:36585373), which was previously listed as omia.variant:1516. Both variants are now merged into one entry and omia.variant:1516 is redundant. | 2015 | 26076463 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022). | |
| 927 | OMIA:002083-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Abortion (embryonic lethality), ANXA10-related | ANXA10 | repeat variation | Naturally occurring variant | Not currently evaluated | 8 | "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." | 2016 | 27881083 | ||||||||
| 286 | OMIA:000001-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) | Abortion due to a nonsense mutation in APAF1 on haplotype HH1 | APAF1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | g.62810245C>T | XM_015471110.2:c.1735C>T | XP_015326596.1:p.(Q579*) | Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. Previously listed in OMIA as: p.(Q581*), c.1741C>T, updated to recent transcript information [03/09/2024] | rs448942533 | 2016 | 27289157 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 731 | OMIA:001965-9913 | taurine cattle | Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Holstein cholesterol deficiency | APOB | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" | 2016 | 26763170 | Additional breed inforamtion based on PMID: 40312951 | ||||||
| 780 | OMIA:001334-9913 | taurine cattle | Swedish Red (Cattle) | Sperm, short tail | ARMC3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 13 | g.24024660del | c.1442del | p.(A451fs*26) | rs797454424 | 2016 | 26923438 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 289 | OMIA:000194-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) | Citrullinaemia | ASS1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.100781668C>T | NM_173892.4:c.256C>T | NP_776317.1:p.(R86*) | Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. | rs5334475062 | 1989 | 2813370 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 188 | OMIA:001450-9913 OMIA:001464-9913 | taurine cattle | Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) | Congenital muscular dystonia 1 | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25933247G>A | NM_001075767.1:c.1675C>T | NP_001069235.1:p.(R559C) | Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). | rs5334475104 | 2008 | 18344998 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). | |
| 219 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25939141C>A | NM_001075767.1:c.857G>T | NP_001069235.1:p.(G286V) | This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. | rs3423529256 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 218 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25939366C>A | NM_001075767.1:c.632G>T | NP_001069235.1:p.(G211V) | rs5334474971 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 205 | OMIA:001464-9913 | taurine cattle | Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.25940510C>T | NM_001075767.1:c.491G>A | NP_001069235.1:p.(R164H) | Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 | rs3423529241 | 2008 | 18786632 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 298 | OMIA:000627-9913 | taurine cattle | Polled Hereford (Cattle) | Maple syrup urine disease | BCKDHA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.50551011C>T | c.148C>T | p.(Q50*) | cDNA position based on ENSBTAT00000021342.6 | rs5334475064 | 1990 | 2303405 | ||
| 200 | OMIA:000627-9913 | taurine cattle | Shorthorn (Cattle) | Maple syrup urine disease | BCKDHA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.50560242C>T | c.1380C>T | p.(P372L) | rs3423447991 | 1999 | 10425233 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1766 | OMIA:002913-9913 | taurine cattle | Holstein Friesian (Cattle) | Cardiac malformation, BRI3BP-related | BRI3BP | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.50813902C>T | NM_001099087.1:c.478G>A | NP_001092557.1:p.(V160I) | likely de novo variant | 2025 | 39593234 | |||
| 981 | OMIA:001991-9913 | taurine cattle | Nordic Red (Cattle) | Stillbirth | BTBD9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 23 | "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" | 2016 | 27091210 | ||||||||
| 1660 | OMIA:002819-9913 | taurine cattle | Holstein Friesian (Cattle) | Muscle weakness | CACNA1S | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.79613592C>T | XM_024976574.1:c.3853G>A | XP_024832342.1:p.G1285S | ENSBTAT00000065901.3; ENSBTAP00000054797.3 | rs3423414874 | 2024 | 38246543 | ||
| 1087 | OMIA:002201-9913 | taurine cattle | Normande (Cattle) | Abortion due to haplotype NH7 | CAD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.72409143T>C | p.(Y452C) | published as CAD g.72399397T>C; p.Tyr452Cys | rs5334475092 | 2019 | 31056337 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1032 | OMIA:002167-9913 | taurine cattle | Nordic Red (Cattle) | Asthenospermia | CCDC189 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 25 | g.26880841C>T | Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." | rs5334474909 | 2019 | 30975085 | ||||
| 1528 | OMIA:002626-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Haplotype with homozygous deficiency JBH17, CDC45-related | CDC45 | substitution | splicing | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 17 | g.74743512G>T | located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing | 2021 | 33758295 | |||||
| 991 | OMIA:001830-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH7 | CENPU | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 27 | g.15123637_15123640del | Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." | 2020 | 31733857 | |||||
| 964 | OMIA:001502-9913 | taurine cattle | Montbéliarde (Cattle) | Caprine-like Generalized Hypoplasia Syndrome | CEP250 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 13 | g.64710424C>T | c.493C>T | p.(Q165*) | rs5334474991 | 2015 | 25902731 | Coordinates obtained from and/or confirmed by EBI's VEP | ||
| 838 | OMIA:002125-9913 | taurine cattle | Montbéliarde (Cattle) | Neurocristopathy | CHD7 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.26402250_26402254del | p.(K594Afs*29) | 2017 | 28904385 | |||||
| 554 | OMIA:002022-9913 | taurine cattle | Red Dane (Cattle) | Arthrogryposis multiplex congenita, CHRNB1-related | CHRNB1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.27122027del | NM_174516.2:c.55del | NP_776941.1:p.(A19Pfs47*) | Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) | rs5334474854 | 2016 | 27364156 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 210 | OMIA:001887-9913 | taurine cattle | Belgian Blue (Cattle) | Osteopetrosis with gingival hamartomas | CLCN7 | haplotype | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 25 | g.[1139611G>T; 1139613A>G] | c.[2248T>C;2250C>A] | p.(Y750Q) | 2014 | 24159188 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 648 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | 37kb deletion of exons 1-4 | 2000 | 10810088 | |||||||
| 781 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 1 | "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised | 2002 | 12047224 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||||||
| 1669 | OMIA:002432-9913 | taurine cattle | Hereford (Cattle) | Retinal degeneration, CLN3-realted | CLN3 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 25 | NC_037352.1:g.26043843del | NM_001075174.2:c.1106del | NP_001068642.2:p.(P369Rfs*8) | NM_001075174.2; NP_001068642.2 | rs5377951844 | 2024 | 38516801 | ||
| 593 | OMIA:001482-9913 | taurine cattle | Devon (Cattle) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.52112732_52112733insG | c.662_663insG | p.(R221Gfs*6) | 2006 | 16935476 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG | |||
| 1400 | OMIA:001365-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Achromatopsia | CNGB3 | OH1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.76011964G>A | XM_015474554.2:c.751G>A | XP_015330040.2:p.(D251N) | XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn | rs716218235 | 2021 | 34830323 | |
| 839 | OMIA:002127-9913 | taurine cattle | Simmental (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36470764_36470767delinsT | c.3145_3148delinsT | p.(A1049_P1050delinsS) | UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 | rs876049195 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1031 | OMIA:002127-9913 | taurine cattle | Red Angus (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36463798G>A | NM_001034039.2:c.1063G>A | NP_001029211.1:p.(G355S) | Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) | rs3423092630 | 2019 | 30788588 | ||
| 1289 | OMIA:002127-9913 | taurine cattle | Holstein (black and white) (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36473359T>A | NM_001034039.2:c.3917T>A | NP_001029211.1:p.(V1306E) | NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) | rs5334474947 | 2021 | 33672767 | ||
| 1698 | OMIA:002127-9913 | taurine cattle | Normande (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.36473965G>A | NM_001034039.2:c.4234G>A | NP_001029211.1:p.(D1412N) | 2024 | 38773368 | ||||
| 1837 | OMIA:002112-9913 | taurine cattle | Stabiliser, United Kingdom of Great Britain and Northern Ireland (Cattle) | Osteogenesis imperfecta | COL1A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.11792118G > A | NM_174520.2:c.1156G > A | NP_776945.1:p.(G386R) | 2025 | 40999323 | ||||
| 1275 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.32301911_32308589del | "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) | 2021 | 33316082 | ||||||
| 1241 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.32303127_32306640delinsTCTGGGGAGC | 2020 | 32894162 | |||||||
| 840 | OMIA:001926-9913 | taurine cattle | Charolais (Cattle) Salers (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32301746G>A | NM_001001135.3:c.1799G>A | NP_001001135.2:p.(G600D) | previously listed in OMIA as c.1791G>A, updated to reflect recent transcrupt inforamtion [03/09/2024] | rs5334474917 | 2017 | 28904385 | ||
| 842 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32303739G>A | NM_001001135.3:c.2158G>A | NP_001001135.2:p.(G720S) | rs455596159 | 2017 | 28904385 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 414 | OMIA:001926-9913 | taurine cattle | Danish Holstein (Cattle) | bulldog calf | COL2A1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32305226G>A | NM_001001135.3:c.2463+1G>A | rs5334475095 | 2016 | 27296271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 223 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32307658G>A | NM_001001135.3:c.2878G>A | NP_001001135.2:p.(G960R) | rs3423194986 | 2014 | 25017103 | |||
| 841 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32308008G>A | NM_001001135.3:c.2986G>A | NP_001001135.2:p.(G996S) | rs876243579 | 2017 | 28904385 | |||
| 1026 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32308734G>A | NM_001001135.3:c.3166G>A | NP_001001135.2:p.(G1056S) | rs5334475093 | 2019 | 30378686 | |||
| 1835 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Achondrogenesis | COL2A1 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.32312706_32312717del | NM_001001135.3:c.4432_4443del | NP_001001135.2:p.(G1478_I1481del) | 2025 | 40999323 | ||||
| 1263 | OMIA:002295-9913 | taurine cattle | Holstein (black and white) (Cattle) | Ehlers-Danlos syndrome, classic type, 2 | COL5A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.7331916G>T | XM_024979774.1:c.2366G>T | XP_024835542.1:p.(G789V) | XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) | rs5334475045 | 2020 | 33143196 | ||
| 1184 | OMIA:002260-9913 | taurine cattle | Holstein Friesian (Cattle) | de novo mutation in an AI sire | COL6A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.116826597G>A | XM_024990262.1:c.5675C>T | XP_024846030.1:p.(T1892M) | Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. p. coordinates have been updated to reflect recent NCBI transcript [29/08/2024]. | rs5334475059 | 2017 | 28904385 | ||
| 292 | OMIA:000341-9913 | taurine cattle | Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) | Epidermolysis bullosa, dystrophic | COL7A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.51301158C>T | c.4762C>T | p.(R1588*) | rs876174537 | 2012 | 22715415 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 358 | OMIA:002111-9913 | taurine cattle | Holstein (red and white) (Cattle) | Cataract, recessive, CPAMD8-related | CPAMD8 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.6073556C>T | XM_015471929.2:c.220C>T | XP_015327415.2:p.(Q74*) | rs5334474964 | 2017 | 28683140 | |||
| 1418 | OMIA:002519-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH24 | CPT1C | BH24 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.56098048G>A | XM_002695120.5:c.158G>A | XP_002695166.2:p.(G53D) | XM_002695120.5 | rs719328437 | 2021 | 34915862 | |
| 1186 | OMIA:002262-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | CSNK1G2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.44265842G>C | p.(D164H) | Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475073 | 2017 | 28904385 | |||
| 287 | OMIA:001697-9913 | taurine cattle | Jersey (Cattle) | Abortion due to haplotype JH1 | CWC15 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.15449431C>T | NM_001046399.2:c.163C>T | NP_001039864.1:p.(R55*) | UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 | rs1115118696 | 2013 | 23349982 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1251 | OMIA:002288-9913 | taurine cattle | Hereford (Cattle) | Mandibulofacial dysostosis | CYP26C1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 26 | g.14404993T>C | c.563T>G | p.(L188P) | ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg | rs431913023 | 2020 | 33105751 | ||
| 1411 | OMIA:002508-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH8 | CYP2B6 | SH8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.50296371A>T | NM_001075173.1:c.938T>A | NP_001068641.1:p.(I313N) | NM_001075173.1 | rs5352006042 | 2021 | 34944310 | |
| 1624 | OMIA:002582-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Hepatic fibrinogen storage disease | DGKG | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.81082187C>T | XM_002684869.5:c.2162C>T | XP_002684915.3:p.T721I | XM_002684869.5; XP_002684915.3 | 2023 | 37681469 | |||
| 1412 | OMIA:002505-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH5 | DIS3 | SH5 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.47511687_47511687insT | c.2032dup | p.(I678Nfs*2) | NP_025000110.1, XM_025000110.1 | 2021 | 34944310 | ||
| 615 | OMIA:002109-9913 | taurine cattle | Brown Swiss (Cattle) | Tricho-dento-osseous-like syndrome | DLX3 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36665831_36665832insGGAGCACA | c.584_585insGGAGCACAGG | p.(S198Rfs*99) | NM_001081622 position is g.37298375_37298376insGGAGCACA | rs5334475096 | 2017 | 28670783 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1408 | OMIA:002243-9913 | taurine cattle | Highland (Cattle) | Ichthyosis, DSP-related | DSP | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 23 | NC_037350.1:g.47826600G>T | NM_001192368.2:c.6893C>A | NP_001179297.1:p.(A2298D) | NM_001192368.2; NP_001179297.1 | rs5385033307 | 2022 | 34996433 | ||
| 711 | OMIA:000543-9913 | taurine cattle | Danish Holstein (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED6 | insertion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | X | "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" | 2011 | 22034998 | Allele id was copied from Table 1 of Capuzzello et al. (2022) | |||||
| 645 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED1 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | X | c.397_502del | p.(M133Vfs*111) | a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised | 2001 | 11591646 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) | |||
| 1120 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Generalized hypohidrotic ectodermal dysplasia | EDA | HED8 | inversion | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.77174882_80737442inv | Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" | 2019 | 31533624 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | ||||
| 1293 | OMIA:000543-9913 | taurine cattle | Red Angus-Simmental cross | Hypohidrotic ectodermal dysplasia | EDA | HED9 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80382423_80435202del | GCF_002263795.1 (O'Toole et al., 2021) | 2021 | 33801223 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | ||||
| 1484 | OMIA:000543-9913 | taurine cattle | British Blue x Holstein-Friesian cross | Anhidrotic ectodermal dysplasia, EDA-related | EDA | HED10 | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80516615_80538514del | c.397_502del | p.(M133Vfs*111) | NM_001081743.2; NP_001075212.1 | 2022 | 36068608 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 586 | OMIA:000543-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED7 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.80802800_80802801insCCCT | c.280_281insAGGG | p.(G94Qfs*49) | rs5334475024 | 2012 | 22497423 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 1665 | OMIA:000543-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | g.80417567C>T | c.679G>A | p.(G227R) | NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 | rs1114816375 | 2023 | 38275590 | ||
| 373 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411671A>C | NM_001081743.2:c.924+2T>G | c.DNA position is based on NM_001081743.2 | rs5334474632 | 2002 | 12021844 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022) | |
| 1661 | OMIA:000543-9913 | taurine cattle | Limousin (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | HED11 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411716T>C | NM_001081743.2:c.881A>G | NP_001075212.1:p.(E294G) | NM_001081743.2; NP_001075212.1 | rs439722471 | 2024 | 38252617 | |
| 1295 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80411795C>A | NM_001081743.2:c.802C>A | "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) | rs5334475058 | 2011 | 21740563 | Allele id and c. information were copied from Table 1 of Capuzzello et al. (2022) | |
| 1294 | OMIA:000543-9913 | taurine cattle | Red Angus-Charolais-Simmental cross | Anhidrotic ectodermal dysplasia | EDA | HED3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80415626G>A | NM_001081743.2:c.730C>T | NP_001075212.1:p.(R244*) | rs5334474792 | 2006 | 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details | The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 482 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.80803015_80803033del | NM_001081743.2:c.48_66del | NP_001075212.1:p.(A16S22fs*55) | "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." | rs5334474984 | 2011 | 21410470 | Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) |
| 843 | OMIA:002128-9913 | taurine cattle | Charolais (Cattle) | Anhidrotic ectodermal dysplasia, EDAR-related | EDAR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.44599876_44599877insC | p.(P161Rfs*97) | UMD3.1 position is g.44462236_44462237insC | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1474 | OMIA:002560-9913 | taurine cattle | Lidia, Spain (Cattle) | Growth and respiratory lethal syndrome | EDN2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 3 | g.104701617G>A | c.149G>A | p.(C50Y) | ENSBTAG00000021434; ENSBTAT00000028571.3 | 2022 | 35912509 | |||
| 1753 | OMIA:002904-9913 | taurine cattle | Angus (Cattle) | Male subfertility, EML5-related | EML5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.100310158G>A | NM_001206576.1:c.4960C>T | NP_001193505.1:p.(R1654W) | rs380547429 | 2022 | 35478957 | |||
| 617 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.103609778_103609779delinsG | c.2327_2328delinsG | p.(A776Gfs*22) | Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 | rs5334475076 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 375 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.103594013C>T | NM_173927.1:c.1356C>T | Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. | rs5334475072 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 534 | OMIA:002540-9913 | taurine cattle | Tiroler Grauvieh (Cattle) | Chondrodysplasia | EVC2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.103651709_103651710del | NM_173927.1:c.2993_2994del | NP_776352.1:p.(D998Efs*13) | rs5334475061 | 2014 | 24733244 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry. | ||
| 346 | OMIA:002042-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), EXOSC4 | EXOSC4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.755826G>A | NM_001078086.2:c.190G>A | NP_001071554.1:p.(R64*) | rs3423357300 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 713 | OMIA:000363-9913 | taurine cattle | Holstein (black and white) (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 27 | a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised | 2004 | 15566468 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||||||
| 591 | OMIA:000363-9913 | taurine cattle | Japanese Black, Japan (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 27 | g.16305660delinsATATGTGCAGAATATA | c.870delinsATATGTGCAGAATATA | P.(F290delinsLYVQNI) | rs5334474726 | 2005 | 16104386 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1532 | OMIA:001818-9913 | taurine cattle | Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) | Factor XIII deficiency | F13A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 23 | g.48649432T>C | c.248T>C | p.(F83S) | NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: | 1996 | Reference not in PubMed; see OMIA 001818-9913 for reference details | Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023). | ||
| 1038 | OMIA:000437-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.36017426A>T | NM_001145508.1:c.134A>T | NP_001138980.1:p.(H45L) | ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu | rs1117392179 | 2018 | 29774585 | ||
| 194 | OMIA:000437-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Haemophilia A | F8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.36145188T>A | NM_001145508.1:c.6458T>A | NP_001138980.1:p.(L2153H) | rs456129807 | 2009 | 19456318 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1360 | OMIA:002450-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis congenita | FA2H | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.2205625_2205626insG | c.9dupC | p.(A4Rfs*142) | NM_001192455.1; NP_001179384.1 | 2021 | 34599683 | |||
| 1183 | OMIA:002259-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | FAM189A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.28112913T>C | p.(N192S) | Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475108 | 2017 | 28904385 | |||
| 646 | OMIA:000151-9913 | taurine cattle | Holstein (black and white) (Cattle) | Brachyspina | FANCI | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.20773899_20777226del | p.(V877Lfs*27) | 2012 | 22952632 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||||
| 377 | OMIA:000628-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Marfan syndrome | FBN1 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.61917867G>A | c.8227-1G>A | rs5334475078 | 2012 | 22221020 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||
| 201 | OMIA:000628-9913 | taurine cattle | Limousin (Cattle) | Marfan syndrome | FBN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.61831200G>A | NM_174053.2:c.3598G>A | NP_776478.1:p.(E1200K) | rs5334475103 | 2005 | 15776436 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 910 | OMIA:000836-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Limousin (Cattle) | Protoporphyria | FECH | substitution | extension (stop-lost) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.56787697C>A | NM_174054.2:c.1250G>T | NP_776479.1:p.(*417Lext*27) | rs5334474668 | 1998 | 9784594 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1529 | OMIA:002625-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Skeletal dysplasia, FGD3 related | FGD3 | delins, small (<=20) | missense | Naturally occurring variant | Not currently evaluated | UMD_3.1.1 | 8 | g.85826989_85826990delinsTG | p.(H171C) | 2015 | 26306008 | |||||
| 1326 | OMIA:002374-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Charcot Marie Tooth disease | FGD4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.77262490C>T | XM_024992559.1:c.1671+1G>A | Splice donor mutation based on XM_005206883.3 | rs5334475069 | 2021 | 34045765 | |||
| 787 | OMIA:002090-9913 | taurine cattle | Holstein (black and white) (Cattle) | Facial dysplasia syndrome | FGFR2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.41489034C>A | NM_001205310.1:c.927G>T | NP_001192239.1:p.(W309C) | rs5334475009 | 2017 | 28768473 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1179 | OMIA:001703-9913 | taurine cattle | Holstein (black and white) (Cattle) | Chondrodysplasia, disproportionate | FGFR3 | substitution | extension (stop-lost) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.116767863C>A | NM_174318.3:c.2408G>T | NP_776743.1:p.(*803Lext*93) | NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) | rs5334474953 | 2020 | 32239744 | ||
| 304 | OMIA:001360-9913 | taurine cattle | Swedish Red and White (Cattle) | Trimethylaminuria (fishy taint) | FMO3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.38666821C>T | NM_174057.2:c.712C>T | NP_776482.1:p.(R238*) | rs797790546 | 2002 | 12466292 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | ||
| 488 | OMIA:000419-9913 | taurine cattle | Shorthorn (Cattle) | Glycogen storage disease II | GAA | E18 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52484973_52484974del | NM_173913.2:c.2454_2455del | NP_776338.1:p.(T819R) | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 294 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) | Glycogen storage disease II | GAA | E13 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52488949G>A | c1783C>T | NP_776338.1:p.(R595*) | UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. | rs5334474904 | 2000 | 10723725 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. |
| 487 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) | Glycogen storage disease II | GAA | E7 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.52492405_52492406del | NM_173913.2:c.1057_1058del | NP_776338.1:p.(Y353L) | UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1327 | OMIA:002375-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Congenital disorder of glycosylation | GALNT2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 28 | g.2281801G>A | c.1561-1G>A | Splice acceptor mutation based on NM_001193103.1. | rs5334474933 | 2021 | 34045765 | |||
| 182 | OMIA:001826-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH4 | GART | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.1997582A>C | NM_001040473.2:c.869A>C | NP_001035563.1:p.(N290T) | rs465495560 | 2013 | 23762392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1501 | OMIA:002559-9913 | taurine cattle | Holstein Friesian (Cattle) | Persistent truncus arteriosus | GATA6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.34187181T>A | c.1249A>T | p.(K417X) | ENSBTAT00000007537.6 | 2023 | 36333145 | |||
| 1494 | OMIA:002579-9913 | taurine cattle | Irish Moiled (Cattle) | Perinatal mortality syndrome, GCK-related | GCK | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 4 | g.77173487A>T | 2022 | 36105082 | ||||||
| 293 | OMIA:001442-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Forelimb-girdle muscular anomaly | GFRA1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.36627244G>A | NM_001105411.1:c.430C>T | NP_001098881.1:p.(Q144*) | rs5334475112 | 2013 | Reference not in PubMed; see OMIA 001442-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 302 | OMIA:000689-9913 | taurine cattle | Polled Hereford (Cattle) | Myoclonus | GLRA1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.63070074G>T | NM_174321.2:c.156C>A | NP_776746.1:p.(Y52*) | rs5334475027 | 2001 | 11178872 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1804 | OMIA:002958-9913 | taurine cattle | Aubrac (Cattle) | Rhizomelic chondrodysplasia punctata | GNPAT | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 28 | NC_037355.1:g.4039268G>A | 2024 | Reference not in PubMed; see OMIA 002958-9913 for reference details | ||||||
| 778 | OMIA:001985-9913 | taurine cattle | Simmental (Cattle) | Dwarfism, Fleckvieh | GON4L | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.15024247del | NM_001192625.1:c.4287del | NP_001179554.1:p.(G1430Kfs*66) | Previously listed as ARS-UCD1.2: g.15024245del and c.4286del; g. and c. updated to reflect HGVS recommendations (3' rule) [29/08/2024] | rs723240647 | 2016 | 27036302 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909 | |
| 1831 | OMIA:003002-9913 | taurine cattle | Simmental (Cattle) | Short stature–auditory depigmentation syndrome | GRID1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 28 | NC_037355.1:g.40526902G>T | XM_024986926.1:c.1466C>A | XP_024842694.1:p.(P489H) | s719437442 | 2025 | 40913728 | |||
| 296 | OMIA:002230-9913 | taurine cattle | Belted Galloway (Cattle) Brown Swiss (Cattle) | Hypotrichosis | HEPHL1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.721234T>A | NM_001192511.2:c.1684A>T | NP_001179440.1:p.(K562*) | NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 | rs5334475051 | 2021 | 33926013 | ||
| 1825 | OMIA:001461-9913 | taurine cattle | Angus (Cattle) | Gangliosidosis, GM2 | HEXA | delins, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 10 | NC_037337.1:g.19269480_19269481delinsGGAGT | NM_001075164.2: c.834_835delinsACTCC) | NP_001068632.1:p.(Y278*) | 2025 | 41290211 | ||||
| 727 | OMIA:000317-9913 | taurine cattle | Highland (Cattle) | Ears, crop | HMX1 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 6 | 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly | 2013 | 24194898 | ||||||||
| 919 | OMIA:001319-9913 | taurine cattle | Holstein Friesian (Cattle) | Myopathy of the diaphragmatic muscles | HSPA1A | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 23 | Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex | 2003 | 12755819 | ||||||||
| 204 | OMIA:001817-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Perinatal weak calf syndrome | IARS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.83909754C>G | NM_001101069.2:c.235G>C | NP_001094539.1:p.(V79L) | rs5334475110 | 2013 | 23700453 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1396 | OMIA:001823-9913 | taurine cattle | Holstein Friesian (Cattle) | Haplotype with homozygous deficiency-HH2 | IFT80 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.107172616del | NM_001098959.1:c.1155del | NP_001092429.1:p.(L385Ffs*3) | published as g.107172616delT, ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3, c. and p. coordinates updated to NCBI transcripts [29/08/2024] | rs523422030 | 2021 | 34873723 | ||
| 1202 | OMIA:002271-9913 | taurine cattle | Holstein Friesian (Cattle) | Immunodeficiency, IL17Ra-related | IL17RA | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.108813252del | XM_015460734.2:c.180del | XP_015316220.2:p.(C61Afs*62) | published as g.108813251delC, g. coordinates in this table updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | rs5334474974 | 2020 | 32448141 | ||
| 1185 | OMIA:002261-9913 | taurine cattle | Holstein (black and white) (Cattle) | de novo mutation in an AI sire | ITGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.36586185G>A | p.(T252M) | Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. | rs5334475090 | 2017 | 28904385 | |||
| 1577 | OMIA:002718-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctional, ITGA6-related | ITGA6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.24112740C>A | NM_001109981.1:c.2160+1G>T | NP_001103451.1:p.(I657Mfs) | NM_001109981.1 | 2023 | 37308849 | |||
| 197 | OMIA:000595-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) | Leukocyte adhesion deficiency, type I | ITGB2 | BLAD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.144770078T>C | NM_175781.1:c.383A>G | NP_786975.1:p.(D128G) | Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. | rs445709131 | 1992 | 1384046 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. |
| 684 | OMIA:001948-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 19 | "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene | 2015 | 25890340 | ||||||||
| 1716 | OMIA:002872-9913 | taurine cattle | Holstein Friesian (Cattle) | Bovine lymphocyte intestinal retention defect | ITGB7 | BLIRD | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.26807079G>A | NP_001098835.1:904G>A | NP_001098835.1:p.(G302S) | Published as ENSBTAT00000025279.5:p.(G375S) | rs444441523 | 2023 | Reference not in PubMed; see OMIA 002872-9913 for reference details | |
| 1390 | OMIA:002483-9913 | taurine cattle | Neuromuscular channelopathy | KCNG1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 13 | NC_037340.1:g.78918850C>A | NM_001205719.1:c.1248G>T | NP_001192648.1:p.(W416C) | NM_001205719.1; NP_001192648.1 | rs3423356335 | 2021 | 34828398 | |||
| 196 | OMIA:001722-9913 | taurine cattle | Marchigiana (Cattle) Romagnola (Cattle) | Lethal multi-organ developmental dysplasia | KDM2B | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.53761149G>A | XM_005217983.4:c.2503G>A | XP_005218040.1:p.(D835N) | rs5334475109 | 2012 | 23029151 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 207 | OMIA:002390-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Spinal muscular atrophy | KDSR | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.61620302C>T | c.562G>A | p.(A188T) | rs5334475102 | 2007 | 17420465 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1005 | OMIA:000527-9913 | taurine cattle | Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) | Progressive ataxia | KIF1C | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.26407668C>T | NM_001205802.2:c.608G>A | NP_001192731.2:p.(R203Q); p.(R203_T204delinsQ*) | ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). | rs800926237 | 2018 | 30067756 | ||
| 1440 | OMIA:001836-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Abortion due to haplotype HH13 | KIR2DS1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.62758881G>A | NM_001097567.1:c.475C>T | NP_001091036.1:p.(Q159*) | NM_001097567.1; NP_001091036.1 | rs437566778 | 2022 | 35361830 | ||
| 748 | OMIA:000426-9913 | taurine cattle | Bohuskulla, Sweden (Cattle) Chillingham (Cattle) Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) Svensk Fjällras (Cattle) Svensk kullig boskap (skb), Sweden (Cattle) Väneko, Sweden (Cattle) | Gonadal hypoplasia | KIT | cs(29) | complex rearrangement | Naturally occurring variant | Not currently evaluated | 29 | "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" | 2013 | 24086604 | Additional breed information based on Hall et al. (2021) and PMID:40624682 | ||||||
| 1265 | OMIA:002081-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, simplex, KRT5-related` | KRT5 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27367611_27367613del | NM_001008663.1:c.534_536del | NP_001008663.1:p.(N178del) | Publised as '27367604delCAA' coordinates in the table have been updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | 2020 | 33135329 | |||
| 192 | OMIA:002081-9913 | taurine cattle | Friesian cross (Cattle) Jersey cross | Epidermolysis bullosa | KRT5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27371128G>A | NM_001008663.1:c.1432G>A | NP_001008663.1:p.(E478K) | rs5334474982 | 2005 | 15955091 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1337 | OMIA:002114-9913 | taurine cattle | Hereford (Cattle) | Hypotrichosis, KRT71-related | KRT71 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.27331221_27331228del | NM_001075970.1:c.281_288del | NP_001069438.1:p.(M94Nfs*14) | cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively | 2021 | 34356054 | 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del. | ||
| 909 | OMIA:001677-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, junctionalis, LAMA3-related | LAMA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 24 | g.32749369G>A | c.7549C>T | p.(R2517*) | rs5334475046 | 2015 | 26370913 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1387 | OMIA:002479-9913 | taurine cattle | Romagnola (Cattle) | Hemifacial microsomia | LAMB1 | HFM | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.49019693G>A | NM_001206519.1:c.2002C>T | NP_001193448.1:p.(R668C) | NM_001206519.1; NP_001193448.1; | 2022 | 34796979 | ||
| 682 | OMIA:001678-9913 | taurine cattle | Hereford (Cattle) | Epidermolysis bullosa, junctionalis, LAMC2 | LAMC2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 16 | "2.4 kb deletion encompassing the first exon of the LAMC2 gene" | 2015 | 25888738 | ||||||||
| 1415 | OMIA:002516-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency OH4 | LIG3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.15080336_15080341del | NM_001038107.2:c.2483_2484+4delAGGTG | NP_001033196.1:p.K828fs | NM_001038107.2 | rs5381613636 | 2021 | 34915862 | ||
| 627 | OMIA:000963-9913 | taurine cattle | Holstein Friesian (Cattle) | Syndactyly (mule foot) | LRP4 | delins, small (<=20) | delins (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 15 | g.76800972_76800973delinsAT | c.4863_4864delinsAT | p.(N1621_G1622delinsKC) | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | 2006 | 16859890 | |||
| 378 | OMIA:000963-9913 | taurine cattle | Angus (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76792588C>T | NM_001077843.1:c.5385+1G>A | "a G to A transition at the first nucleotide in the splice donor site of intron 37" | rs5334475003 | 2006 | 16963222 | Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 769 | OMIA:000963-9913 | taurine cattle | Simmental (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76807508C>T | NM_001077843.1:c.3595G>A | NP_001071311.1:p.(G1199S) | rs3423411024 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 768 | OMIA:000963-9913 | taurine cattle | Simmental Charolais Cross | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76812187C>T | NM_001077843.1:c.2719G>A | NP_001071311.1:p.(G907R) | rs5334474664 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 1844 | OMIA:000963-9913 | taurine cattle | Holstein Friesian (Cattle) | Syndactyly (mule foot) | LRP4 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 15 | NC_037342.1:g.76819481G>A | NM_001077843.1:c.1480C>T | NP_001071311.1:p.(R494C) | rs380401761 | 2025 | 40999323 | |||
| 183 | OMIA:000185-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Chediak-Higashi syndrome | LYST | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 28 | NC_037355.1:g.8464077T>C | NM_174020.2:c.6044A>G | NP_776445.1:p.(H2015R) | rs481318527 | 1999 | 10594238 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 199 | OMIA:000625-9913 | taurine cattle | Galloway (Cattle) | Mannosidosis, alpha | MAN2B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.12840983G>A | NM_174561.2:c.662G>A | NP_776986.2:p.(R221H) | rs5334474945 | 1997 | 9208932 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 198 | OMIA:000625-9913 | taurine cattle | Angus (Cattle) Murray Grey (Cattle) | Mannosidosis, alpha | MAN2B1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.12842292T>C | NM_174561.2:c.961T>C | NP_776986.2:p.(F321L) | rs5334474873 | 1997 | 9208932 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 297 | OMIA:000626-9913 | taurine cattle | Salers (Cattle) | Mannosidosis, beta | MANBA | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.22188765G>A | NM_174387.2:c.2574G>A | NP_776812.1:p.(W858*) | rs5334475094 | 1999 | 10594236 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1473 | OMIA:002381-9913 | taurine cattle | Romagnola (Cattle) | Skeletal-cardio-enteric dysplasia | MAP2K2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.19923991C>T | NM_001038071.2:c.535G>A | NP_001033160.2:p.(R179W) | NM_001038071.2; NP_001033160.2; possible de-novo causal variant | 2021 | 34209498 | |||
| 1416 | OMIA:002517-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency BH6 | MARS2 | BH6 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.86191230G>A | NM_001098971.1:c.1553G>A | NP_001092441.1:p.(R518Q) | NM_001098971.1 | rs434672528 | 2021 | 34915862 | |
| 1167 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.14705671T>C | NM_174108.2:c.296T>C | NP_776533.1:p.(L99P) | rs109688013 | 2016 | 27037038 | |||
| 558 | OMIA:002043-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MED22-related | MED22 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | p.(L38Rfs*25) | 2016 | 27646536 | |||||||
| 374 | OMIA:001106-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) | Axonopathy | MFN2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.41686003G>A | NM_001190270.1:c.2229C>T | "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 | rs5334475057 | 2011 | 21526202 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 644 | OMIA:001565-9913 | taurine cattle | Ayrshire (Cattle) | Abortion and stillbirth due to mutation in MIMT1 | MIMT1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 18 | a 110 kb deletion in the MIMT1 gene | 2010 | 21152099 | ||||||||
| 678 | OMIA:001931-9913 | taurine cattle | Holstein (black and white) (Cattle) | Depigmentation associated with microphthalmia | MITF | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 22 | a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 | 2014 | 25199536 | ||||||||
| 837 | OMIA:001680-9913 | taurine cattle | Holstein (black and white) (Cattle) | Glass-eyed albino | MITF | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 22 | g.31628127_31628129del | p.(R211del) | UMD3.1 position g.31746506_31746508del | rs5334474965 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 189 | OMIA:001680-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Dominant white with bilateral deafness | MITF | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 22 | NC_037349.1:g.31628131C>A | NM_001001150.2:c.629G>T | NP_001001150.1:p.(R210I) | UMD3.1 position is g.31746502 | rs5334474903 | 2011 | 22174915 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 492 | OMIA:001819-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) Tiroler Grauvieh (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.20911933del | XM_024984177.1:c.1881del | XP_024839945.1:p.(S628Vfs9*) | Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) | rs5334474910 | 2016 | 27919260 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 446 | OMIA:001819-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.20936257_20936259del | NM_174081.2:c.769_771del | NP_776506.1:p.(Y257del) | published as c.769_771delTAC | 2000 | 10801779 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 483 | OMIA:001541-9913 | taurine cattle | Simmental (Cattle) | Arachnomelia, BTA23 | MOCS1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 23 | g.13837657_13837658del | c.1224_1225del | p.(H408Qfs*51) | 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 | rs383500843 | 2011 | 21255426 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. | |
| 491 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.47095176_47095177del | c.2904_2905del | p.(G934*) | rs5334475077 | 2009 | 19779552 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del | ||
| 208 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.47089627T>G | NM_001192670.1:c.1906T>G | NP_001179599.1:p.(C636G) | rs466131011 | 2012 | 22497452 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1417 | OMIA:002518-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Haplotype with homozygous deficiency BH14 | MRPL55 | BH14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 7 | NC_037334.1:g.2996436C>T | NM_001303490.1:c.169C>T | NP_001290419.1:p.(R57*) | NM_001303490.1 | rs461014370 | 2021 | 34915862 | |
| 618 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nt419(del7-ins10) | delins, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.6281243_6281249delinsAAGCATACAA | c.419_425delinsAAGCATACAA | p.(F140*) | cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively | rs5334475091 | 1998 | 9501304 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021) |
| 212 | OMIA:000683-9913 | taurine cattle | Gelbvieh (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279187T>C | NM_001001525.3:c.191T>C | NP_001001525.1:p.(L64P) | UMD3.1 position is g.6213889T>C | rs449270213 | 2015 | 25515003 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 771 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279278C>A | NM_001001525.3:c.282C>A | NP_001001525.1:p.(F94L) | UMD3.1 position is g.6213980A>C | rs110065568 | 1998 | 9501304 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 772 | OMIA:000683-9913 | taurine cattle | Parthenais (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6279310C>G | NP_001001525.1:c.314C>G | NP_001001525.1:p.(S105C) | UMD3.1 position is g.6214012C>G | rs5334475047 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 773 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | D182N | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281368G>A | NM_001001525.3:c.544G>A | NP_001001525.1:p.(D182N) | rs5334475067 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 299 | OMIA:000683-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281434C>T | NM_001001525.3:c.610C>T | NP_001001525.1:p.(Q204*) | UMD3.1 position is g.6216138C>T | rs110344317 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 300 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6281500G>T | NM_001001525.3:c.676G>T | NP_001001525.1:p.(E226*) | UMD3.1 position is g.6216204G>T | rs5334474940 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 489 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Japanese Black, Japan (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) | Muscular hypertrophy (double muscling) | MSTN | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283674_6283684del | NM_001001525.3:c.818_828del | NP_001001525.1:p.(D273Rfs*14) | UMD3.1 position is g.6218379delATGAACACTCC; c. previously listed as c.821_831del - updated to recent transcript ID and incorrect EVA rs382669990 replaced [29/08/2024] | rs5384554823 | 1997 | 9288100 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021). Additional breeds added based on recent publications: PMID: 40170586. | |
| 301 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283727G>T | NM_001001525.3:c.871G>T | NP_001001525.1:p.(E291*) | UMD3.1 position is g.6218432G>T; c.1004G>T updated to c.871G>T [29/08/2024] | rs5334475075 | 2013 | 22497537 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 203 | OMIA:000683-9913 | taurine cattle | Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) | Muscular hypertrophy (double muscling) | MSTN | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6283794G>A | NM_001001525.3:c.938G>A | NP_001001525.1:p.(C313Y) | UMD3.1 position is g.6218499G>A | rs5334475012 | 1997 | 9314496 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 217 | OMIA:001978-9913 | taurine cattle | Holstein Friesian (Cattle) | Arthrogryposis, distal, type 1B | MYBPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.65446598T>G | NM_001110773.1:c.884T>G | NP_001104243.1:p.(L295R) | rs5369172067 | 2015 | 26289121 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1500 | OMIA:002590-9913 | taurine cattle | Limousin (Cattle) | Cleft palate | MYH3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.[29609605-29609615del;29609623A>G] | c.[2864T>C;2872_2882del] | c.[I955T; p.L958Tfs*5] | NM_001101835.1 | 2022 | 36309651 | |||
| 556 | OMIA:002039-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MYH6-related | MYH6 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.21538917_21538919del | p.(K1730del) | 2016 | 27646536 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||||
| 202 | OMIA:001342-9913 | taurine cattle | Santa Gertrudis (Cattle) | Mucopolysaccharidosis IIIB | NAGLU | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.42624367G>A | NM_001102226.2:c.1354G>A | NP_001095696.1:p.(E452K) | rs5334475071 | 2007 | 17458708 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1469 | OMIA:002557-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Leber optic neuropathy | ND4L | substitution | missense | Naturally occurring variant | Not currently evaluated | M | m.10432T>C | Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" | 2019 | Reference not in PubMed; see OMIA 002557-9913 for reference details | ||||||
| 766 | OMIA:002103-9913 | taurine cattle | Angus (Cattle) | Developmental duplications | NHLRC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.34340886T>C | NM_001083723.2:c.932T>C | NP_001077192.1:p.(V311A) | rs5334474969 | 2014 | Reference not in PubMed; see OMIA 002103-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 679 | OMIA:001936-9913 | taurine cattle | Romagnola (Cattle) | Cataract, recessive, Romagnola | NID1 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 28 | "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" | 2014 | 25347398 | ||||||||
| 1718 | OMIA:002874-9913 | taurine cattle | Montbéliarde (Cattle) | Haplotype with homozygous deficiency, NOA1-related | NOA1A | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.72359797_72359798insG | NM_001038188.2:c.1086_1087insC | NP_001033277.1:(p.D363Rfs*9) | Published as ENSBTAT00000071135.1:p.D400RfsX9 | rs5411279036 | 2023 | 39343954 Reference not in PubMed; see OMIA 002874-9913 for reference details | ||
| 1244 | OMIA:000725-9913 | taurine cattle | Angus (Cattle) | Niemann-Pick type C1 | NPC1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 24 | NC_037351.1:g.33099467C>G | NM_174758.2:c.2969C>G | NP_777183.1:p.(P990R) | NM_174758.2:c.2969C>G | rs482882512 | 2020 | 32970694 | ||
| 1410 | OMIA:002509-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH9 | NUBPL | SH9 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 21 | NC_037348.1:g.42154344C>A | NM_001193042.1:c.428C>A | NP_001179971.1:p.(S143Y) | NM_001193042.1 | rs5335823597 | 2021 | 34944310 | |
| 1468 | OMIA:002556-9913 | taurine cattle | Chianina (Cattle) | Double-outlet right ventricle | NUMB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.84751870G>A | NM_001101951.1:c.416C>T | NP_001095421.1:p.(T139M) | NM_001101951.1; NP_001095421.1 | 2022 | 35748177 | |||
| 555 | OMIA:002035-9913 | taurine cattle | Jersey (Cattle) | Abortion (embryonic lethality), OBFC1-related | OBFC1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 26 | g.24461804_24461805del | c.379_380del | p.(K127Vfs*29) | rs455647476 | 2016 | 27646536 | 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del | ||
| 288 | OMIA:000162-9913 | taurine cattle | Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Cardiomyopathy, dilated | OPA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 18 | NC_037345.1:g.53152213G>A | NM_001245934.1:c.343C>T | NP_001232863.1:p.(Q115*) | UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 | rs479222100 | 2011 | 20923700 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Additional breeds based on PMID:40312951 | |
| 428 | OMIA:001437-9913 | taurine cattle | Brown Swiss (Cattle) | Beta-lactoglobulin, aberrant low expression | PAEP | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.103255964C>A | c.-215C>A | "C to A transversion at position 215 bp upstream of the translation initiation site" | rs5334475105 | 2006 | 17033029 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1443 | OMIA:002548-9913 | taurine cattle | Holstein Friesian (Cattle) | Deficiency of haplotype HH35 | PCDH15 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 26 | NC_037353.1:g.5325675C>G | XM_059881970.1:c.2599C>G | XP_059737953.1:p.(L867V) | XM_015460562.2; XP_015316048.2 | rs469553146 | 2022 | 35361830 | ||
| 1841 | OMIA:003012-9913 | taurine cattle | Holstein Friesian (Cattle) | Dwarfism, primordial disproportionate and craniofacial dysmorphism | PDGFRA | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.69749162T>C | NM_001192345.2:c.1685T>C | NP_001179274.1:p.(I562T) | 2025 | 40999323 | ||||
| 820 | OMIA:001827-9913 | taurine cattle | Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) | Abortion due to haplotype MH1 | PFAS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.27895397C>T | NM_001256564.1:c.3613C>T | NP_001243493.1:p.(R1205C) | rs455876205 | 2017 | 28803020 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 406 | OMIA:001953-9913 | taurine cattle | Belgian Blue (Cattle) | Arthrogryposis, lethal syndrome | PIGH | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 10 | NC_037337.1:g.79469727G>C | NM_001038116.2:c.211-10C>G | rs451004237 | 2015 | 25895751 | Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | |||
| 339 | OMIA:001935-9913 | taurine cattle | Simmental (Cattle) | Zinc deficiency-like syndrome | PLD4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 21 | g.69352995G>A | c.702G>A | p.(W234*) | UMD3.1 position is g.71001232G>A | rs378824791 | 2014 | 25052073 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1493 | OMIA:002578-9913 | taurine cattle | Holstein (black and white) (Cattle) | Mast cell tumour, congenital | PLP2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | X | NC_037357.1:g.87216480C>T | NM_203363.1:c.50C>T | NP_976239.1:p.(T17I) | NM_203363.1; XP_005642144.1 | 2022 | 36139188 | |||
| 1166 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | PMEL | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.57345302_57345304del | c.50_52del | p.(L19del) | rs385468954 | 2016 | 27037038 | ||||
| 765 | OMIA:000827-9913 | taurine cattle | Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) | Progressive degenerative myeloencephalopathy (Weaver syndrome) | PNPLA8 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 4 | NC_037331.1:g.49600585C>T | XM_005205444.4:c.1703G>A | XP_005205501.2:p.(S568N) | rs800397662 | 2016 | 26992691 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 588 | OMIA:000161-9913 | taurine cattle | Polled Hereford (Cattle) | Cardiomyopathy and woolly haircoat syndrome | PPP1R13L | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.53013747_53013753dup | c.956-962dupACAGGCG | p.(G335Efs*36) | 2009 | 19016676 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||
| 1840 | OMIA:003013-9913 | taurine cattle | Angus (Cattle) | Dwarfism, primordial disproportionate | PRDM10 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.36138136G>A | NM_001191168.1:c.866C>T | NP_001178097.1:p.(P289L) | 2025 | 40999323 | ||||
| 291 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.95896205G>A | c.1573C>T | p.(R525*) | rs109639251 | 2009 | 19887637 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 352 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 6 | NC_037333.1:g.95896205G>A | NM_001144099.1:c.2032C>T | NP_001137571.1:p.(R678*) | ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter | rs109639251 | 2009 | 19887637 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |
| 1447 | OMIA:001372-9913 | taurine cattle | Criollo Lechero Tropical, Mexico (Cattle) | Slick hair | PRLR | SLICK4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099113C>G | NM_001039726.2:c.1281C>G | NP_001034815.1:p.(Y427*) | 2021 | 33259090 | |||
| 544 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099214del | NM_001039726.2:c.1382del | NP_001034815.1:p.(A461Vfs*2) | rs517047387 | 2014 | 25519203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of Sharma et al. (2017) Animal Genetics 48(3):369-370, breed infromation updated based on PMID:39377537 | |
| 974 | OMIA:001372-9913 | taurine cattle | Criollo Lechero Tropical, Mexico (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099226C>A | NM_001039726.2:c.1394C>A | NP_001034815.1:p.(S465*) | rs5334474999 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 | |
| 1448 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK5 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099228A>T | NM_001039726.2:c.1396A>T | NP_001034815.1:p.(K466*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 1449 | OMIA:001372-9913 | taurine cattle | Carora, Venezuela (Bolivarian Republic of) (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099267C>T | NM_001039726.2:c.1435C>T | NP_001034815.1:p.(Q479*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 975 | OMIA:001372-9913 | taurine cattle | Baoulé (Cattle) Caracu, Brazil (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Casanareño, Colombia (Cattle) Chino Santandereano, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) West African Zebu (Cattle) | Slick hair | PRLR | SLICK2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 20 | NC_037347.1:g.39099321C>T | NM_001039726.2:c.1489C>T | NP_001034815.1:p.(R497*) | rs5334474702 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 and PMID:39710878 | |
| 1688 | OMIA:001139-9913 | taurine cattle | Red Angus (Cattle) | Glycogen storage disease V | PYGM | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42989581G>A | NM_175786.2 c.1948C>T | NP_786980.1:p.(R650*) | published as c.2257C>T in ARS-UCD1.2 | 2024 | 38678201 | |||
| 193 | OMIA:001139-9913 | taurine cattle | Charolais (Cattle) | Glycogen storage disease V | PYGM | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42991370G>A | NM_175786.2:c.1468C>T | NP_786980.1:p.(R490W) | rs5334475023 | 1996 | 8845714 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1689 | OMIA:002848-9913 | taurine cattle | Brown Swiss (Cattle) | Spermatogenic failure, QRICH2-related | QRICH2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.55436710del | XM_002696205.5:c.4929del | XP_002696251.3:C1644Afs*52 | Coordinates in this table consider 3' rule of HGVS recommendation | 2022 | 35255804 | |||
| 221 | OMIA:002037-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RABGGTB | RABGGTB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.69060748T>C | NM_001015646.1:c.584A>G | NP_001015646.1:p.(Y195C) | ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys | rs1118263722 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 209 | OMIA:002433-9913 | taurine cattle | Holstein Friesian (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Thrombopathia | RASGRP2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.42978791A>G | NM_001099946.1:c.701T>C | NP_001093416.1:p.(L234P) | Additional breeds based on PMID:40312951 | rs385444696 | 2007 | 18039909 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 1717 | OMIA:002873-9913 | taurine cattle | Normande (Cattle) | Haplotype with homozygous deficiency, RFC5-related | RFC5 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.57188407_57188409del | NM_001075358.1:c.573_575del | NP_001068826.1:p.(E192del) | Published as ENSBTAT00000085991.1:p.E369del | rs5366807285 | 2023 | Reference not in PubMed; see OMIA 002873-9913 for reference details | ||
| 1442 | OMIA:002547-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Haplotype HH25 deficiency | RIOX1 | deletion, gross (>20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.84938408_84938437del | c.396_425del | p.(A133_E142del) | NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA | 2022 | 35361830 | |||
| 676 | OMIA:001901-9913 | taurine cattle | Nordic Red (Cattle) | Abortion due to deletion of RNASEH2B | RNASEH2B | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.20007546_20691454del | A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. | 2014 | 24391517 | Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 - http://ftp.ensembl.org/pub/release-94/). | |||||
| 376 | OMIA:001686-9913 | taurine cattle | Belgian Blue (Cattle) | Dwarfism, proportionate, with inflammatory lesions | RNF11 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.95015373T>C | NM_001077953.1:c.124-2A>G | NM_001077953.1 | rs3423159409 | 2012 | 22438830 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 344 | OMIA:002038-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RNF20 | RNF20 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.91297797A>T | NM_001081587.1:c.2077A>T | NP_001075056.1:p.(K693*) | rs5334474936 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 611 | OMIA:002029-9913 | taurine cattle | Angus (Cattle) Belgian Blue (Cattle) Charolais (Cattle) Gelbvieh (Cattle) Holstein Friesian (Cattle) Maine-Anjou (Cattle) Normande (Cattle) Red Angus (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Retinitis pigmentosa 1 | RP1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.22340665_22340666insA | p.(R791Kfs*13) | 2016 | 27510606 | Additional breeds based on PMID:40312951 | ||||
| 858 | OMIA:002134-9913 | taurine cattle | Ayrshire (Cattle) | Abortion due to haplotype AH2 | RPAP2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | 3 | a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 | 2017 | Reference not in PubMed; see OMIA 002134-9913 for reference details | |||||||
| 416 | OMIA:002041-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), RPIA-related | RPIA | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.47355110C>T | NM_001035433.2:c.826+1G>A | rs5334475111 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1269 | OMIA:002297-9913 | taurine cattle | Holstein Friesian (Cattle) | Tetradysmelia | RSPO2 | delins, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.56451029_56501201delinsTGACAA | a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene | 2020 | 33176673 | ||||||
| 990 | OMIA:002149-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH6 | SDE2 | substitution | start-lost | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 16 | NC_037343.1:g.29020700A>G | NM_001099065.2:c.2T>C | NP_001092535.1:p.(M1?) | ENSBTAT00000016992.6:c.2T>C ENSBTAP00000016992.5:p.Met1? "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" | rs434666183 | 2018 | 29680649 | ||
| 222 | OMIA:002444-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Hydrallantois | SLC12A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 10 | g.62157819G>A | p.(P372L) | rs5334475056 | 2016 | 27613513 | ||||
| 992 | OMIA:002150-9913 | taurine cattle | Rouge des prés, France (Cattle) | Syndrome des veaux tourneurs (Turning calves syndrome) | SLC25A46 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 7 | g.109742796C>T | c.376C>T | p.(R126C) | rs5334475040 | 2017 | 28376083 | |||
| 626 | OMIA:000366-9913 | taurine cattle | Brown Swiss (Cattle) Holstein Friesian (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) Swiss Fleckvieh (Cattle) | Fanconi syndrome | SLC2A2 | delins, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.96472797_96472804delinsCATC | NM_001103222.1:c.772_779delinsCATC | NP_001096692.1:p.(L258fs*16) | Previously listed as c.771_778delinsCATC, updated to NCBI transcript [29/08/2024] | 2016 | 27169150 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC. Additional breed inforamtion based on PMID: 40312951 | ||
| 187 | OMIA:001340-9913 | taurine cattle | Holstein Friesian (Cattle) | Complex vertebral malformation | SLC35A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.43261945C>A | NM_001105386.1:c.538G>T | NP_001098856.1:p.(V180F) | rs438228855 | 2006 | 16344554 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1181 | OMIA:001340-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | SLC35A3 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 3 | NC_037330.1:g.43268369G>T | NM_001105386.1:c.73C>A | NP_001098856.1:p.(R25S) | This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. | rs5334475074 | 2017 | 28904385 | ||
| 263 | OMIA:001828-9913 | taurine cattle | Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) | Abortion due to haplotype MH2 | SLC37A2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 29 | NC_037356.1:g.28510651C>T | NM_001024486.1:c.34C>T | NP_001019657.1:p.(R12*) | rs5358558602 | 2013 | 23762392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 372 | OMIA:000593-9913 | taurine cattle | Holstein Friesian (Cattle) | Acrodermatitis enteropathica | SLC39A4 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 14 | g.537516G>A | c.1645+1G>A | "a single nucleotide mutation of the splice donor site in intron 10" | rs5334475080 | 2006 | 16714095 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1839 | OMIA:003020-9913 | taurine cattle | Holstein Friesian (Cattle) | Caudal and thoracic vertebral and viscerocranial malformation | SLC40A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.6785954T>A | NM_001077970.1:c.323T>A | NP_001071438.1:p.(I108N) | 2025 | 40999323 | ||||
| 847 | OMIA:001821-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | g.39790069G>A | c.134G>A | p.(R45Q) | Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" | rs5334474931 | 2017 | 28982372 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 848 | OMIA:001821-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous type IV | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | g.39824417C>T | c.1331C>T | p.(T444I) | Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" | rs5334474883 | 2017 | 28982372 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1846 | OMIA:001821-9913 | taurine cattle | Dexter (Cattle) | Coat colour, dilution (chocolate / cream) | SLC45A2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 20 | NC_037347.1: g.39790189A>C | XM_002696386.6: c.398A>C | XP_002696432.2: p.(Q133P) | 2025 | 41101985 | ||||
| 303 | OMIA:001228-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Spherocytosis | SLC4A1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 19 | NC_037346.1:g.44069903G>A | NM_181036.2:c.1990C>T | NP_851379.1:p.(R664*) | rs5334475039 | 1996 | 8621763 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 647 | OMIA:002443-9913 | taurine cattle | Angus (Cattle) Hereford (Cattle) Holstein (black and white) (Cattle) Simmental (Cattle) | Osteopetrosis | SLC4A2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 4 | g.113638011_113640784del | "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" | 2010 | 20507629 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||||
| 904 | OMIA:001451-9913 | taurine cattle | Belgian Blue (Cattle) | Congenital muscular dystonia 2 | SLC6A5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 29 | g.24366560A>G | c.809T>C | p.(L270P) | rs3423560860 | 2008 | 18344998 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 211 | OMIA:001824-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH3 | SMC2 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 8 | NC_037335.1:g.93753358T>C | XM_015472668.2:c.3404T>C | XP_015328154.1:p.(F1135S) | XM_015472668.2; XP_015328154.1 | rs456206907 | 2014 | 24667746 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 557 | OMIA:002040-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), SNAPC4-related | SNAPC4 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | 11 | p.(L1227Afs*134) | 2016 | 27646536 | |||||||
| 1182 | OMIA:002258-9913 | taurine cattle | Charolais (Cattle) | Lethality, SOWAHB-related | SOWAHB | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.91735816G>T | p.(Q379K) | This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of a Charolais AI bull. No information was provided on the descendants of this bull. | rs5334475088 | 2017 | 28904385 | |||
| 206 | OMIA:001247-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) | Spinal dysmyelination | SPAST | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 11 | g.14742184G>A | c.1964G>A | p.(R560Q) | rs445770480 | 2010 | 19714378 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 920 | OMIA:001230-9913 | taurine cattle | Holstein Friesian (Cattle) Japanese Black, Japan (Cattle) Jersey (Cattle) | Ovotesticular DSD (Disorder of Sexual Development) | SRY | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Y | A deletion of the SRY gene | 1996 | 8978769 | ||||||||
| 214 | OMIA:001960-9913 | taurine cattle | Simmental (Cattle) | Abortion due to haplotype FH4 | SUGT1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 12 | NC_037339.1:g.11102143A>G | NM_001046203.2:c.949T>C | NP_001039668.1:p.(W317R) | rs110793536 | 2015 | 25927203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 587 | OMIA:000059-9913 | taurine cattle | Brown Swiss (Cattle) | Arachnomelia, BTA5 | SUOX | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 5 | g.57316723_57316724insG | c.363_364insG | p.(A124Gfs*42) | rs5334475086 | 2010 | 20865119 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 213 | OMIA:001951-9913 | taurine cattle | Holstein (black and white) (Cattle) | Vertebral and spinal dysplasia | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 9 | NC_037336.1:g.101160274T>C | NM_001192985.1:c.196A>G | NP_001179914.1:p.(K66E) | rs5334475020 | 2015 | 25614605 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 963 | OMIA:001941-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH5 | TFB1M | complex rearrangement | Naturally occurring variant | Not currently evaluated | 9 | "a deletion of 138kbp, spanning position 93,233kb to 93,371kb on chromosome 9 (BTA9), harboring only dimethyl-adenosine transferase 1 (TFB1M). The deletion breakpoints are flanked by bovine long interspersed nuclear elements Bov-B (upstream) and L1ME3 (downstream), suggesting a homologous recombination/deletion event." | 2016 | 27128314 | ||||||||
| 295 | OMIA:000424-9913 | taurine cattle | Africander (Cattle) | Goitre, familial | TG | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 14 | NC_037341.1:g.8432343G>A | XM_025001401.1:c.1963C>T | XP_024857169.1:p.(R655*) | rs480120030 | 1987 | 3472203 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | ||
| 779 | OMIA:001902-9913 | taurine cattle | Simmental (Cattle) | Male subfertility | TMEM95 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.27056843C>A | c.483C>A | p.(C161*) | rs378652941 | 2014 | 24391514 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 410 | OMIA:000542-9913 | taurine cattle | Pezzata Rossa Italiana, Italy (Cattle) | Hypotrichosis, streaked | TSR2 | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | X | g.91964644A>G | c.441+226A>G | rs5334475030 | 2015 | 26203908 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||
| 345 | OMIA:002036-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), TTF1 | TTF1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 11 | NC_037338.1:g.102463944G>A | NM_001102083.1:c.1579G>A | NP_001095553.1:p.(R527*) | rs715966442 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 776 | OMIA:001939-9913 | taurine cattle | Brown Swiss (Cattle) Original Swiss Brown (Cattle) Simmental (Cattle) | Haplotype with homozygous deficiency BH2 | TUBD1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 19 | g.10833921T>C | c.757T>C | p.(H210R) | rs383232842 | 2016 | 27225349 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1414 | OMIA:002515-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency OH2 | TUBGCP5 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 2 | NC_037329.1:g.1268426G>T | NM_001102495.1:c.311C>A | NP_001095965.1:p.(T104K) | NM_001102495.1 | rs720533878 | 2021 | 34915862 | ||
| 1851 | OMIA:000202-9913 | taurine cattle | Coat colour, albinism, oculocutaneous | TYR | Not currently evaluated | Manuscript in preparation | 2025 | Reference not in PubMed; see OMIA 000202-9913 for reference details | ||||||||||||
| 1830 | OMIA:000202-9913 | taurine cattle | Simmental (Cattle) | Coat colour, albinism, oculocutaneous | TYR | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 29 | NC_037356.1:g.6343738G>A | NM_181001.3:c.1283C>T | NP_851344.1:p.(P428L) | 2025 | 40913728 | ||||
| 589 | OMIA:000202-9913 | taurine cattle | Brown Swiss (Cattle) | Coat colour, albinism, oculocutaneous | TYR | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD2.0 | 29 | NC_037356.1:g.6424971_6424972insG | NM_181001.3:c.925_926insC | Insertion causes a frameshift that resulted in a premature stop codon at residue 316, whereas normal sequence contains 517 amino acids. | 2004 | 14727143 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 404 | OMIA:001934-9913 | taurine cattle | Ayrshire, Finland (Cattle) | Ptosis, intellectual disability, retarded growth and mortality (PIRM) syndrome | UBE3B | substitution | splicing | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 17 | NC_037344.1:g.63668380C>T | NM_001206232.2:c.2076G>A | NP_001193161.1:p.(E692E) | ENSBTAT00000003493.5:c.2076G>A ENSBTAP00000003493.4:p.Glu692= | rs475678587 | 2014 | 25306138 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Variant rsID kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |
| 1409 | OMIA:002298-9913 | taurine cattle | Jersey (Cattle) | Neuropathy with splayed forelimbs | UCHL1 | JNS | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 6 | g.60158901G>A | c.979G>A | p.(E327K) | Several transcripts are reported: ENSBTAT00000046823.2:c.718G>A ENSBTAP00000044075.1:p.Glu240Lys ENSBTAT00000066434.1:c.931G>A ENSBTAP00000063885.1:p.Glu311Lys ENSBTAT00000072800.1:c.979G>A ENSBTAP00000059848.1:p.Glu327Lys ENSBTAT00000074165.1:c.706G>A ENSBTAP00000057432.1:p.Glu236Lys | rs1116058914 | 2022 | 34955244 | |
| 290 | OMIA:000262-9913 | taurine cattle | Holstein (black and white) (Cattle) Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Wagyu (Cattle) | Deficiency of uridine monophosphate synthase | UMPS | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 1 | NC_037328.1:g.69151931C>T | NM_177508.1:c.1213C>T | NP_803474.1:p.(R405*) | rs5334474835 | 1993 | 8486364 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 592 | OMIA:002423-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Multiple ocular defects | WFDC1 | insertion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 18 | g.10567100_10567101insC | c.321insC | insertion of a single base causes a frame shift mutation and a premature termination codon appeared at codon 126 | 2009 | 19374945 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1618 | OMIA:002759-9913 | taurine cattle | Brown Swiss (Cattle) | Brachygnathia | WNT10B | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UCD1.3 | 5 | NC_037332.1:g.30846510dup | XM_010805029.3:c.910dup | XP_010803331.1:p.R304Pfs*14 | XM_010805029.3; XP_010803331.1; published as g.30,846,510dupC; c.910dupC; variant is associated with increased risk of brachygnathia | rs525007739 | 2023 | 37641348 | ||
| 921 | OMIA:001736-9913 | taurine cattle | Charolais (Cattle) | Polled and multisystemic syndrome | ZEB2 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | 2 | A 3.7Mb deletion encompassing the genes ARHGAP15, GTDC1 and ZEB2 | 2012 | 23152852 | ||||||||
| 1246 | OMIA:001736-9913 | taurine cattle | Simmental (Cattle) | Polledness, abnormal skull shape, small body stature and subfertility | ZEB2 | Del11 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 2 | g.52263360_52263370del | 2020 | 33046754 | ||||||
| 1283 | OMIA:002307-9913 | taurine cattle | Limousin (Cattle) | Frontonasal dysplasia | ZIC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | ARS-UCD1.2 | 12 | g.76742067del | c.1596del | p.(S453*) | rs3423095151 | 2021 | 33388042 |
* Variant pathogenicity for single gene diseases as evaluated by an expert panel of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization Standing Committee
| Overall Statistics | |
|---|---|
| Total number of variants | 262 |
| Variants with genomic location | 235 (89.7% ) |
| Variants in a variant database, i.e. with rs ID | 172 (65.6%) |
| Variant Type | Count | Percent |
|---|---|---|
| complex rearrangement | 2 | 0.8% |
| deletion, gross (>20) | 22 | 8.4% |
| deletion, small (<=20) | 32 | 12.2% |
| delins, gross (>20) | 2 | 0.8% |
| delins, small (<=20) | 10 | 3.8% |
| duplication | 3 | 1.1% |
| haplotype | 1 | 0.4% |
| insertion, gross (>20) | 4 | 1.5% |
| insertion, small (<=20) | 13 | 5.0% |
| inversion | 1 | 0.4% |
| repeat variation | 1 | 0.4% |
| substitution | 170 | 64.9% |
| unknown | 1 | 0.4% |
| Variant Effect | Count | Percent |
|---|---|---|
| deletion (in-frame) | 8 | 3.1% |
| delins (in-frame) | 3 | 1.1% |
| extension (stop-lost) | 2 | 0.8% |
| frameshift | 43 | 16.4% |
| missense | 105 | 40.1% |
| nonsense (stop-gain) | 44 | 16.8% |
| regulatory | 2 | 0.8% |
| splicing | 23 | 8.8% |
| start-lost | 1 | 0.4% |
| unknown | 31 | 11.8% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1987 | 1 | 0.4% |
| 1988 | 0 | 0.0% |
| 1989 | 1 | 0.4% |
| 1990 | 1 | 0.4% |
| 1991 | 0 | 0.0% |
| 1992 | 1 | 0.4% |
| 1993 | 1 | 0.4% |
| 1994 | 0 | 0.0% |
| 1995 | 0 | 0.0% |
| 1996 | 4 | 1.5% |
| 1997 | 4 | 1.5% |
| 1998 | 5 | 1.9% |
| 1999 | 4 | 1.5% |
| 2000 | 5 | 1.9% |
| 2001 | 2 | 0.8% |
| 2002 | 7 | 2.7% |
| 2003 | 1 | 0.4% |
| 2004 | 2 | 0.8% |
| 2005 | 3 | 1.1% |
| 2006 | 7 | 2.7% |
| 2007 | 7 | 2.7% |
| 2008 | 4 | 1.5% |
| 2009 | 6 | 2.3% |
| 2010 | 4 | 1.5% |
| 2011 | 8 | 3.1% |
| 2012 | 11 | 4.2% |
| 2013 | 8 | 3.1% |
| 2014 | 13 | 5.0% |
| 2015 | 12 | 4.6% |
| 2016 | 26 | 9.9% |
| 2017 | 21 | 8.0% |
| 2018 | 5 | 1.9% |
| 2019 | 7 | 2.7% |
| 2020 | 13 | 5.0% |
| 2021 | 27 | 10.3% |
| 2022 | 15 | 5.7% |
| 2023 | 8 | 3.1% |
| 2024 | 6 | 2.3% |
| 2025 | 12 | 4.6% |