Search Results

Advanced search

Link to this search: https://omia.org/results/?gb_species_id=9940&result_type=variant&search_type=advanced

105 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Variant Type Variant Effect Source of Genetic Variant AVCG Pathogenicity Classification* Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
318 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.1938399G>T XM_027969213.1:c.424G>T XP_027825014.1:p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
857 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.2088231G>A XP_027825015.1:c.673G>A XP_027825015.1:p.(V225M) Published as g.1862883G>A /  (V15M),  previously listed in OMIA as XM_012156230:c.805G>A, XP_012011620:p.Val269Met based on Joller et al., 2017; coordinates in this table updated to a recent reference genome [10/06/2025] 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1750 OMIA:001562-9940 sheep Persian (Sheep) Pulmonary hypoplasia with anasarca ADAMTS3 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated Oarv3.1 6 NC_019463.1:g.87124344del XM_012180125.1:c.2055+3del XP_012035515.1:p.(V680_V685del) the variant results in the activation of a cryptic splice site within exon 14 2024 39409761
233 OMIA:000662-9940 sheep Romney Marsh (Sheep) Motor neuron disease, lower AGTPBP1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.35795594G>C XM_015093043.2:c.2909G>C XP_014948529.2:p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1252 OMIA:001672-9940 sheep Zwartbles (Sheep) Type 1 Primary Hyperoxaluria AGXT substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.801189C>T XM_027966918.1:c.584G>A XP_027822719.1:p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
1486 OMIA:002162-9940 sheep Hypophosphatasia ALPL substitution missense Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.260716094G>C XM_027965561.1:c.1077C>G XP_027821362.1:p.(I359M) XM_027965561.1; XP_027821362.1 2018 30446691
1828 OMIA:001492-9940 sheep Merino (Sheep) Axonopathy, segmental ALS2 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 2 NC_056055.1:g.204020069-204020070del NC_056055.1:g.204020069-204020070del XP_011998058.1:p.(L1380Gfs*17) 2025 41131452
714 OMIA:000201-9940 sheep Merino (Sheep) White fleece ASIP Wt insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH 2008 18493018
1111 OMIA:000201-9940 sheep Recessive black ASIP a deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.66475132_66475136del published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site 2002 12354151 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1112 OMIA:000201-9940 sheep Recessive black ASIP a substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 NC_040264.1:g.66474980T>A NM_001134303.1:c.376T>A NP_001127775.1:p.(C126S) Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 2008 18493018 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
439 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 11 g.36938224T>A c.766+2831A>T ENSOART00000006875.1:c.766+2831A>T ENSOART00000006877.1:c.781+2831A>T rs588626728 2013 24086150
440 OMIA:001885-9940 sheep Lacaune (Sheep) Fecundity, Lacaune, FecL B4GALNT2 substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 11 g.37034573A>G 2013 24086150
1333 OMIA:001079-9940 sheep spælsau (Sheep) yellow fat BCO2 insertion, gross (>20) Naturally occurring variant Not currently evaluated 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
320 OMIA:001079-9940 sheep spælsau (Sheep) Yellow fat BCO2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 15 NC_040266.1:g.25024133C>T XM_012095240.3:c.196C>T XP_011950630.2:p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
755 OMIA:002306-9940 sheep Tunisian Barbary (Sheep) Fecundity, Barbarine BMP15 FecX(Bar) complex rearrangement frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X g.[56600937insG;56600945_56600947del;56600948C>A] c.[301G>T;302_304delCTA;310insC] p.(A101Cfs*113) "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 2017 28506298
244 OMIA:002306-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, Belclare BMP15 FecX(B) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594843C>A NM_001114767.1:c.1100G>T NP_001108239.1:p.(S367I) 2004 14627550 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
238 OMIA:002306-9940 sheep Olkuska (Sheep) Fecundity, Olkuska BMP15 FecX(O) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594934T>G NM_001114767.1:c.1009A>C NP_001108239.1:p.(N337H) Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
236 OMIA:002306-9940 sheep Lacaune (Sheep) Fecundity, Lacaune BMP15 FecX(L) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594981C>T NM_001114767.1:c.962G>A NP_001108239.1:p.(C321Y) cDNA position based on NP_001108239.1 2007 17038554 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
237 OMIA:002306-9940 sheep Grivette (Sheep) Fecundity, Grivette BMP15 FecX(Gr) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56594993G>A NM_001114767.1:c.950C>T NP_001108239.1:p.(T317I) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
235 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Inverdale BMP15 FecX(I) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595047A>T NM_001114767.1:c.896T>A NP_001108239.1:p.(V299D) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively rs398521635 2000 10888873 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
335 OMIA:002306-9940 sheep Romney Marsh (Sheep) Fecundity, Hanna BMP15 FecX(H) substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595072G>A NM_001114767.1:c.871C>T NP_001108239.1:p.(Q291*) previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively rs413916687 2000 10888873
334 OMIA:002306-9940 sheep Cambridge (Sheep) Fecundity, Galway BMP15 FecX(G) substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595225G>A NM_001114767.1:c.718C>T NP_001108239.1:p.(Q239*) rs425019156 2004 14627550
521 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity, Rasa Aragonesa BMP15 FecX(R) deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.56595467_56595483del NM_001114767.1:c.460_476del NP_001108239.1:p.(W154Nfs*55) published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively 2008 18355397 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1345 OMIA:002306-9940 sheep Blanc Du Massif Central (Sheep) Noir du Velay, France (Sheep) Fecundity BMP15 FecX(N) substitution regulatory Naturally occurring variant Not currently evaluated Oar_v3.1 X g.50977717T>A 2020 32636872
1341 OMIA:002306-9940 sheep Rasa Aragonesa, Spain (Sheep) Fecundity BMP15 FecX(RA) substitution missense Naturally occurring variant Not currently evaluated Oar_v3.1 X NC_019484.1:g.50970948G>A NM_001114767.1:c.1172C>T NP_001108239.1:p.(T391I) Published as ENSOART00000010201: p.T400I - changed from NC_019484.1:g.50970948C>T to NC_019484.1:g.50970948G>A [09/06/2025]  2020 31927415
1768 OMIA:002074-9940 sheep Tail fat deposition BMP2 Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v1.0 13 NC_040264.1:g.51760995A>C candidate causal variant that influences tail fat weight trait and expression of BMP2 2024 39742295
241 OMIA:000383-9940 sheep Booroola (Sheep) Small Tailed Han, China (Sheep) Fecundity, Booroola BMPR1B FecB(B) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.34010859T>C NM_001009431.1:c.746A>G NP_001009431.1:p.(Q249R) Position on Oar_v3.1: g.29382188T>C, previously listed in OMIA as c.914A>G and p.(Q305R). c. and p. coordinates updated [10/06/2025] rs418841713 2001 11259271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1403 OMIA:002342-9940 sheep Blanc Du Massif Central (Sheep) Lacaune (Sheep) Ciliary dyskinesia, primary (respiratory failure) CCDC65 LDHH6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.147207999C>A XM_004006389.4:c.521G>T XP_004006438.1:p.(E111*) XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A rs1085624756 2021 35052387
1479 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR substitution nonsense (stop-gain) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.57192317C>A NM_001009781.1:c.1621G>T NP_001009781.1:p.(G541*) NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence 2021 34632318
1478 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR deletion, small (<=20) deletion (in-frame) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.57218683_57218685del NM_001009781.1:c.1518_1520del NP_001009781.1:p.(F507del) NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence 2021 34632318
1664 OMIA:000698-9940 sheep Merino (Sheep) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 4 NC_056057.1:g.107930611C>T XM_004008136.5:c.844C>T XP_004008185.4:p.(P282S) rs3487175777 2024 39765607
245 OMIA:000698-9940 sheep Rasa Aragonesa, Spain (Sheep) Myotonia CLCN1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.115541101G>A XM_004008136.4:c.277G>A XP_004008185.4:p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys.  rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
389 OMIA:001482-9940 sheep Borderdale, New Zealand (Sheep) Neuronal ceroid lipofuscinosis, 5 CLN5 substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.56313269G>A NM_001082595.1:c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
671 OMIA:001443-9940 sheep South Hampshire, New Zealand (Sheep) Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
234 OMIA:001443-9940 sheep Merino (Sheep) Neuronal ceroid lipofuscinosis, 6 CLN6 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.16039510G>A NM_001040289.1:c.184C>T NP_001035379.1:p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1016 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.108958871C>T XM_027965914.1:c.1618G>A XP_027821715.1:p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
317 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
1838 OMIA:002127-9940 sheep Charollais (Sheep) Osteogenesis imperfecta, type II COL1A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 11 NC_056064.1:g.36197409G>A XM_027974705.2:c.1189G>A XP_027830506.1:p.(G397S) 2025 40999323
1836 OMIA:001926-9940 sheep Charollais (Sheep) Achondrogenesis type II COL2A1 substitution missense Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 3 NC_056056.1:g.138610131G > A XM_042246797.1:c.2908G > A XP_042102731.1:p.(G970S) 2025 40999323
905 OMIA:001505-9940 sheep Roslagsfår, Sweden (Sheep) Neuronal ceroid lipofuscinosis, 10 CTSD substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 21 NC_040272.1:g.51583020G>A XM_027959254.1:c.883G>A XP_027815055.1:p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
914 OMIA:001354-9940 sheep Rambouillet (Sheep) Muscular hypertrophy (double muscling), Callipyge DLK1 substitution regulatory Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 18 NC_056071.1:g.63330265A>G "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) rs10721113 2002 12368241 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
908 OMIA:001542-9940 sheep Corriedale (Sheep) Hypophosphatemic rickets, autosomal recessive, 1 DMP1 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.112910614C>T XM_012180327.3:c.433C>T XP_012035717.1:p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1550 OMIA:002687-9940 sheep Fleece variation, wool density EDAR substitution regulatory Naturally occurring variant Not currently evaluated Oar_v4.0 3 g.61927840T>C the T allele is associated denser wool production in fine wool sheep rs408766096 2024 37137429
930 OMIA:001765-9940 sheep West African Dwarf (Sheep) Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
621 OMIA:000437-9940 sheep Weißes Alpenschaf, Switzerland (Sheep) Haemophilia A F8 delins, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 X NC_040278.1:g.86301507_86301516delinsTAATTAATACC NM_001172550.1:c.3107_3116delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries [21/09/06]. After checking the cDNA sequence in Fig. 3 of the paper, IT updated c. coordinates from  c.3108_3117delinsGGTATTAATTA to c.3107_3116delinsGGTATTAATTA [10/06/2025]. Published as c.3107del10ins11.
941 OMIA:001723-9940 sheep Romney Marsh (Sheep) Familial episodic ataxia FGF14 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.88095843G>A XM_027973760.1:c.214C>T XP_027829561.1:p.(Q72*) Oar_v3.1 position is g.77593415, published as c.46C>T & p.(Q16*), coordinates in this table updated to reflect recent transcript and protein information 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
225 OMIA:001703-9940 sheep Suffolk (Sheep) Chondrodysplasia, Spider lamb FGFR3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 6 NC_040257.1:g.128784747A>T XM_027971315.1:c.2093T>A XP_027827116.1:p.(V698E) published as c.1719T>A; p.(V700E); updated to HGVS nomenclature [10/04/2026] 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
231 OMIA:002621-9940 sheep South Down (Sheep) Gaucher disease, type GBA substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.111561271C>T XM_004002580.4:c.1142G>A XP_004002629.2:p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
239 OMIA:002362-9940 sheep Wicklow Cheviot (Sheep) Fecundity, Thoka, FecG GDF9 FecG(T) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545130T>G NM_001142888.2:c.1279A>C NP_001136360.2:p.(S427R) Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively 2009 19713444 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
242 OMIA:002362-9940 sheep Belclare (Sheep) Cambridge (Sheep) Fecundity, High fertility, FecG GDF9 FecG(H) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545225G>A NM_001142888.2:c.1184C>T NP_001136360.2:p.(S395F) Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively 2004 14627550 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
243 OMIA:002362-9940 sheep Gammelnorsk spaelsau, Norway (Sheep) Fecundity, Norwegian White Sheep GDF9 FecG(F) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545298C>T NC_040256.1:c.1111G>A NP_001136360.2:p.(V371M) Oar_v3.1 position is g.41841285C>T rs403536877 2013 23280002 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
240 OMIA:002362-9940 sheep Pelibuey, Mexico (Sheep) Santa Ines, Brazil (Sheep) Fecundity, Embrapa, FecG GDF9 FecG(E) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545375A>C NM_001142888.2:c.1034T>G NP_001136360.2:p.(F345C) Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively rs1092755620 2011 20528846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1407 OMIA:002362-9940 sheep Icelandic (Sheep) Fecundity, Loa, FecG GDF9 FecG(L) deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545396_46545399del NP_001136360.2:p.(N337Rfs*26) Oar_v3.1 position is g.41841383_41841386del 2021 34967038
246 OMIA:002362-9940 sheep Ile-De-France (Sheep) Fecundity, Vacaria, FecG GDF9 FecG(V) substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 5 NC_040256.1:g.46545466G>A NM_001142888.2:c.943C>T NP_001136360.2:p.(R315C) Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively 2014 25039891 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
230 OMIA:000402-9940 sheep Romney Marsh (Sheep) Gangliosidosis, GM1 GLB1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 19 NC_040270.1:g.8003247C>A XM_015102219.2:c.686G>T XP_014957705.2:p.(C299F) 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
387 OMIA:001461-9940 sheep Jacob (Sheep) Gangliosidosis, GM2, type I (B variant) HEXA substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.20584348C>G NM_001126343.1:c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1153 OMIA:001952-9940 sheep Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) Microtia HMX1 duplication Naturally occurring variant Not currently evaluated Oar_v4.0 6 g.114173249_114173324dup He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). 2020 31691317
1742 OMIA:002721-9940 sheep Tail length, long HOXB13 insertion, gross (>20) Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 11 NC_056064.1:g.37524995_37524996insN[168] 2022 36068271
1285 OMIA:000806-9940 sheep Damara (Sheep) Hebridean (Sheep) Jacob (Sheep) Manx Loaghtan (Sheep) Navajo-Churro (Sheep) Sishui, China (Sheep) Polyceraty HOXD1 deletion, small (<=20) splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.144548739_144548742del "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) 2021 33528505
319 OMIA:002229-9940 sheep Valle del Belice, Italy (Sheep) Hypotrichosis HR substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.45703202C>T XM_027964354.1:c.1312C>T XP_027820155.1:p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
805 OMIA:001528-9940 sheep INRA 401, France (Sheep) Fleece variation, woolly IRF2BP2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 25 insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene 2017 28379502
1272 OMIA:001948-9940 sheep Mouton vendéen, France (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 11 NC_040262.1:g.7412626C>T XM_027974087.1:c.2791C>T XP_027829888.1:p.(R931*) Published as OAR11_v4.0, g.54799925G>A  / p.Arg885* 2020 33225458
543 OMIA:001948-9940 sheep Spanish Churro (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 11 NC_040262.1:g.7425460_7425463del XM_027974087.1:c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1549 OMIA:002687-9940 sheep Fleece variation, fine wool KRT74 substitution missense Naturally occurring variant Not currently evaluated Oar_v4.0 3 NC_019460.2:g.133486008C>A XM_004006324.3:c.367C>A XP_004006373.1:p.(H123N) XM_004006324.3; XP_004006373.1; the C allele is associated with wool fineness rs427563779 2024 37137429
1781 OMIA:002269-9940 sheep Bleu Du Maine (Sheep) Junctional epidermolysis bullosa LAMB3 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 12 NC_056065.1:g.73166198delG XM_042229255.1:c.3051 + 1delG XP_042085189.1:p.(V1018Ffs*12) the 1-bp deletion affects the first nucleotide of intron 20 at the exon/intron boundary and mary result in altered splicing of exon 20 2025 40100311
507 OMIA:001678-9940 sheep German Blackheaded Mutton (Sheep) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 12 NC_040263.1:g.68856318_68856319del NM_001142358.1:c.2746_2747del NP_001135830.1:p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
915 OMIA:001694-9940 sheep Polypay (Sheep) Resistance to lentivirus LOC105603932 Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 20 g.32931861_32931862del Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). rs397514112 2013 24303974 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1110 OMIA:001199-9940 sheep Valle del Belice, Italy (Sheep) Recessive pheomelanism MC1R e substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487353C>T NM_001282528.1:c.199C>T NP_001269457.1:p.(R67C) 2010 Reference not in PubMed; see OMIA 001199-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
229 OMIA:001199-9940 sheep Corriedale (Sheep) Dala (Sheep) Damara (Sheep) Merino (Sheep) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487372T>A NM_001282528.1:c.218T>A NP_001269457.1:p.(M73K) 1999 9892731 c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
228 OMIA:001199-9940 sheep Massese, Italy (Sheep) Dominant black MC1R E^D substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487515G>A NM_001282528.1:c.361G>A NP_001269457.1:p.(D121N) 1999 9892731 c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1108 OMIA:001199-9940 sheep Gute (Sheep) Swedish Fur (Sheep) Värmlandsfår, Sweden (Sheep) Dominant black MC1R substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.15487606G>A NM_001282528.1:c.452G>A NP_001269457.1:p.(R151Q) 2019 31475378 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1637 OMIA:002371-9940 sheep Kerry Hill (Sheep) Microcephaly, MFSD2A-related MFSD2A duplication frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 1 NC_056054.1:g.14577421dup XM_004001833.5:c.285dup XP_004001882.2:p.(D96Rfs*9) XM_004001833.5; XP_004001882.2 2024 37921236
1217 OMIA:000031-9940 sheep Jacob (Sheep) Lilac MLPH substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.3580535C>A NM_001146271.1:c.40G>T NP_001139743.1:p.(E14*) Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) 2020 32512769
1690 OMIA:002849-9940 sheep Manech Tête Rousse, France (Sheep) Methylmalonyl-CoA mutase deficiency MMUT substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 20 NC_040271.1:g.23776347G>A XM_004018875.4:c.1225C>T XP_004018923.1:p.(Q409*) 2024 38424485
435 OMIA:000683-9940 sheep Texel (Sheep) Muscular hypertrophy (double muscling), Texel MSTN substitution regulatory Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 g.129065977G>A c.*1232G>A "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" rs408469734 2006 16751773 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1242 OMIA:001595-9940 sheep Merino (Sheep) Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.236304072del XM_027965226.1:c.1716del XP_027821027.1:p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
1141 OMIA:002227-9940 sheep Istrska pramenka (Sheep) Otocephaly OTX2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 7 NC_040258.1:g.71478714G>A XM_015097088.2:c.265C>T XP_014952574.2:p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
1461 OMIA:002552-9940 sheep Pancreatic agenesis PDX1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 10 NC_040261.1:g.33940517_33940724del XM_027973895.1:c.195_403del XM_027973895.1; 208bp deletion 2017 29234093
232 OMIA:000649-9940 sheep Texel (Sheep) Microphthalmia PITX3 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 22 NC_040273.1:g.25497953C>G NM_001178053.1:c.338G>C NP_001171524.1:p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1267 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.230750869G>A XM_027968104.1:c.1186C>T XP_027823905.1:p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
1266 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 NC_040254.1:g.230766713T>C XM_004006987.4:c.336-2A>G XP_012031020.2:p.(L71Wfs*3) 2021 33159255
1353 OMIA:001504-9940 sheep Neuronal ceroid lipofuscinosis, 1 PPT1 delins, small (<=20) nonsense (stop-gain) Genome-editing (CRISPR-Cas9) Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.15235231_15235231delinsTTA XP_004001885.2:p.(R151*) 2019 31289301
1553 OMIA:002693-9940 sheep Cheviot (Sheep) Achondroplasia, PRICKLE1-related PRICKLE1 deletion, small (<=20) Naturally occurring variant Not currently evaluated 3 10 bp deletion in the open reading frame 2016 Reference not in PubMed; see OMIA 002693-9940 for reference details
823 OMIA:000944-9940 sheep Ile-De-France (Sheep) Romanov (Sheep) Resistance to scrapie PRNP V Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.48675389C>T c.407C>T p.(A136V) Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs591379086 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
825 OMIA:000944-9940 sheep Resistance to scrapie, Nor98 type PRNP F Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.48675403C>T c.421C>T p.(L141F) Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs598580733 2005 15604451 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
824 OMIA:000944-9940 sheep Ile-De-France (Sheep) Romanov (Sheep) Resistance to scrapie PRNP H Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.48675443G>A c.461G>A p.(R154H) Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs605048948 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
822 OMIA:000944-9940 sheep Suffolk (Sheep) Resistance to scrapie PRNP Q Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 13 g.48675494G>A c.512G>A p.(R171Q) Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively rs160575103 1990 1969635 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
388 OMIA:001139-9940 sheep Merino (Sheep) Glycogen storage disease V PYGM substitution splicing Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 21 NC_040272.1:g.44787090C>T NM_001009192.2:c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1663 OMIA:001867-9940 sheep Poll Dorset (Sheep) Lissencephaly and cerebellar hypoplasia RELN substitution missense Naturally occurring variant Not currently evaluated Oar_Rambouillet_v1.0 4 NC_040255.1:g.50288685C>T NM_001306121.1:c.7088G>A NP_001293050.1:p.(R2363H) Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. 2024 39394905
673 OMIA:001867-9940 sheep Spanish Churro (Sheep) Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.50313243_50313273del NM_001306121.1:c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
926 OMIA:000483-9940 sheep Polled RXFP2 insertion, gross (>20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 10 "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" 2015 26103004
506 OMIA:001400-9940 sheep Texel (Sheep) Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 4 NC_040255.1:g.95624809del XM_004008022.4:c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
1707 OMIA:002862-9940 sheep Manech Tête Rousse, France (Sheep) Haplotype with homozygous deficiency, SLC33A1-related SLC33A1 MTRDHH2 duplication frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.252649023dupG XM_012100950.3:c.735dupG XP_011956340.1:p.(R246Afs*3) 2024 38922751
1761 OMIA:001821-9940 sheep Suffolk (Sheep) Suffolk white fleece SLC45A2 deletion, small (<=20) deletion (in-frame) Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v3.0 16 NC_056069.1:g39966131_39966133del XM_004017064.5:c.661_663del XP_004017113.5:p.(F221del) 2025 39608806
1608 OMIA:002755-9940 sheep South Down (Sheep) Congenital photosensitivity and hyperbilirubinaemia SLCO1B3 substitution missense Naturally occurring variant Not currently evaluated Oar_v3.1 3 NC_019460.1:g.193691915C>T XM_012175224.1:c.1318G>A XP_012030614.1:p.(G440R) XM_012175224.1; XP_012030614.1 2018 29688779
1420 OMIA:001744-9940 sheep Elevated milk leukocytes count SOCS2 Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 3 g.139302270C>T c.286C>T p.(R96C) Oar_v3.1 position g.129722200C>T, transcripts XM_027967202.1, ENSOART00020018904.1:c.286C>T ENSOARP00020015648.1:p.Arg96Cys rs868996547 2015 26658352
1578 OMIA:000975-9940 sheep Tail, short TBXT substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 8 NC_040259.1:g.95879358C>A XM_027972732.1:c.334G>T XP_027828533.1:p.G112W The gene is also called TBXT 2018 35948368 29208649
1595 OMIA:002370-9940 sheep North Country Cheviot (Sheep) Motor neuron disease, TMCO6-related TMCO6 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated ARS-UI_Ramb_v2.0 5 NC_056058.1:g.49438388_49438391del XM_012178620.3:c.645_648del XP_012034010.1:p.(L215Ffs*34) XP_012034010.1 2023 37488055
1042 OMIA:002176-9940 sheep Coopworth (Sheep) Perendale (Sheep) Meckel-like hepatorenal fibrocystic dysplasia syndrome TMEM67 haplotype Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 9 NC_040260.1:g.[91651651A>C;91651669A>T] XM_012184130.2:c.[2042T>A;2060T>G] XP_012039520.2:p.[(I681N);(I687S)] Published as c.[2050T>A; 2068T>G] rs1086155906; rs1088172192 2017 28487520 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1238 OMIA:002285-9940 sheep Merino (Sheep) Ovine congenital progressive muscular dystrophy TNNT1 deletion, small (<=20) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 14 NC_040265.1:g.66970247del XM_027978800.1:c.746+1del Published as "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) 2020 32819427
227 OMIA:001249-9940 sheep Brown TYRP1 substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 c.2240C>G p.(A???V) 2013 23451726
1127 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS1 deletion, small (<=20) frameshift Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87540706_87540707del NM_001130023.1:c.86_87del NP_001123495.1:p.(E29Vfs*5) NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) 2019 31571241 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA
226 OMIA:001249-9940 sheep Soay (Sheep) Tawny (light brown) TYRP1 b^Soay substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87545636G>T NM_001130023.1:c.869G>T NP_001123495.1:p.(C290F) rs402624085 2007 17254985 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1128 OMIA:001249-9940 sheep Valais Red (Sheep) Brown TYRP1 b^VS2 substitution nonsense (stop-gain) Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 2 NC_040253.1:g.87549195C>T NM_001130023.1:c.1066C>T NP_001123495.1:p.(R356*) NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) rs1085637427 2019 31571241
906 OMIA:001176-9940 sheep Scottish Blackface (Sheep) Porphyria cutanea tarda UROD substitution missense Naturally occurring variant Not currently evaluated Oar_rambouillet_v1.0 1 NC_040252.1:g.20327971T>C NM_001012341.1:c.392T>C NP_001012341.1:p.(L131P) Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively rs429214636 2005 16026339 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.

* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.

Overall Statistics
Total number of variants 105
Variants with genomic location 103 (98.1% )
Variants in a variant database, i.e. with rs ID 30 (28.6%)
Variant Type Count Percent
complex rearrangement 1 1.0%
deletion, gross (>20) 4 3.8%
deletion, small (<=20) 17 16.2%
delins, small (<=20) 2 1.9%
duplication 3 2.9%
haplotype 1 1.0%
insertion, gross (>20) 5 4.8%
substitution 65 61.9%
unknown 7 6.7%
Variant Effect Count Percent
deletion (in-frame) 2 1.9%
frameshift 12 11.4%
missense 39 37.1%
nonsense (stop-gain) 18 17.1%
regulatory 6 5.7%
splicing 6 5.7%
unknown 22 21.0%
Year First Reported Count Percent
1990 1 1.0%
1991 0 0.0%
1992 0 0.0%
1993 2 1.9%
1994 0 0.0%
1995 0 0.0%
1996 0 0.0%
1997 1 1.0%
1998 0 0.0%
1999 2 1.9%
2000 3 2.9%
2001 1 1.0%
2002 2 1.9%
2003 1 1.0%
2004 3 2.9%
2005 2 1.9%
2006 3 2.9%
2007 2 1.9%
2008 4 3.8%
2009 1 1.0%
2010 6 5.7%
2011 3 2.9%
2012 5 4.8%
2013 9 8.6%
2014 1 1.0%
2015 5 4.8%
2016 1 1.0%
2017 7 6.7%
2018 3 2.9%
2019 4 3.8%
2020 9 8.6%
2021 8 7.6%
2022 1 1.0%
2023 1 1.0%
2024 9 8.6%
2025 5 4.8%