Search Results
Advanced search
Link to this search: https://omia.org/results/?gb_species_id=9940&result_type=variant&search_type=advanced
105 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Variant Type | Variant Effect | Source of Genetic Variant | AVCG Pathogenicity Classification* | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 318 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.1938399G>T | XM_027969213.1:c.424G>T | XP_027825014.1:p.(E142*) | XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) | 2012 | 22497338 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 857 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.2088231G>A | XP_027825015.1:c.673G>A | XP_027825015.1:p.(V225M) | Published as g.1862883G>A / (V15M), previously listed in OMIA as XM_012156230:c.805G>A, XP_012011620:p.Val269Met based on Joller et al., 2017; coordinates in this table updated to a recent reference genome [10/06/2025] | 2015 | 25354687 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1750 | OMIA:001562-9940 | sheep | Persian (Sheep) | Pulmonary hypoplasia with anasarca | ADAMTS3 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Oarv3.1 | 6 | NC_019463.1:g.87124344del | XM_012180125.1:c.2055+3del | XP_012035515.1:p.(V680_V685del) | the variant results in the activation of a cryptic splice site within exon 14 | 2024 | 39409761 | |||
| 233 | OMIA:000662-9940 | sheep | Romney Marsh (Sheep) | Motor neuron disease, lower | AGTPBP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.35795594G>C | XM_015093043.2:c.2909G>C | XP_014948529.2:p.(R970P) | protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively | 2012 | 22588130 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1252 | OMIA:001672-9940 | sheep | Zwartbles (Sheep) | Type 1 Primary Hyperoxaluria | AGXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.801189C>T | XM_027966918.1:c.584G>A | XP_027822719.1:p.(C195Y) | NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) | 2020 | 33003365 | |||
| 1486 | OMIA:002162-9940 | sheep | Hypophosphatasia | ALPL | substitution | missense | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.260716094G>C | XM_027965561.1:c.1077C>G | XP_027821362.1:p.(I359M) | XM_027965561.1; XP_027821362.1 | 2018 | 30446691 | ||||
| 1828 | OMIA:001492-9940 | sheep | Merino (Sheep) | Axonopathy, segmental | ALS2 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 2 | NC_056055.1:g.204020069-204020070del | NC_056055.1:g.204020069-204020070del | XP_011998058.1:p.(L1380Gfs*17) | 2025 | 41131452 | ||||
| 714 | OMIA:000201-9940 | sheep | Merino (Sheep) | White fleece | ASIP | Wt | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH | 2008 | 18493018 | ||||||
| 1111 | OMIA:000201-9940 | sheep | Recessive black | ASIP | a | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.66475132_66475136del | published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site | 2002 | 12354151 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| 1112 | OMIA:000201-9940 | sheep | Recessive black | ASIP | a | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | NC_040264.1:g.66474980T>A | NM_001134303.1:c.376T>A | NP_001127775.1:p.(C126S) | Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 | 2008 | 18493018 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 439 | OMIA:001885-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune, FecL | B4GALNT2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 11 | g.36938224T>A | c.766+2831A>T | ENSOART00000006875.1:c.766+2831A>T ENSOART00000006877.1:c.781+2831A>T | rs588626728 | 2013 | 24086150 | |||
| 440 | OMIA:001885-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune, FecL | B4GALNT2 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 11 | g.37034573A>G | 2013 | 24086150 | ||||||
| 1333 | OMIA:001079-9940 | sheep | spælsau (Sheep) | yellow fat | BCO2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | 15 | "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) | 2021 | 34193038 | ||||||||
| 320 | OMIA:001079-9940 | sheep | spælsau (Sheep) | Yellow fat | BCO2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 15 | NC_040266.1:g.25024133C>T | XM_012095240.3:c.196C>T | XP_011950630.2:p.(Q66*) | Oar_v3.1 position is g.21947481C>T | rs1090867485 | 2010 | 20122251 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 755 | OMIA:002306-9940 | sheep | Tunisian Barbary (Sheep) | Fecundity, Barbarine | BMP15 | FecX(Bar) | complex rearrangement | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | g.[56600937insG;56600945_56600947del;56600948C>A] | c.[301G>T;302_304delCTA;310insC] | p.(A101Cfs*113) | "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 | 2017 | 28506298 | ||
| 244 | OMIA:002306-9940 | sheep | Belclare (Sheep) Cambridge (Sheep) | Fecundity, Belclare | BMP15 | FecX(B) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594843C>A | NM_001114767.1:c.1100G>T | NP_001108239.1:p.(S367I) | 2004 | 14627550 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 238 | OMIA:002306-9940 | sheep | Olkuska (Sheep) | Fecundity, Olkuska | BMP15 | FecX(O) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594934T>G | NM_001114767.1:c.1009A>C | NP_001108239.1:p.(N337H) | Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 236 | OMIA:002306-9940 | sheep | Lacaune (Sheep) | Fecundity, Lacaune | BMP15 | FecX(L) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594981C>T | NM_001114767.1:c.962G>A | NP_001108239.1:p.(C321Y) | cDNA position based on NP_001108239.1 | 2007 | 17038554 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 237 | OMIA:002306-9940 | sheep | Grivette (Sheep) | Fecundity, Grivette | BMP15 | FecX(Gr) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56594993G>A | NM_001114767.1:c.950C>T | NP_001108239.1:p.(T317I) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | 2013 | 23637641 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 235 | OMIA:002306-9940 | sheep | Romney Marsh (Sheep) | Fecundity, Inverdale | BMP15 | FecX(I) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595047A>T | NM_001114767.1:c.896T>A | NP_001108239.1:p.(V299D) | protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively | rs398521635 | 2000 | 10888873 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 335 | OMIA:002306-9940 | sheep | Romney Marsh (Sheep) | Fecundity, Hanna | BMP15 | FecX(H) | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595072G>A | NM_001114767.1:c.871C>T | NP_001108239.1:p.(Q291*) | previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively | rs413916687 | 2000 | 10888873 | |
| 334 | OMIA:002306-9940 | sheep | Cambridge (Sheep) | Fecundity, Galway | BMP15 | FecX(G) | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595225G>A | NM_001114767.1:c.718C>T | NP_001108239.1:p.(Q239*) | rs425019156 | 2004 | 14627550 | ||
| 521 | OMIA:002306-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Fecundity, Rasa Aragonesa | BMP15 | FecX(R) | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.56595467_56595483del | NM_001114767.1:c.460_476del | NP_001108239.1:p.(W154Nfs*55) | published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively | 2008 | 18355397 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1345 | OMIA:002306-9940 | sheep | Blanc Du Massif Central (Sheep) Noir du Velay, France (Sheep) | Fecundity | BMP15 | FecX(N) | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | X | g.50977717T>A | 2020 | 32636872 | |||||
| 1341 | OMIA:002306-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Fecundity | BMP15 | FecX(RA) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | X | NC_019484.1:g.50970948G>A | NM_001114767.1:c.1172C>T | NP_001108239.1:p.(T391I) | Published as ENSOART00000010201: p.T400I - changed from NC_019484.1:g.50970948C>T to NC_019484.1:g.50970948G>A [09/06/2025] | 2020 | 31927415 | ||
| 1768 | OMIA:002074-9940 | sheep | Tail fat deposition | BMP2 | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v1.0 | 13 | NC_040264.1:g.51760995A>C | candidate causal variant that influences tail fat weight trait and expression of BMP2 | 2024 | 39742295 | ||||||||
| 241 | OMIA:000383-9940 | sheep | Booroola (Sheep) Small Tailed Han, China (Sheep) | Fecundity, Booroola | BMPR1B | FecB(B) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.34010859T>C | NM_001009431.1:c.746A>G | NP_001009431.1:p.(Q249R) | Position on Oar_v3.1: g.29382188T>C, previously listed in OMIA as c.914A>G and p.(Q305R). c. and p. coordinates updated [10/06/2025] | rs418841713 | 2001 | 11259271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 1403 | OMIA:002342-9940 | sheep | Blanc Du Massif Central (Sheep) Lacaune (Sheep) | Ciliary dyskinesia, primary (respiratory failure) | CCDC65 | LDHH6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.147207999C>A | XM_004006389.4:c.521G>T | XP_004006438.1:p.(E111*) | XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A | rs1085624756 | 2021 | 35052387 | |
| 1479 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | substitution | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57192317C>A | NM_001009781.1:c.1621G>T | NP_001009781.1:p.(G541*) | NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence | 2021 | 34632318 | |||
| 1478 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | deletion, small (<=20) | deletion (in-frame) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57218683_57218685del | NM_001009781.1:c.1518_1520del | NP_001009781.1:p.(F507del) | NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence | 2021 | 34632318 | |||
| 1664 | OMIA:000698-9940 | sheep | Merino (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 4 | NC_056057.1:g.107930611C>T | XM_004008136.5:c.844C>T | XP_004008185.4:p.(P282S) | rs3487175777 | 2024 | 39765607 | |||
| 245 | OMIA:000698-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Myotonia | CLCN1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.115541101G>A | XM_004008136.4:c.277G>A | XP_004008185.4:p.(E93K) | Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. | rs401726021 | 2015 | 25744800 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 389 | OMIA:001482-9940 | sheep | Borderdale, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.56313269G>A | NM_001082595.1:c.571+1G>A | rs422165326 | 2008 | 17988881 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 671 | OMIA:001443-9940 | sheep | South Hampshire, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis | CLN6 | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | deletion of exon 1 | 2013 | 23338040 | |||||||
| 234 | OMIA:001443-9940 | sheep | Merino (Sheep) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.16039510G>A | NM_001040289.1:c.184C>T | NP_001035379.1:p.(R62C) | protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively | rs399747319 | 2006 | 17046213 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1016 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.108958871C>T | XM_027965914.1:c.1618G>A | XP_027821715.1:p.(G540S) | 2017 | 28282490 | Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 317 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oori1 scaffold00739 | 3 | g.263324C>T | c.706C>T | p.(R236*) | In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" | 2010 | 19874885 | |||
| 1838 | OMIA:002127-9940 | sheep | Charollais (Sheep) | Osteogenesis imperfecta, type II | COL1A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 11 | NC_056064.1:g.36197409G>A | XM_027974705.2:c.1189G>A | XP_027830506.1:p.(G397S) | 2025 | 40999323 | ||||
| 1836 | OMIA:001926-9940 | sheep | Charollais (Sheep) | Achondrogenesis type II | COL2A1 | substitution | missense | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 3 | NC_056056.1:g.138610131G > A | XM_042246797.1:c.2908G > A | XP_042102731.1:p.(G970S) | 2025 | 40999323 | ||||
| 905 | OMIA:001505-9940 | sheep | Roslagsfår, Sweden (Sheep) | Neuronal ceroid lipofuscinosis, 10 | CTSD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.51583020G>A | XM_027959254.1:c.883G>A | XP_027815055.1:p.(D295N) | published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively | 2000 | 10856224 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 914 | OMIA:001354-9940 | sheep | Rambouillet (Sheep) | Muscular hypertrophy (double muscling), Callipyge | DLK1 | substitution | regulatory | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 18 | NC_056071.1:g.63330265A>G | "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) | rs10721113 | 2002 | 12368241 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 908 | OMIA:001542-9940 | sheep | Corriedale (Sheep) | Hypophosphatemic rickets, autosomal recessive, 1 | DMP1 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.112910614C>T | XM_012180327.3:c.433C>T | XP_012035717.1:p.(R145*) | Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. | 2011 | 21747952 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1550 | OMIA:002687-9940 | sheep | Fleece variation, wool density | EDAR | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 3 | g.61927840T>C | the T allele is associated denser wool production in fine wool sheep | rs408766096 | 2024 | 37137429 | |||||
| 930 | OMIA:001765-9940 | sheep | West African Dwarf (Sheep) | Waardenburg syndrome, type 4A | EDNRB | deletion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" | 2012 | 23300849 | |||||||
| 621 | OMIA:000437-9940 | sheep | Weißes Alpenschaf, Switzerland (Sheep) | Haemophilia A | F8 | delins, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | X | NC_040278.1:g.86301507_86301516delinsTAATTAATACC | NM_001172550.1:c.3107_3116delinsGGTATTAATTA | The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon | 2010 | 19943872 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries [21/09/06]. After checking the cDNA sequence in Fig. 3 of the paper, IT updated c. coordinates from c.3108_3117delinsGGTATTAATTA to c.3107_3116delinsGGTATTAATTA [10/06/2025]. Published as c.3107del10ins11. | ||||
| 941 | OMIA:001723-9940 | sheep | Romney Marsh (Sheep) | Familial episodic ataxia | FGF14 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.88095843G>A | XM_027973760.1:c.214C>T | XP_027829561.1:p.(Q72*) | Oar_v3.1 position is g.77593415, published as c.46C>T & p.(Q16*), coordinates in this table updated to reflect recent transcript and protein information | 2017 | 29253853 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 225 | OMIA:001703-9940 | sheep | Suffolk (Sheep) | Chondrodysplasia, Spider lamb | FGFR3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.128784747A>T | XM_027971315.1:c.2093T>A | XP_027827116.1:p.(V698E) | published as c.1719T>A; p.(V700E); updated to HGVS nomenclature [10/04/2026] | 2006 | 16441300 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 231 | OMIA:002621-9940 | sheep | South Down (Sheep) | Gaucher disease, type | GBA | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.111561271C>T | XM_004002580.4:c.1142G>A | XP_004002629.2:p.(C381Y) | Oar_v3.1 position is g.103978212C>T | rs429928390 | 2017 | 29023809 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 239 | OMIA:002362-9940 | sheep | Wicklow Cheviot (Sheep) | Fecundity, Thoka, FecG | GDF9 | FecG(T) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545130T>G | NM_001142888.2:c.1279A>C | NP_001136360.2:p.(S427R) | Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively | 2009 | 19713444 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 242 | OMIA:002362-9940 | sheep | Belclare (Sheep) Cambridge (Sheep) | Fecundity, High fertility, FecG | GDF9 | FecG(H) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545225G>A | NM_001142888.2:c.1184C>T | NP_001136360.2:p.(S395F) | Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively | 2004 | 14627550 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 243 | OMIA:002362-9940 | sheep | Gammelnorsk spaelsau, Norway (Sheep) | Fecundity, Norwegian White Sheep | GDF9 | FecG(F) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545298C>T | NC_040256.1:c.1111G>A | NP_001136360.2:p.(V371M) | Oar_v3.1 position is g.41841285C>T | rs403536877 | 2013 | 23280002 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 240 | OMIA:002362-9940 | sheep | Pelibuey, Mexico (Sheep) Santa Ines, Brazil (Sheep) | Fecundity, Embrapa, FecG | GDF9 | FecG(E) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545375A>C | NM_001142888.2:c.1034T>G | NP_001136360.2:p.(F345C) | Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively | rs1092755620 | 2011 | 20528846 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
| 1407 | OMIA:002362-9940 | sheep | Icelandic (Sheep) | Fecundity, Loa, FecG | GDF9 | FecG(L) | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545396_46545399del | NP_001136360.2:p.(N337Rfs*26) | Oar_v3.1 position is g.41841383_41841386del | 2021 | 34967038 | |||
| 246 | OMIA:002362-9940 | sheep | Ile-De-France (Sheep) | Fecundity, Vacaria, FecG | GDF9 | FecG(V) | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 5 | NC_040256.1:g.46545466G>A | NM_001142888.2:c.943C>T | NP_001136360.2:p.(R315C) | Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively | 2014 | 25039891 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 230 | OMIA:000402-9940 | sheep | Romney Marsh (Sheep) | Gangliosidosis, GM1 | GLB1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 19 | NC_040270.1:g.8003247C>A | XM_015102219.2:c.686G>T | XP_014957705.2:p.(C299F) | 2012 | Reference not in PubMed; see OMIA 000402-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 387 | OMIA:001461-9940 | sheep | Jacob (Sheep) | Gangliosidosis, GM2, type I (B variant) | HEXA | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.20584348C>G | NM_001126343.1:c.1330G>C | The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. | 2010 | 20817517 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1153 | OMIA:001952-9940 | sheep | Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) | Microtia | HMX1 | duplication | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 6 | g.114173249_114173324dup | He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). | 2020 | 31691317 | ||||||
| 1742 | OMIA:002721-9940 | sheep | Tail length, long | HOXB13 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 11 | NC_056064.1:g.37524995_37524996insN[168] | 2022 | 36068271 | ||||||||
| 1285 | OMIA:000806-9940 | sheep | Damara (Sheep) Hebridean (Sheep) Jacob (Sheep) Manx Loaghtan (Sheep) Navajo-Churro (Sheep) Sishui, China (Sheep) | Polyceraty | HOXD1 | deletion, small (<=20) | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.144548739_144548742del | "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) | 2021 | 33528505 | |||||
| 319 | OMIA:002229-9940 | sheep | Valle del Belice, Italy (Sheep) | Hypotrichosis | HR | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.45703202C>T | XM_027964354.1:c.1312C>T | XP_027820155.1:p.(Q438*) | Oar_v3.1 position is g.43224867C>T | rs423413166 | 2003 | 12927087 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 805 | OMIA:001528-9940 | sheep | INRA 401, France (Sheep) | Fleece variation, woolly | IRF2BP2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 25 | insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene | 2017 | 28379502 | |||||||
| 1272 | OMIA:001948-9940 | sheep | Mouton vendéen, France (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7412626C>T | XM_027974087.1:c.2791C>T | XP_027829888.1:p.(R931*) | Published as OAR11_v4.0, g.54799925G>A / p.Arg885* | 2020 | 33225458 | |||
| 543 | OMIA:001948-9940 | sheep | Spanish Churro (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7425460_7425463del | XM_027974087.1:c.4412_4415del | Oar_v3.1: g.54849767_54849770del | 2015 | 25955497 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||||
| 1549 | OMIA:002687-9940 | sheep | Fleece variation, fine wool | KRT74 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v4.0 | 3 | NC_019460.2:g.133486008C>A | XM_004006324.3:c.367C>A | XP_004006373.1:p.(H123N) | XM_004006324.3; XP_004006373.1; the C allele is associated with wool fineness | rs427563779 | 2024 | 37137429 | |||
| 1781 | OMIA:002269-9940 | sheep | Bleu Du Maine (Sheep) | Junctional epidermolysis bullosa | LAMB3 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 12 | NC_056065.1:g.73166198delG | XM_042229255.1:c.3051 + 1delG | XP_042085189.1:p.(V1018Ffs*12) | the 1-bp deletion affects the first nucleotide of intron 20 at the exon/intron boundary and mary result in altered splicing of exon 20 | 2025 | 40100311 | |||
| 507 | OMIA:001678-9940 | sheep | German Blackheaded Mutton (Sheep) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | deletion, small (<=20) | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 12 | NC_040263.1:g.68856318_68856319del | NM_001142358.1:c.2746_2747del | NP_001135830.1:p.(A928*) | FM872310 c.2746delCA | 2011 | 21573221 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 915 | OMIA:001694-9940 | sheep | Polypay (Sheep) | Resistance to lentivirus | LOC105603932 | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 20 | g.32931861_32931862del | Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). | rs397514112 | 2013 | 24303974 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||||
| 1110 | OMIA:001199-9940 | sheep | Valle del Belice, Italy (Sheep) | Recessive pheomelanism | MC1R | e | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487353C>T | NM_001282528.1:c.199C>T | NP_001269457.1:p.(R67C) | 2010 | Reference not in PubMed; see OMIA 001199-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 229 | OMIA:001199-9940 | sheep | Corriedale (Sheep) Dala (Sheep) Damara (Sheep) Merino (Sheep) | Dominant black | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487372T>A | NM_001282528.1:c.218T>A | NP_001269457.1:p.(M73K) | 1999 | 9892731 | c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 228 | OMIA:001199-9940 | sheep | Massese, Italy (Sheep) | Dominant black | MC1R | E^D | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487515G>A | NM_001282528.1:c.361G>A | NP_001269457.1:p.(D121N) | 1999 | 9892731 | c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1108 | OMIA:001199-9940 | sheep | Gute (Sheep) Swedish Fur (Sheep) Värmlandsfår, Sweden (Sheep) | Dominant black | MC1R | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.15487606G>A | NM_001282528.1:c.452G>A | NP_001269457.1:p.(R151Q) | 2019 | 31475378 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1637 | OMIA:002371-9940 | sheep | Kerry Hill (Sheep) | Microcephaly, MFSD2A-related | MFSD2A | duplication | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 1 | NC_056054.1:g.14577421dup | XM_004001833.5:c.285dup | XP_004001882.2:p.(D96Rfs*9) | XM_004001833.5; XP_004001882.2 | 2024 | 37921236 | |||
| 1217 | OMIA:000031-9940 | sheep | Jacob (Sheep) | Lilac | MLPH | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.3580535C>A | NM_001146271.1:c.40G>T | NP_001139743.1:p.(E14*) | Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) | 2020 | 32512769 | |||
| 1690 | OMIA:002849-9940 | sheep | Manech Tête Rousse, France (Sheep) | Methylmalonyl-CoA mutase deficiency | MMUT | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 20 | NC_040271.1:g.23776347G>A | XM_004018875.4:c.1225C>T | XP_004018923.1:p.(Q409*) | 2024 | 38424485 | ||||
| 435 | OMIA:000683-9940 | sheep | Texel (Sheep) | Muscular hypertrophy (double muscling), Texel | MSTN | substitution | regulatory | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | g.129065977G>A | c.*1232G>A | "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" | rs408469734 | 2006 | 16751773 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1242 | OMIA:001595-9940 | sheep | Merino (Sheep) | Brachygnathia, cardiomegaly and renal hypoplasia syndrome | OBSL1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.236304072del | XM_027965226.1:c.1716del | XP_027821027.1:p.(V573Wfs*119) | XM_027965226.1:c.1716delC | 2020 | 32933480 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC | ||
| 1141 | OMIA:002227-9940 | sheep | Istrska pramenka (Sheep) | Otocephaly | OTX2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.71478714G>A | XM_015097088.2:c.265C>T | XP_014952574.2:p.(R89*) | Paris et al. (2020): XM_015097088.2:c.265C > T | 2020 | 31969185 | |||
| 1461 | OMIA:002552-9940 | sheep | Pancreatic agenesis | PDX1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.33940517_33940724del | XM_027973895.1:c.195_403del | XM_027973895.1; 208bp deletion | 2017 | 29234093 | ||||||
| 232 | OMIA:000649-9940 | sheep | Texel (Sheep) | Microphthalmia | PITX3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 22 | NC_040273.1:g.25497953C>G | NM_001178053.1:c.338G>C | NP_001171524.1:p.(R113P) | Oar_v3.1 position is g.22045744C>G | 2010 | 20084168 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1267 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230750869G>A | XM_027968104.1:c.1186C>T | XP_027823905.1:p.(Q396*) | Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. | 2021 | 33159255 | |||
| 1266 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230766713T>C | XM_004006987.4:c.336-2A>G | XP_012031020.2:p.(L71Wfs*3) | 2021 | 33159255 | ||||
| 1353 | OMIA:001504-9940 | sheep | Neuronal ceroid lipofuscinosis, 1 | PPT1 | delins, small (<=20) | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.15235231_15235231delinsTTA | XP_004001885.2:p.(R151*) | 2019 | 31289301 | ||||||
| 1553 | OMIA:002693-9940 | sheep | Cheviot (Sheep) | Achondroplasia, PRICKLE1-related | PRICKLE1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | 3 | 10 bp deletion in the open reading frame | 2016 | Reference not in PubMed; see OMIA 002693-9940 for reference details | ||||||||
| 823 | OMIA:000944-9940 | sheep | Ile-De-France (Sheep) Romanov (Sheep) | Resistance to scrapie | PRNP | V | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675389C>T | c.407C>T | p.(A136V) | Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs591379086 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 825 | OMIA:000944-9940 | sheep | Resistance to scrapie, Nor98 type | PRNP | F | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675403C>T | c.421C>T | p.(L141F) | Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs598580733 | 2005 | 15604451 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 824 | OMIA:000944-9940 | sheep | Ile-De-France (Sheep) Romanov (Sheep) | Resistance to scrapie | PRNP | H | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675443G>A | c.461G>A | p.(R154H) | Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively | rs605048948 | 1993 | 8094373 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 822 | OMIA:000944-9940 | sheep | Suffolk (Sheep) | Resistance to scrapie | PRNP | Q | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 13 | g.48675494G>A | c.512G>A | p.(R171Q) | Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively | rs160575103 | 1990 | 1969635 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 388 | OMIA:001139-9940 | sheep | Merino (Sheep) | Glycogen storage disease V | PYGM | substitution | splicing | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.44787090C>T | NM_001009192.2:c.2380-1G>A | a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 | rs402505013 | 1997 | 9267848 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1663 | OMIA:001867-9940 | sheep | Poll Dorset (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_Rambouillet_v1.0 | 4 | NC_040255.1:g.50288685C>T | NM_001306121.1:c.7088G>A | NP_001293050.1:p.(R2363H) | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | 39394905 | |||
| 673 | OMIA:001867-9940 | sheep | Spanish Churro (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.50313243_50313273del | NM_001306121.1:c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 926 | OMIA:000483-9940 | sheep | Polled | RXFP2 | insertion, gross (>20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 10 | "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" | 2015 | 26103004 | ||||||||
| 506 | OMIA:001400-9940 | sheep | Texel (Sheep) | Chondrodysplasia, Texel | SLC13A1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.95624809del | XM_004008022.4:c.334del | Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 | 2012 | 22742499 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation. | ||||
| 1707 | OMIA:002862-9940 | sheep | Manech Tête Rousse, France (Sheep) | Haplotype with homozygous deficiency, SLC33A1-related | SLC33A1 | MTRDHH2 | duplication | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.252649023dupG | XM_012100950.3:c.735dupG | XP_011956340.1:p.(R246Afs*3) | 2024 | 38922751 | |||
| 1761 | OMIA:001821-9940 | sheep | Suffolk (Sheep) | Suffolk white fleece | SLC45A2 | deletion, small (<=20) | deletion (in-frame) | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v3.0 | 16 | NC_056069.1:g39966131_39966133del | XM_004017064.5:c.661_663del | XP_004017113.5:p.(F221del) | 2025 | 39608806 | ||||
| 1608 | OMIA:002755-9940 | sheep | South Down (Sheep) | Congenital photosensitivity and hyperbilirubinaemia | SLCO1B3 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_v3.1 | 3 | NC_019460.1:g.193691915C>T | XM_012175224.1:c.1318G>A | XP_012030614.1:p.(G440R) | XM_012175224.1; XP_012030614.1 | 2018 | 29688779 | |||
| 1420 | OMIA:001744-9940 | sheep | Elevated milk leukocytes count | SOCS2 | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 3 | g.139302270C>T | c.286C>T | p.(R96C) | Oar_v3.1 position g.129722200C>T, transcripts XM_027967202.1, ENSOART00020018904.1:c.286C>T ENSOARP00020015648.1:p.Arg96Cys | rs868996547 | 2015 | 26658352 | |||||
| 1578 | OMIA:000975-9940 | sheep | Tail, short | TBXT | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 8 | NC_040259.1:g.95879358C>A | XM_027972732.1:c.334G>T | XP_027828533.1:p.G112W | The gene is also called TBXT | 2018 | 35948368 29208649 | ||||
| 1595 | OMIA:002370-9940 | sheep | North Country Cheviot (Sheep) | Motor neuron disease, TMCO6-related | TMCO6 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | ARS-UI_Ramb_v2.0 | 5 | NC_056058.1:g.49438388_49438391del | XM_012178620.3:c.645_648del | XP_012034010.1:p.(L215Ffs*34) | XP_012034010.1 | 2023 | 37488055 | |||
| 1042 | OMIA:002176-9940 | sheep | Coopworth (Sheep) Perendale (Sheep) | Meckel-like hepatorenal fibrocystic dysplasia syndrome | TMEM67 | haplotype | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 9 | NC_040260.1:g.[91651651A>C;91651669A>T] | XM_012184130.2:c.[2042T>A;2060T>G] | XP_012039520.2:p.[(I681N);(I687S)] | Published as c.[2050T>A; 2068T>G] | rs1086155906; rs1088172192 | 2017 | 28487520 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1238 | OMIA:002285-9940 | sheep | Merino (Sheep) | Ovine congenital progressive muscular dystrophy | TNNT1 | deletion, small (<=20) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 14 | NC_040265.1:g.66970247del | XM_027978800.1:c.746+1del | Published as "KT218690 c.614 + 1delG" (Clayton et al., 2020); Oar3.1 chr14: g.59556001delG and Oar4.0 chr14: g.59437065delG (Josh Clayton, pers comm., 7 Sep 2020) | 2020 | 32819427 | |||||
| 227 | OMIA:001249-9940 | sheep | Brown | TYRP1 | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | c.2240C>G | p.(A???V) | 2013 | 23451726 | ||||||
| 1127 | OMIA:001249-9940 | sheep | Valais Red (Sheep) | Brown | TYRP1 | b^VS1 | deletion, small (<=20) | frameshift | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87540706_87540707del | NM_001130023.1:c.86_87del | NP_001123495.1:p.(E29Vfs*5) | NM_001130023.1: c.86_87delGA; NP_001123495.1: p.(Glu29ValfsTer5) | 2019 | 31571241 | 210906 to conform to HGVS notation, FN removed GA from g.87540706_87540707delGA and c.86_87delGA | |
| 226 | OMIA:001249-9940 | sheep | Soay (Sheep) | Tawny (light brown) | TYRP1 | b^Soay | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87545636G>T | NM_001130023.1:c.869G>T | NP_001123495.1:p.(C290F) | rs402624085 | 2007 | 17254985 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1128 | OMIA:001249-9940 | sheep | Valais Red (Sheep) | Brown | TYRP1 | b^VS2 | substitution | nonsense (stop-gain) | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.87549195C>T | NM_001130023.1:c.1066C>T | NP_001123495.1:p.(R356*) | NM_001130023.1: c.1066C>T; NP_001123495.1: p.(Arg356*) | rs1085637427 | 2019 | 31571241 | |
| 906 | OMIA:001176-9940 | sheep | Scottish Blackface (Sheep) | Porphyria cutanea tarda | UROD | substitution | missense | Naturally occurring variant | Not currently evaluated | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.20327971T>C | NM_001012341.1:c.392T>C | NP_001012341.1:p.(L131P) | Oar_v3.1 position is g.19437840T>C; protein and cDNA positions are based on NP_001012341.1 and NM_001012341.1, respectively | rs429214636 | 2005 | 16026339 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. |
* Variant pathogenicity for single-gene diseases as evaluated according to the Animal Variant Classification Guidelines (AVCG) by the Variant Pathogenicity Working Group of the International Society of Animal Genetics (ISAG) Animal Genetic Testing Standardization (AGTS) Standing Committee: P = pathogenic, LP = likely pathogenic, VUS = variant of unknown significance, LB = likely benign, B = benign. For more information (including details on the classification of each variant) see LINKS.
| Overall Statistics | |
|---|---|
| Total number of variants | 105 |
| Variants with genomic location | 103 (98.1% ) |
| Variants in a variant database, i.e. with rs ID | 30 (28.6%) |
| Variant Type | Count | Percent |
|---|---|---|
| complex rearrangement | 1 | 1.0% |
| deletion, gross (>20) | 4 | 3.8% |
| deletion, small (<=20) | 17 | 16.2% |
| delins, small (<=20) | 2 | 1.9% |
| duplication | 3 | 2.9% |
| haplotype | 1 | 1.0% |
| insertion, gross (>20) | 5 | 4.8% |
| substitution | 65 | 61.9% |
| unknown | 7 | 6.7% |
| Variant Effect | Count | Percent |
|---|---|---|
| deletion (in-frame) | 2 | 1.9% |
| frameshift | 12 | 11.4% |
| missense | 39 | 37.1% |
| nonsense (stop-gain) | 18 | 17.1% |
| regulatory | 6 | 5.7% |
| splicing | 6 | 5.7% |
| unknown | 22 | 21.0% |
| Year First Reported | Count | Percent |
|---|---|---|
| 1990 | 1 | 1.0% |
| 1991 | 0 | 0.0% |
| 1992 | 0 | 0.0% |
| 1993 | 2 | 1.9% |
| 1994 | 0 | 0.0% |
| 1995 | 0 | 0.0% |
| 1996 | 0 | 0.0% |
| 1997 | 1 | 1.0% |
| 1998 | 0 | 0.0% |
| 1999 | 2 | 1.9% |
| 2000 | 3 | 2.9% |
| 2001 | 1 | 1.0% |
| 2002 | 2 | 1.9% |
| 2003 | 1 | 1.0% |
| 2004 | 3 | 2.9% |
| 2005 | 2 | 1.9% |
| 2006 | 3 | 2.9% |
| 2007 | 2 | 1.9% |
| 2008 | 4 | 3.8% |
| 2009 | 1 | 1.0% |
| 2010 | 6 | 5.7% |
| 2011 | 3 | 2.9% |
| 2012 | 5 | 4.8% |
| 2013 | 9 | 8.6% |
| 2014 | 1 | 1.0% |
| 2015 | 5 | 4.8% |
| 2016 | 1 | 1.0% |
| 2017 | 7 | 6.7% |
| 2018 | 3 | 2.9% |
| 2019 | 4 | 3.8% |
| 2020 | 9 | 8.6% |
| 2021 | 8 | 7.6% |
| 2022 | 1 | 1.0% |
| 2023 | 1 | 1.0% |
| 2024 | 9 | 8.6% |
| 2025 | 5 | 4.8% |