Search Results

Advanced search

Link to this search:

1148 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.

OMIA Variant ID OMIA Phene-Species ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Type of Variant Source of Genetic Variant Deleterious? Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Year Published PubMed ID(s) Acknowledgements
2 OMIA:000042-9031 chicken Wisconsin hypoalpha mutant (WHAM), United States of America (Chicken) Analphalipoproteinaemia ABCA1 missense Naturally occurring variant yes GRCg6a Z g.54877918C>T c.265G>A p.(E89K) 2002 12364545 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1126 OMIA:002238-9913 taurine cattle Shorthorn (Cattle) Ichthyosis, ABCA12-related ABCA12 missense Naturally occurring variant yes ARS-UCD1.2 2 g.103016791A>G c.6776T>C p.(L2259P) NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) 2019 31568573
195 OMIA:002238-9913 taurine cattle Chianina (Cattle) Ichthyosis, ABCA12-related ABCA12 missense Naturally occurring variant yes ARS-UCD1.2 2 g.103025585T>C c.5804A>G p.(H1935R) 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1220 OMIA:002238-9913 taurine cattle Polled Hereford (Cattle) Ichthyosis, ABCA12-related ABCA12 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 2 g.103043495_103043496insG c.5689_5690insC p.(S1784Ifs*33) BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) rs3423092881 2020 32567073
1379 OMIA:002238-9823 pig Bama Xiang Zhu, China (Pig) Ichthyosis ABCA12 splicing Chemical mutagenesis (ENU) unknown Sscrofa11.1 15 g.117250799T>C Intronic mutation IVS49-727 A>G results in splicing alteration resulting in a 132-nt insertion and a premature stop codon (Wang et al., 2019) 2019 30925591
1050 OMIA:002179-9615 dog Labrador Retriever (Dog) Stargardt disease 1 ABCA4 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 6 g.55146556dup c.4176dup p.(F1393Lfs*3) Mäkeläinen et al. (2019): "ENSCAFT00000005367 exon28 4170dupC* V1390fs" Importantly, the same authors also explain in Table S3 that "*The insertion is found in a cytosine mononucleotide-repeat region [55,146,550–55,146,556] and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4176insC, p.F1393Lfs*1395)." Variant information changed to reflect HGVS nomenclature 2019 30889179
607 OMIA:001402-9615 dog Border Collie (Dog) Adverse reaction to certain drugs ABCB1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 14 CanFam3.1 published as c.73insAAT - allele is reflected by the reference sequence CanFam3.1 and NM_001003215.2 as reference: g.13737172_13737174; c.73_75, p.N25 2010 21113104
469 OMIA:001402-9615 dog Australian Shepherd (Dog) Border Collie (Dog) Collie (Dog) German Shepherd Dog (Dog) Long-Haired Whippet (Dog) Miniature Australian Shepherd Dog (Dog) Old English Sheepdog (Dog) Shetland Sheepdog (Dog) Silken Windhound (Dog) Waller (Dog) White Swiss Shepherd Dog (Dog) Adverse reaction to certain drugs ABCB1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 14 g.13726596_13726599del c.228_231del p.(D77Afs*16) NM_001003215.2; NP_001003215.2 2001 11692082 Variant information gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005
442 OMIA:001402-9615 dog Border Collie (Dog) Adverse reaction to certain drugs ABCB1 regulatory Naturally occurring variant no CanFam3.1 14 g.13742402A>C published as Canfam2 chr14:16692274T>G, c.-6-180T>G, possible regulatory variant associated with resistance to phenobarbital treatment in epileptic Border Collies rs852787132 2011 21488961 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
1322 OMIA:001402-9685 domestic cat Domestic Longhair Domestic medium-haired Domestic Shorthair Ragdoll (Cat) Russian Blue (Cat) Siamese (Cat) Adverse reaction to certain drugs ABCB1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A2 g.93144355_93144356del c.1930_1931del NM_001171064.2; published as ABCB1:1930_1931delTC; resuling in a frameshift generating a series of stop codons immediately downstream from the deletion. The protein product is predicted to be severely truncated (~50%) and non functional (Mealey and Burke, 2015). The original paper does not identify breed but the variant was later reported in heterozyous form in several breeds: PMID:34125616. 2015 25660379 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1574 OMIA:002710-9615 dog Manchester Terrier (Dog) Cardiomyopathy, dilated, ABCC9-related ABCC9 SCDY/DCM missense Naturally occurring variant unknown Dog10K_Boxer_Tasha 27 g.21042635C>T c.3557G>A p.(R1186Q) XM_022410972.2; XP_022266680.2 2023 37239348
1477 OMIA:002561-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Infertility ABHD16B nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 13 g.53957903G>A c.652C>T p.(Q218*) ENSBTAT00000045249.4; ENSBTAP00000055253.1 rs468948776 2020 31963602
1388 OMIA:002368-9615 dog Golden Retriever (Dog) Ichthyosis, ABHD5-related ABHD5 ICH2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 23 g.2587000_2587013del c.1006_1019del p.(D336Sfs*6) XM_542689.5; XP_542689.2 2022 34791225
1497 OMIA:002585-9615 dog Cavalier King Charles Spaniel (Dog) medium-chain acyl-CoA dehydrogenase ACADM delins, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 6 g.71401388_71401389delinsCATAATTCTTAGACAATATTGAGAATTAAC c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG p.(T150Ifs*6) XM_038541645.1; XP_038397573.1 2022 36292732
972 OMIA:002140-9615 dog German Hunting Terrier (Dog) Exercise induced metabolic myopathy ACADVL nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 5 g.32193689C>A c.1728C>A p.(Y576*) XM_546581.5; XP_546581.3 2018 29491033
429 OMIA:001271-9913 taurine cattle Dexter (Cattle) Bulldog calf ACAN BD2 regulatory Naturally occurring variant yes ARS-UCD1.2 21 g.20377856C>T c.-198C>T 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
590 OMIA:001271-9913 taurine cattle Dexter (Cattle) Highland (Cattle) Bulldog calf ACAN BD1 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 21 g.20422104_20422105insGGCA c.2266_2267insGGCA Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1060 OMIA:001271-9915 indicine cattle (zebu) Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) Bulldog calf ACAN insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 21 g.20428539_20428540insC c.5688_5689insC p.(V1897fs*9) cDNA position based on transcript NM_173981.2 2018 30305023
1001 OMIA:001271-9796 horse Miniature Horse (Horse) Dwarfism, ACAN-related ACAN D4 deletion, small (<=20) Naturally occurring variant yes EquCab3.0 1 g.95257480_95257500del c.7633_7653del p.(F2545_D2551del) 220110: corrected genomic position from g.95257458_95257500del to 95257480_95257500 and updated cDNA and published protein coordinates (p.(F2017_D2023del)) based on the following transcripts: ENSECAT00000040213.1:c.7633_7653del ENSECAP00000032890.1:p.Phe2545_Cys2551del rs1095048839 2018 30058072
788 OMIA:001271-9796 horse Miniature Horse (Horse) Shetland Pony (Horse) Dwarfism, ACAN-related ACAN D3* missense Naturally occurring variant yes EquCab3.0 1 g.95282140C>G c.1513G>C p.(A505P) ENSECAT00000040213.1:c.1513G>C ENSECAP00000032890.1:p.Ala505Pro This variant was named D3* by Eberth et al. (2018) rs1095048823 2017 27942904 Variant coordinates obtained from Eberth et al. (2018) and EVA_ID link
1000 OMIA:001271-9796 horse Miniature Horse (Horse) Dwarfism, ACAN-related ACAN D2 missense Naturally occurring variant yes EquCab3.0 1 g.95284530C>T c.1270C>T p.(V424M) rs3091781465 2018 30058072
999 OMIA:001271-9796 horse Miniature Horse (Horse) Dwarfism, ACAN-related ACAN D1 deletion, small (<=20) Naturally occurring variant yes EquCab3.0 1 g.95291271del c.245del p.(K82Rfs*54) 220110: changed g.95291270del to g.95291271del based on HGVS 3'rule. ENSECAT00000040213.1:c.245del ENSECAP00000032890.1:p.Lys82ArgfsTer54 rs1095048841 2018 30058072
323 OMIA:000702-9031 chicken Nanomelia ACAN nonsense (stop-gain) Naturally occurring variant yes GRCg6a 10 g.13502829C>A c.4537G>T p.(E1513*) 1994 7827752 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1045 OMIA:002177-9615 dog Akita (Dog) American Akita (Dog) Amelogenesis imperfecta, ACP4-related ACPT insertion, small (<=20) Naturally occurring variant yes CanFam3.1 1 g.106051997dupC c.1189dupG p.(A397Gfs) XM_541473.2; XP_541473.2; ACPT is a synonym of ACP4 2019 30877375
1419 OMIA:002226-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH34 ACSL5 BH34 missense Naturally occurring variant yes ARS-UCD1.2 26 g.32940521C>G c.528C>G p.(N176K) NM_001075650.1 2021 34915862
1259 OMIA:002226-9615 dog Australian Kelpie (Dog) Intestinal lipid malabsorption ACSL5 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 28 g.23380074_23483377del NC_006610.3CFA28:g.23380074_23483377del (O/Brien et al., 2020) 2020 33106515
1073 OMIA:000388-9685 domestic cat Domestic Shorthair Fibrodysplasia ossificans progressiva ACVR1 missense Naturally occurring variant yes Felis_catus_9.0 C1 g.150014354C>T c.617G>A p.(R206H) XM_023259334.1; XP_023115102.1 2019 31007133 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
633 OMIA:001520-9615 dog Glen of Imaal Terrier (Dog) Cone-rod dystrophy 3 ADAM9 deletion, gross (>20) Naturally occurring variant yes 16 "a deletion of exons 15 and 16 which alters the reading frame leading to a premature stop codon" in the ADAM9 gene 2010 20691256
43 OMIA:001870-9615 dog Beagle (Dog) Glaucoma, primary open angle ADAMTS10 missense Naturally occurring variant yes CanFam3.1 20 g.53096339C>T c.1981G>A p.(G661R) XM_849227.3; XP_854320.1 2011 21379321
101 OMIA:001870-9615 dog Norwegian Elkhound (Dog) Glaucoma, primary open angle ADAMTS10 missense Naturally occurring variant yes CanFam3.1 20 g.53101896C>T c.1159G>A p.(A387T) XM_849227.3; XP_854320.1 2014 25372548 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
685 OMIA:001976-9615 dog Basset Hound (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.40614853_40614872del c.194_213del p.(L68Gfs*) XM_022416850.1; XP_022272558.1 2015 26474315
365 OMIA:000588-9615 dog American Toy Terrier (Dog) Chinese Crested (Dog) German Hunting Terrier (Dog) Jack Russell Terrier (Dog) Lancashire Heeler (Dog) Miniature Bull Terrier (Dog) Parson Russell Terrier (Dog) Patterdale Terrier (Dog) Rat Terrier (Dog) Sealyham Terrier (Dog) Tenterfield Terrier (Dog) Tibetan Terrier (Dog) Toy Fox Terrier (Dog) Volpino Italiano (Dog) Welsh Terrier (Dog) Wire Fox Terrier (Dog) Yorkshire Terrier (Dog) Lens luxation ADAMTS17 splicing Naturally occurring variant yes CanFam3.1 3 g.40782144G>A c.1473+1G>A XM_022416850.1; additional breeds reported by PMID:22050825 and PMID:37582787 rs1152388408 2010 20375329 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
96 OMIA:001976-9615 dog Basset Fauve de Bretagne (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 missense Naturally occurring variant yes CanFam3.1 3 g.40808345G>A c.1552G>A p.(G518S) XM_022416851.1; XP_022272559.1 2015 26474315 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1086 OMIA:001976-9615 dog Petit Basset Griffon Vendeen (Dog) Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 inversion Naturally occurring variant yes CanFam3.1 3 g.40812274_45768123inv c.1721+2668_*4831255inv XM_545825.4; Forman et al. (2015): "a 4.96 Mb inversion . . . with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123) [Canfam3.1]… Analysis of RNAseq data revealed novel exon expression for ADAMTS17 due to cryptic splicing occurring 3’ of the exons located immediately upstream of the inversion event." 2015 26683476
942 OMIA:000588-9615 OMIA:001976-9615 dog Chinese Shar-Pei (Dog) Primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both ADAMTS17 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.40935387_40935392del c.3069_3074del p.(V1024_V1025del) XM_014112382.2; XP_013967857.1; published as c.3070_3075delCGTGGT; p.(V1025_V1026del) 2018 29287154
486 OMIA:000328-9913 taurine cattle Belgian Blue (Cattle) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 7 g.2017035_2017051delinsAGC c.464_480delinsAGC 1999 10417273 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1513 OMIA:000328-9615 dog Alapaha Blue Blood Bulldog (Dog) obsolete Pit Bull Terrier (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 11 g.2280117delC c.10delC p.(P4Rfs*175) 2022 36421833
1117 OMIA:000328-9615 dog Doberman Pinscher (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 11 g.2408978C>T c.769C>T p.(R257*) 2019 31294848
1514 OMIA:000328-9615 dog Catahoula Leopard Dog (Dog) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 missense Genome-editing (CRISPR-Cas9) yes CanFam3.1 11 g.2491238G>A c.2897G>A p.(R966H) 2022 36421833
1589 OMIA:000328-9685 domestic cat Domestic Shorthair Ehlers-Danlos syndrome ADAMTS2 delins, small (<=20) Naturally occurring variant yes F.catus_Fca126_mat1.0 A1 g.90995621dup c.698dup p.(Ser235fs*3) XM_023254116.2; XP_023109884.2 2023 37462293
318 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.1938399G>T c.424G>T p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
857 OMIA:000328-9940 sheep Dorper (Sheep) Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 5 g.2088231G>A c.805G>A p.(V269M) XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
537 OMIA:001140-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cleft lip with or without cleft palate ADAMTS20 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 27 g.10553479_10553480del c.1358_1359del p.(K453Ifs*4) XM_022410988.1; XP_022266696.1; published as c.1360_1361delAA and p.(K453Ifs*3); coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature 2015 25798845 Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn.
1163 OMIA:001562-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Pulmonary hypoplasia and anasarca syndrome ADAMTS3 missense Naturally occurring variant yes ARS-UCD1.2 6 g.87462016G>A c.1222C>T p.(H408T) NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) 2020 32069517
60 OMIA:001509-9615 dog Beagle (Dog) Musladin-Lueke syndrome ADAMTSL2 missense Naturally occurring variant yes CanFam3.1 9 g.49931561C>T c.661C>T p.(R221C) 2010 20862248 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
935 OMIA:001511-9913 taurine cattle Angus (Cattle) Contractual arachnodactyly (Fawn calf syndrome) ADAMTSL3 deletion, gross (>20) Naturally occurring variant yes 21 "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" 2014 Reference not in PubMed; see OMIA 001511-9913 for reference details
1435 OMIA:002535-9913 taurine cattle Original Schweizer Braunvieh, Switzerland (Cattle) Congenital cataract ADAMTSL4 missense Naturally occurring variant yes ARS-UCD1.2 3 g.20146737C>T c.2327G>A p.(R776H) NM_001101061.1; NP_001094531.1 2022 35233794
466 OMIA:001577-9615 dog Curly Coated Retriever (Dog) Glycogen storage disease IIIa AGL deletion, small (<=20) Naturally occurring variant yes CanFam3.1 6 g.50050457del c.4223del p.(K1408Sfs*6) NM_001048096.1; NP_001041561.1; published as c.4223delA; genomic position adjusted to HGVS 3' rule 2007 17338148 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
934 OMIA:002135-9913 taurine cattle Angus (Cattle) Arthrogryposis multiplex congenita, AGRN-related AGRN deletion, gross (>20) Naturally occurring variant yes 16 A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) 2011 Reference not in PubMed; see OMIA 002135-9913 for reference details
233 OMIA:000662-9940 sheep Romney Marsh (Sheep) Motor neuron disease, lower AGTPBP1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.35795594G>C c.2909G>C p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
75 OMIA:001672-9615 dog Coton de Tulear (Dog) Primary hyperoxaluria type I (Oxalosis I) AGXT missense Naturally occurring variant yes CanFam3.1 25 g.50968854G>A c.304G>A p.(G102S) XP_003639939.1:p.Gly102Ser rs397510072 2012 22486513 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1252 OMIA:001672-9940 sheep Zwartbles (Sheep) Type 1 Primary Hyperoxaluria AGXT missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.801189C>T c.584G>A p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
1214 OMIA:001222-9685 domestic cat Persian (Cat) Leber congenital amaurosis AIPL1 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 E1 g.940445C>T c.577C>T p.(R193*) XM_023243858.1:c.577C>T 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
1629 OMIA:002788-9913 taurine cattle Holstein Friesian (Cattle) Subfertility, AK9-related AK9 splicing Naturally occurring variant yes ARS-UCD1.2 9 g.40620329A>G rs457222030 2021 34028060
1094 OMIA:002205-9615 dog Collie Rough (Dog) Recurrent inflammatory pulmonary disease AKNA deletion, small (<=20) Naturally occurring variant yes CanFam3.1 11 g.68576241_68576244del c.2717_2720delACAG p.(D906Afs*173) XM_014117950.2: c.2717_2720delACAG; XP_013973425.1:p.(Asp906Alafs*173) 2019 31357536
1240 OMIA:002250-9615 dog Saluki (Dog) Succinic Semialdehyde Dehydrogenase Deficiency ALDH5A1 missense Naturally occurring variant yes CanFam3.1 35 g.22572768G>A c.866G>A p.(G288D) XM_014110599.2: c.866G>A; XP_013966074.2: p.(Gly288Asp) (Vernau et al., 2020) 2020 32887425
1292 OMIA:002316-9685 domestic cat American Shorthair (Cat) Exotic Shorthair (Cat) Munchkin (Cat) Scottish Fold (Cat) Sphynx (Cat) Cardiomyopathy, hypertrophic ALMS1 missense Naturally occurring variant unknown Felis_catus_9.0 A3 g.92439157G>C c.7384G>C p.(G2462R) cDNA and protein positions have been predicted using Ensemble VEP based on transcript ENSFCAT00000077013.1; variant initially reported in Sphynx cats and in a later study (Akiyama et al., 2023) identified in other breeds. Turba et al., 2023 report additional variants in the vicinity that can result in allele dropout in DNA tests and indicate "the need to verify the correspondence between the g.92439157 C variant frequency and the prevalence of HCM" due to high allele frequency of the variant in Sphynx cats in their study. 2021 33639992
1021 OMIA:002162-9615 dog Karelian Bear Dog (Dog) Hypophosphatasia ALPL missense Naturally occurring variant yes CanFam3.1 2 g.77561953A>C c.1301T>G p.(V434G) XM_005617214.3; XP_005617271.1 2019 30700765
1486 OMIA:002162-9940 sheep Hypophosphatasia ALPL missense Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 2 g.260716094G>C c.1077C>G p.(I359M) XM_027965561.1; XP_027821362.1 2018 30446691
550 OMIA:002717-9685 domestic cat Burmese (Cat) Brachycephaly ALX1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B4 g.110088245_110088256del c.497_508del p.(A166_T169del) XM_003989090.4; XP_003989139.1; published as c.496delCTCTCAGGACTG 2016 26610632 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
764 OMIA:001009-9913 taurine cattle Shorthorn (Cattle) Tibial hemimelia ALX4 deletion, gross (>20) Naturally occurring variant yes 15 Deletion of 45,694 bp including exon 1 of ALX4 2012 Reference not in PubMed; see OMIA 001009-9913 for reference details
763 OMIA:001009-9913 taurine cattle Galloway (Cattle) Tibial hemimelia ALX4 ALX4dup-GAU duplication Naturally occurring variant yes ARS-UCD1.2 15 g.74384916_74384935dup UMD3.1 position is g.75154399_75154418dup. Duplication of 20bp in exon 2 is predicted to result in a frameshift leading to a premature stop codon and truncated protein. 2015 26076463 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022).
1516 OMIA:001009-9913 taurine cattle Galloway (Cattle) Tibial hemimelia ALX4 ALX4dup-LfL duplication Naturally occurring variant yes ARS-UCD1.2 15 g.74384938_74384919dup Buitkamp et al. (2022): "The ALX4dup-LfL duplication results in a frameshift (amino acid position 151) leading to a truncated protein of 248 nt in length, compared with 303 nt of the wild-type protein (XP_027418402.1)". 2023 36585373
280 OMIA:002775-9615 dog Miniature Schnauzer (Dog) Persistent Mullerian duct syndrome AMHR2 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 27 g.1794738G>A c.262C>T p.(R88*) XM_543632.6; XP_543632.4; published as c.241C>T; coordinates in the table have been updated to a recent reference genome and / or transcript 2009 18723470
639 OMIA:000565-9615 dog Giant Schnauzer (Dog) Intestinal cobalamin malabsorption, AMN-related AMN deletion, gross (>20) Naturally occurring variant yes CanFam3.1 8 g.70807271_70807303del c.1113_1145del p.(G372_A382del) NM_001002960.1; NP_001002960.1 2005 15845892 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
426 OMIA:000565-9615 dog Australian Shepherd (Dog) Intestinal cobalamin malabsorption, AMN-related AMN start-lost Naturally occurring variant yes ROS_Cfam_1.0 8 g.71077084G>A c.3G>A p.(M1?) NM_001002960.1; NP_001002960.1 2005 15845892
1677 OMIA:002838-9615 dog Cirneco dell'Etna (Dog) Cirneco oculo-neurological syndrome AMPD2 CONS deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 6 g.42698170del c.2131del p.(D711Mfs12*)  XM_038541065.1; XP_038396993.1; NC_049227.1 2024 38397227
353 OMIA:002539-9615 dog Dalmatian (Dog) Respiratory distress syndrome ANLN nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 14 g.47812143C>T c.31C>T p.(R11*) 2017 28222102 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
422 OMIA:001353-9615 dog German Shepherd Dog (Dog) Platelet receptor for factor X, deficiency of ANO6 splicing Naturally occurring variant yes CanFam3.1 27 g.8912219C>T c.1934+1G>A XM_005636953.1 2015 26414452 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
927 OMIA:002083-9913 taurine cattle Japanese Black, Japan (Cattle) Abortion (embryonic lethality), ANXA10-related ANXA10 repeat variation Naturally occurring variant yes 8 "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." 2016 27881083
580 OMIA:000248-9615 dog Collie (Dog) Neutropenia, cyclic AP3B1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.28663129_28663130insA c.2407_2408insA p.(T803Nfs*5) NM_001002974.2; NP_001002974.1; a single base pair (A) insertion in exon 20 of the AP3 beta gene (AP3B1) 2003 12897784
286 OMIA:000001-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein (black and white) (Cattle) Abortion due to a nonsense mutation in APAF1 on haplotype HH1 APAF1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 5 g.62810245C>T c.1741C>T p.(Q581*) Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. rs448942533 2016 27289157 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1206 OMIA:001916-9615 dog Jack Russell Terrier (Dog) Familial Adenomatous Polyposis APC delins, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.312131_312132delinsAA c.[462_463delinsTT] p.(K155X) XM_014111995.2; XP_013967470.1 2020 32445578 Reference assembly and genomic location kindly provided by Kyoko Yoshizaki, 17 Dec 2020
731 OMIA:001965-9913 taurine cattle Holstein (black and white) (Cattle) Holstein cholesterol deficiency APOB insertion, gross (>20) Naturally occurring variant yes 11 "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" 2016 26763170
436 OMIA:000991-9796 horse Quarter Horse (Horse) Androgen insensitivity syndrome (AIS) AR regulatory Naturally occurring variant yes EquCab3.0 X NC_009175.3:g.52728703A>G NM_001163891.1:c.1A>G  mutation in start codon for  NP_001157363.1; 2012 22095250 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022
1143 OMIA:000991-9796 horse Tennessee Walking Horse (Horse) Androgen insensitivity syndrome (AIS) AR deletion, small (<=20) Naturally occurring variant yes EquCab3.0 X NC_009175.3:g.52728885del NM_001163891.1:c.183del NP_001157363.1:p.(R63Gfs) published as c.183delT and p.(Ser61fs); c. and p. information in the table has been updated to HGVS nomenclature 2020 31936796 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022
783 OMIA:000991-9796 horse Androgen insensitivity syndrome AR deletion, gross (>20) Naturally occurring variant yes EquCab3.0 X NC_009175.3:g.52808634_52808658del NM_001163891.1:c.1630_1654del the deletion is predicted to create a frameshift: "resulting in altered amino acid composition from p.543Lys and a premature stop codon 44 amino acid residues downstream in exon 3 2017 28192783
786 OMIA:000991-9796 horse Thoroughbred (Horse) Androgen insensitivity syndrome AR missense Naturally occurring variant yes EquCab3.0 X NC_009175.3:g.52872393G>C NM_001163891.1:c.2042G>C NP_001157363.1:p.(W681S) 2016 27073903 The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022; p. coordinates obtained from Villagomez et al. (2019)
1144 OMIA:000991-9796 horse Thoroughbred (Horse) Androgen insensitivity syndrome (AIS) AR missense Naturally occurring variant yes EquCab3.0 X NC_009175.3:g.52878093C>T NM_001163891.1:c.2132C>T NP_001157363.1:p.(A711V) 2020 31936796
960 OMIA:001917-9615 dog Leonberger (Dog) Saint Bernard (Dog) Polyneuropathy, ARHGEF10-related ARHGEF10 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 16 g.54349199_54349208del c.1955_1958+6del XM_005630036.3; XP_005630093.1; published as c.1955_1958+6delCACGGTGAGC - eliminating the 3'-splice junction of exon 17 and creating an alternate splice site leading to a truncated protein 2014 25275565 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
780 OMIA:001334-9913 taurine cattle Swedish Red (Cattle) Sperm, short tail ARMC3 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 13 g.24024660del c.1442del p.(A451fs*26) rs797454424 2016 26923438 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
56 OMIA:000666-9615 dog Miniature Schnauzer (Dog) Mucopolysaccharidosis VI ARSB deletion, gross (>20) Naturally occurring variant yes CanFam3.1 3 g.27870127_27870182del c.-24_32del NM_001048133.1 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
640 OMIA:000666-9615 dog Poodle, Miniature (Dog) Mucopolysaccharidosis VI ARSB deletion, gross (>20) Naturally occurring variant yes CanFam3.1 3 g.27870253_27870274del c.103_124del p.(A35Gfs*108) NM_001048133.1; NP_001041598.1 2012 22329490 Variant information initially provided by Karthik Raj and Urs Giger
859 OMIA:000666-9615 dog Great Dane (Dog) Mucopolysaccharidosis VI ARSB nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 3 g.27870445C>T c.295C>T p.(Q99*) NM_001048133.1; NP_001041598.1 2018 29157190 Variant information initially provided by Karthik Raj and Urs Giger, and confirmed by Ensembl's VEP
1258 OMIA:000666-9615 dog Miniature Pinscher (Dog) Mucopolysaccharidosis VI ARSB missense Naturally occurring variant yes CanFam3.1 3 g.27950471G>A c.910G>A p.(G304R) NM_001048133.1; NP_001041598.1 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
1320 OMIA:000666-9685 domestic cat Siamese (Cat) Mucopolysaccharidosis VI, mild, in L476P/D520N cats ARSB missense Naturally occurring variant yes Felis_catus_9.0 A1 g.145138738C>T c.1558G>A p.(D520N) NM_001142259.1; NP_001135731.1; D520N/D520N and L476P/D520N cats have normal growth and appearance. L476P/D520N cats have a very mild MPS VI phenotype (increased incidence of degenerative joint disease). 1998 9421472 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
132 OMIA:000666-9685 domestic cat Domestic Shorthair Siamese (Cat) Mucopolysaccharidosis VI ARSB missense Naturally occurring variant yes Felis_catus_9.0 A1 g.145138869A>G c.1427T>C p.(L476P) NM_001142259.1; NP_001135731.1 1996 8910299 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
67 OMIA:001503-9615 dog American Staffordshire Terrier (Dog) Neuronal ceroid lipofuscinosis, 4A ARSG missense Naturally occurring variant yes CanFam3.1 9 g.15071276G>A c.296G>A p.(R99H) 2010 20679209 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1309 OMIA:002325-9685 domestic cat Encephalopathy, spongy ASPA missense Naturally occurring variant yes Felis_catus_9.0 E1 g.13585610C>G c.859G>C p.(A287P) XM_006939957.4; XP_006940019.1 2021 33779415
111 OMIA:002099-9615 dog German Shepherd Dog (Dog) Ichthyosis, ASPRV1-related ASPRV1 missense Naturally occurring variant yes CanFam3.1 10 g.68587027A>G c.1052T>C p.(L351P) XM_014117456.1; XP_013972931.1 2017 28249031 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1673 OMIA:002099-9615 dog Pembroke Welsh Corgi (Dog) Ichthyosis, non-epidermolytic ASPRV1 deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 10 NC_049231.1:g.69888722_69888723del XM_038551592.1:c.594_595del XP_038407520.1:p.(L199Rfs*342) 2024 38549226
289 OMIA:000194-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) Citrullinaemia ASS1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 11 g.100781668C>T c.256C>T p.(R86*) Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. 1989 2813370 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
65 OMIA:001471-9615 dog Poodle, Standard (Dog) Neonatal encephalopathy with seizures ATF2 missense Naturally occurring variant yes CanFam3.1 36 g.19078954A>C c.152T>G p.(M51R) 2008 18074159 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
94 OMIA:001954-9615 dog Lagotto Romagnolo (Dog) Neurodegenerative vacuolar storage disease ATG4D missense Naturally occurring variant yes CanFam3.1 20 g.50618958C>T c.1288G>A p.(A430T) 2015 25875846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1067 OMIA:001552-9615 dog Australian Cattle Dog (Dog) Neuronal ceroid lipofuscinosis, 12 ATP13A2 missense Naturally occurring variant yes CanFam3.1 2 g.81208162C>T c.1118C>T p.(T373I) XM_005617949.3; XP_005618006.1 2019 30956123
400 OMIA:001552-9615 dog Tibetan Terrier (Dog) Neuronal ceroid lipofuscinosis, 12 ATP13A2 splicing Naturally occurring variant yes CanFam3.1 2 g.81210367del c.1623del XM_005617949.3; XP_005618006.1; variant was published as c.1623delG p.P541fs*597 by Farias et al. (2011); Wöhlke et al. (2011) provided an alternate transcript position c.1620delG and proposed that the variant causes exon 16 skipping in NCL-affected Tibetan terriers. The sequence information provided by Wöhlke et al. (2011) corresponds to XM_005617949.3:c.1623del 2011 21362476 22022275
734 OMIA:002110-9615 dog Belgian Shepherd Dog (Dog) Ataxia, cerebellar, ATP1B2-related ATP1B2 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 5 g.32551064_32551065ins[LT796559.1:g.50_276] c.130_131ins[LT796559.1:g.50_276] XM_546597.5; "a 227 bp SINE insertion into exon 2 of the ATP1B2 gene" 2017 28620085
188 OMIA:001450-9913 OMIA:001464-9913 taurine cattle Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) Congenital muscular dystonia 1 ATP2A1 missense Naturally occurring variant yes ARS-UCD1.2 25 g.25933247G>A c.1675C>T p.(R559C) Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( 
219 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 missense Naturally occurring variant yes ARS-UCD1.2 25 g.25939141C>A c.857G>T p.(G286V) This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
218 OMIA:001464-9913 taurine cattle Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 missense Naturally occurring variant yes ARS-UCD1.2 25 g.25939366C>A c.632G>T p.(G211V) 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
205 OMIA:001464-9913 taurine cattle Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) Pseudomyotonia, congenital ATP2A1 missense Naturally occurring variant yes ARS-UCD1.2 25 g.25940510C>T c.491G>A p.(R164H) Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 2008 18786632 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1192 OMIA:002265-9615 dog Irish Terrier (Dog) Darier disease ATP2A2 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 26 g.8200944_8200945insN[(205)] c.2098-3_2098-2insN[(205)] p.(T700Vfs*6) NM_001003214.1; NP_001003214.1; Linek et al. (2020): "a heterozygous SINE insertion [~205bp] into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15", giving rise to NP_001003214.1:p.(Thr700Valfs*6) 2020 32354065
1533 OMIA:002265-9615 dog Shih Tzu (Dog) Darier disease ATP2A2 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 26 g.8434781A>C c.2425A>C p.(N809H) NM_001003214.1; NP_001003214.1 2023 36883421
1347 OMIA:001071-9685 domestic cat Wilson disease ATP7B missense Naturally occurring variant yes A1 p.(P550L) 2020 31687873
106 OMIA:001071-9615 dog Labrador Retriever (Dog) Wilson disease ATP7B missense Naturally occurring variant yes CanFam3.1 22 g.225112G>A c.4151G>A p.(R1384Q) XM_005633831.3; XP_005633888.1; variant published as c.4358G>A / p.(R1453Q) and the variant coordinates in this table have been changed to reflect recent transcript IDs; conflicting evidence in regard to causality of this variant are reported in the literature - see for details rs851958524 2016 26747866 30 Dec 2020: correct genomic location provided by Angelica K Kallenberg
1590 OMIA:001071-9685 domestic cat Domestic Longhair Wilson disease ATP7B missense Naturally occurring variant yes Felis_catus_9.0 A1 g.19609511T>A c.3670T>A p.(W1224R) XM_023251165.1; XP_023106933.1; variant heterozygous in a single affected cat 2023 37427085
1136 OMIA:001071-9685 domestic cat Wilson disease ATP7B missense Naturally occurring variant yes Felis_catus_9.0 A1 g.19611002C>G c.3890C>G p.(T1297R) XM_023251176.1; XM_023251176.1 2019 30561139 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1076 OMIA:001645-10036 golden hamster Black tremor Atrn insertion, gross (>20) Naturally occurring variant yes Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" 2002 11773967
348 OMIA:000487-9796 horse Belgian Draft (Horse) Friesian (Horse) Hydrocephalus B3GALNT2 nonsense (stop-gain) Naturally occurring variant yes EquCab3.0 1 g.76887901C>T c.1423C>T p.(Q475*) XM_001491545; XP_001491595; Ducro et al. (2015): "The nomenclature for the mutation is c.1423C>T [GenBank:XM_001491545] corresponding to p.Gln475* [GenBank:XP_001491595]". As at 25 April 2019, Ensembl's Variant Effect Predictor (VEP) gives the EquCab3 c. and p. coordinates as having not changed from the EquCab2 coordinates reported by Ducro et al. (2015). The Ensembl ref is ENSECAT00000049072 rs3429464524 2015 26452345 c. and p. variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. EquCab3 g. coordinate provided by Meredith O’Connell, working under the supervision of Professor Ernie Bailey, 24 April 2019
421 OMIA:002068-9796 horse Friesian (Horse) Dwarfism, Friesian B4GALT7 splicing Naturally occurring variant yes EquCab3.0 14 g.3772591C>T c.50G>A p.(R17K) 2016 27793082 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. FN thanks Elizabeth Huffman, who updated the g. coordinates to EquCab3, working under the supervision of Professor Ernie Bailey; 23 April 2020.
1391 OMIA:002484-9615 dog Shetland Sheepdog (Dog) Bardet-Biedl syndrome 2 BBS2 missense Naturally occurring variant yes CanFam3.1 2 g.59693737G>C c.1222G>C p.(A408P) ENSCAFT00000014523.5; ENSCAFP00000013435.4 2021 34828377
356 OMIA:002045-9615 dog Puli (Dog) Bardet-Biedl syndrome 4 BBS4 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 30 g.36063748A>T c.58A>T p.(K20*) 2017 28533336
1131 OMIA:002216-9544 Rhesus monkey Bardet-Biedl syndrome 7 BBS7 deletion, small (<=20) Naturally occurring variant yes Mmul_8.0.1 c.160delG p.(A54fs) 2019 31589838
1049 OMIA:002178-9823 pig Large White (Pig) Abortion, BBS9 and BMPER-related BBS9 deletion, gross (>20) Naturally occurring variant yes Sscrofa11.1 18 g.39817373_40029300del Derks et al. (2018): "a large deletion in complete LD with the SSC18 haplotype of approximately 212kb (position 39,817,373 to 40,029,300), spanning a part of the BBS9 gene ... [and reducing] expression of the downstream BMPER gene" 2018 30231021
635 OMIA:001592-9615 dog Cavalier King Charles Spaniel (Dog) Episodic falling BCAN deletion, gross (>20) Naturally occurring variant yes CanFam3.1 7 g.41325010_41340731delinsAAGGCC c.-13991_466+85delinsGGCCTT XM_005622698.1; a 15.7kb deletion in the BCAN gene removing the first 3 exons 2012 21821125
298 OMIA:000627-9913 taurine cattle Polled Hereford (Cattle) Maple syrup urine disease BCKDHA nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 18 g.50551011C>T c.148C>T p.(Q50*) cDNA position based on ENSBTAT00000021342.6 1990 2303405
200 OMIA:000627-9913 taurine cattle Shorthorn (Cattle) Maple syrup urine disease BCKDHA missense Naturally occurring variant yes ARS-UCD1.2 18 g.50560242C>T c.1380C>T p.(P372L) 1999 10425233 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1333 OMIA:001079-9940 sheep spælsau (Sheep) yellow fat BCO2 insertion, gross (>20) Naturally occurring variant yes 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
320 OMIA:001079-9940 sheep spælsau (Sheep) Yellow fat BCO2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 15 g.25024133C>T c.196C>T p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
737 OMIA:001554-9615 dog Finnish Lapphund (Dog) Lapponian Herder (Dog) Multifocal retinopathy 3 BEST1 cmr3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 18 g.54470590del c.1388del p.(P463Hfs) NM_001097545.1; NP_001091014.1; published as c.1388delC; variant initially identified in Lapponian Herder and later reported in additional breeds: PMID:27525650 rs397509969 2010 21197113 Variant information and allele abbreviation gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and genomic position in CanFam3.1 and EVA ID provided by Mateo Etcheveste and Robert Kuhn.
59 OMIA:001553-9615 dog Coton de Tulear (Dog) Multifocal retinopathy 2 BEST1 cmr2 missense Naturally occurring variant yes CanFam3.1 18 g.54476143C>T c.482G>A p.(G161D) NM_001097545.1; NP_001091014.1 2007 17460247 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
275 OMIA:001444-9615 dog Boerboel (Dog) Bull Mastiff (Dog) English Mastiff (Dog) Great Pyrenees (Dog) Multifocal retinopathy 1 BEST1 cmr1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 18 g.54478586G>A c.73C>T p.(R25*) NM_001097545.1; NP_001091014.1 2007 17460247 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
398 OMIA:001660-9615 dog Great Dane (Dog) Inherited myopathy of Great Danes BIN1 splicing Naturally occurring variant yes CanFam3.1 19 g.23522400A>G c.786-2A>G p.(R262_K263insASASRPFPQ) XM_014121413.2; XP_013976888.1; published as IVS10-2A>G, updated in this table to HGVS nomenclature 2013 23754947
1281 OMIA:002306-9823 pig German Landrace (Pig) Infertility and increased litter size BMP15 nonsense (stop-gain) Naturally occurring variant yes Sscrofa11.1 X g.44618787C>T p.(R212*) "NP_001005155.2:p.R212X" (Flossmann et al., 2021) 2021 33413103
1254 OMIA:000576-9823 pig Yorkshire (Pig) Knobbed acrosome defect BOLL deletion, gross (>20) Naturally occurring variant yes Sscrofa11.1 15 g.101549770_101604750del 2020 32975846
851 OMIA:002132-9615 dog German Shorthaired Pointer (Dog) Abortion (embryonic lethality), BTBD17-related BTBD17 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.6048201_6048202insG c.85+206_85+207insG ROS_Cfam_1.0:g.6720627_6720628insG ENSCAFT00845033049.1:c.85+206_85+207insG; the homozygous variant genotype is associated with embryonic lethality in German Shorthaired Pointer, but may not be causal as the variant was observed at a high frequency in both heterozygous and homozygous form across normal dogs from multiple breeds (PMID:37582787) rs852549625 2017 29053721
981 OMIA:001991-9913 taurine cattle Nordic Red (Cattle) Stillbirth BTBD9 deletion, gross (>20) Naturally occurring variant yes 23 "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" 2016 27091210
325 OMIA:001622-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup C BTN1A1 nonsense (stop-gain) Naturally occurring variant no GRCg6a 28 g.903289G>T c.165C>A p.(C55*) rs735807319 2005 16051833 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
455 OMIA:000155-9615 dog Brittany Spaniel (Dog) C3 deficiency C3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 20 g.53573746del c.2136del p.(F712Lfs*11) XM_038428862.1; XP_038284790.1 "a deletion of a cytosine at position 2136 (codon 712), leading to a frameshift that generates a stop codon 11 amino acids downstream" 1998 9510185
1660 OMIA:002819-9913 taurine cattle Holstein Friesian (Cattle) Muscle weakness CACNA1S missense Naturally occurring variant yes ARS-UCD1.2 16 g.79613592C>T c.3853G>A p.G1285S ENSBTAT00000065901.3; ENSBTAP00000054797.3 rs3423414874 2024 38246543
1087 OMIA:002201-9913 taurine cattle Normande (Cattle) Abortion due to haplotype NH7 CAD missense Naturally occurring variant yes ARS-UCD1.2 11 g.72409143T>C p.(Y452C) published as CAD g.72399397T>C; p.Tyr452Cys 2019 31056337 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1490 OMIA:002573-151761 yellow-crowned parrot Lewy body-like disease CADPS2 missense Naturally occurring variant yes c.1675G>C p.(V559L) 2022 36086934
105 OMIA:001820-9615 dog Parson Russell Terrier (Dog) Ataxia, spinocerebellar CAPN1 missense Naturally occurring variant yes CanFam3.1 18 g.52009339C>T c.344G>A p.(C115Y) XM_540866.5; XP_540866.2 2013 23741357 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1692 OMIA:002854-9615 dog Miniature Schnauzer (Dog) Immunodeficiency, susceptibility to Mycobacterium avium complex CARD9 deletion, small (<=20) yes CanFam3.1 9 NC_006591.3:g.49115079_49115081del XM_844178.5:c.493_495del XP_849271.2: p.(K165del) 2024 38710903
1674 OMIA:002835-9615 dog Cavalier King Charles Spaniel (Dog) Immunodeficiency, CARMIL2-related CARMIL2 missense Naturally occurring variant yes CanFam3.1 5 g.81801920G>A c.871C>T p.(R291*) NC_006587.3; XM_022419456.1; XP_022275164.1 rs3330142729 2024 38535207
49 OMIA:001138-9615 dog American Foxhound (Dog) Beagle (Dog) English Foxhound (Dog) Harrier (Dog) Poodle, Miniature (Dog) Treeing Walker Coonhound (Dog) Hypocatalasia CAT missense Naturally occurring variant yes CanFam3.1 18 g.33397548C>T c.979G>A p.(A327T) Variant initially identified in Beagle and later reported in additional breeds: PMID:29708978, PMID27525650 2000 11137458 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1032 OMIA:002167-9913 taurine cattle Nordic Red (Cattle) Asthenospermia CCDC189 splicing Naturally occurring variant yes ARS-UCD1.2 25 g.26880841C>T Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." 2019 30975085
266 OMIA:001540-9615 dog Old English Sheepdog (Dog) Ciliary dyskinesia, primary CCDC39 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 34 g.13952270G>A c.286C>T p.(R96*) 2011 21131972 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1403 OMIA:002342-9940 sheep Blanc Du Massif Central (Sheep) Lacaune (Sheep) Ciliary dyskinesia, primary (respiratory failure) CCDC65 LDHH6 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.147207999C>A c.521G>T p.(E111*) XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A rs1085624756 2021 35052387
1274 OMIA:001521-9615 dog Portuguese Water Dog (Dog) Progressive retinal atrophy, early onset CCDC66 EOPRA insertion, small (<=20) Naturally occurring variant yes CanFam3.1 20 g.33717704_33717705insT c.2262_c.2263insA p.(V747Sfs*8) 2020 33273526
574 OMIA:001521-9615 dog Schapendoes (Dog) Generalized PRA CCDC66 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 20 g.33745452_33745453insT c.521_522insA p.(N174Kfs*2) NM_001168012.1; NP_001161484.1; genomic coordinates in accordance with HGVS 3'-rule 2010 19777273 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
538 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) Naturally occurring variant no 28 c.502_511delCGCTCACCCC 2015 25873518
539 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) Naturally occurring variant no 28 c.502_516delCGCTCACCCCGCCCC 2015 25873518
395 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 splicing Naturally occurring variant no 28 c.506-515del10 2012 22171251
396 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 splicing Naturally occurring variant no 28 c.507-511del5 2012 22171251
603 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 tva^r2 insertion, small (<=20) Naturally occurring variant no GRCg6a 28 g.985659_985660insCTCG c.48_49insCTCG p.(P18Afs) NM_001044645.1; NP_001038110.1 2004 15564460 Genomic position in GRCg6a provided by Joshua Khamis.
12 OMIA:001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 tva^r missense Naturally occurring variant no GRCg6a 28 g.985980C>G c.185C>G p.(C62W) NM_001044645.1; NP_001038110.1; published as c.120C>G and p.(C40W); coordinates in the table have been updated to a recent reference genome and / or transcript 2004 15564460 Genomic position in GRCg6a provided by Joshua Khamis.
1528 OMIA:002626-9913 taurine cattle Japanese Black, Japan (Cattle) Haplotype with homozygous deficiency JBH17, CDC45-related CDC45 splicing Naturally occurring variant yes UMD_3.1.1 17 g.74743512G>T located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing 2021 33758295
1496 OMIA:002584-9615 dog Beauceron (Dog) Deafness, CDH23-related CDH23 missense Naturally occurring variant yes CanFam3.1 4 g:22340631C>T c.700C>T p.(P234S) ON462053; XM_022417544.1; XP_022273252.1 2022 36308003 The UU_Cfam_GSD_1.0 genomic variant coordinate is: g.Chr4:23074925C>T
991 OMIA:001830-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH7 CENPU deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 27 g.15123637_15123640del Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." 2020 31733857
964 OMIA:001502-9913 taurine cattle Montbéliarde (Cattle) Caprine-like Generalized Hypoplasia Syndrome CEP250 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 13 g.64710424C>T c.493C>T p.(Q165*) 2015 25902731 Coordinates obtained from and/or confirmed by EBI's VEP
384 OMIA:001244-9685 domestic cat Abyssinian (Cat) American Curl (Cat) American Wirehair (Cat) Balinese (Cat) Bengal (Cat) Colorpoint Shorthair (Cat) Cornish Rex (Cat) Munchkin (Cat) Ocicat (Cat) Oriental Shorthair (Cat) Peterbald (Cat) Siamese (Cat) Singapura (Cat) Somali (Cat) Tonkinese (Cat) Retinal degeneration II CEP290 splicing Naturally occurring variant yes Felis_catus_9.0 B4 g.112522818A>C c.7584+9T>G XM_023256243.1; published as IVS50 + 9T>G. The cat sequenced to generate the Felis_catus_9.0 reference genome is homozygous for the likely causal variant. The genomic and cDNA coordinates had therefore been previously listed in this table as g.112522818TC>A and c.7584+9G>T. The information has been updated based on feedback from 潘旭 to reflect that the likely causal variant is c.7584+9G and that the normal allele is c.7584+9T[6/4/2023]. 2007 17507457 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Variant was initially identified in the Abyssinian and Somali breeds but identified to be present in several other breeds (Menotti-Raymond et al., 2020; Pubmed:19747862)
177 OMIA:000636-9823 pig Membranoproliferative glomerulonephritis type II CFH missense Naturally occurring variant yes Sscrofa11.1 10 c.3610T>G p.(I1166R) CFH is located on Chr10 in Sscrofa10.2 g.2553907T>G, but recorded as 'unplaced/NW_018085100.1' in Sscrofa11.1. 2002 12466119 The genomic location on Sscrofa11.1 was determined by Stephanie Shields (27/05/2020)
1479 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR nonsense (stop-gain) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 4 g.57192317C>A c.1621G>T p.(G541*) NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence 2021 34632318
1478 OMIA:001794-9940 sheep Romney (Sheep) Cystic fibrosis CFTR deletion, small (<=20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 4 g.57218683_57218685del c.1518_1520del p.(F507del) NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence 2021 34632318
61 OMIA:002072-9615 dog Old Danish Pointing Dog (Dog) Myasthenic syndrome, congenital CHAT missense Naturally occurring variant yes CanFam3.1 28 g.1484906G>A c.85G>A p.(V29M) XM_005637485.3; XP_005637542.1 2007 17586598 20181218 Thanks to Maarten de Groot for advising FN of the genomic location of this variant.
838 OMIA:002125-9913 taurine cattle Montbéliarde (Cattle) Neurocristopathy CHD7 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 14 g.26402250_26402254del p.(K594Afs*29) 2017 28904385
554 OMIA:002022-9913 taurine cattle Red Dane (Cattle) Arthrogryposis multiplex congenita, CHRNB1-related CHRNB1 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.27122027del c.55del p.(A19Pfs47*) Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) 2016 27364156 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
490 OMIA:000685-9915 indicine cattle (zebu) Brahman (Cattle) Myasthenic syndrome, congenital, CHRNE-related CHRNE 470del20 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.26485848_26485867del c.470_489del Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised 2002 12481987 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
614 OMIA:000685-9615 dog Jack Russell Terrier (Dog) Myasthenic syndrome, congenital, due to CHRNE CHRNE insertion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.31705136_31705137insC c.636_637insC p.(G212Rfs*274) ENSCAFT00000083466.1; ENSCAFP00000057633.1; published as c.633_634insC, coordinates in the table updated in accordance to HGVS 3'-rule 2015 26429099
804 OMIA:000685-9615 dog Heideterrier (Dog) Myasthenic syndrome, congenital, due to CHRNE CHRNE insertion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.31707450_31707451insG c.1436_1437insG p.(S479Rfs*14) XM_014113502.1; XP_013968977.1 2017 28508416
1664 OMIA:000698-9940 sheep Myotonia CLCN1 unpublished unknown Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. 2024 Reference not in PubMed; see OMIA 000698-9940 for reference details
399 OMIA:000698-89462 water buffalo Murrah (Buffalo) Myotonia CLCN1 splicing Naturally occurring variant yes c.396C>T 2013 23339992
224 OMIA:000698-9925 goat Myotonia CLCN1 missense Naturally occurring variant yes ARS1 4 g.13857007C>G c.2590G>C p.(P864A) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000031898.1 1996 8855341
609 OMIA:000698-9615 dog Australian Cattle Dog (Dog) Border Collie (Dog) Myotonia CLCN1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 16 g.6344748_6344749insT c.2647_2648insA p.(R883Qfs*18) NM_001003124.2; NP_001003124.1; published as c.2665insA; p.(R889fs); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17552451
1041 OMIA:000698-9615 dog Labrador Retriever (Dog) Myotonia CLCN1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 16 g.6348929T>A c.2275A>T p.(R759X) Quitt et al. (2018): "Chr16:6348929 T A CLCN1 ENSCAFG00000003619.3 stopgain" 2018 29934119
62 OMIA:000698-9615 dog Miniature Schnauzer (Dog) Myotonia CLCN1 missense Naturally occurring variant yes CanFam3.1 16 g.6366383G>A c.803C>T p.(T268M) 1999 10452529 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1364 OMIA:000698-9615 dog American Bulldog (Dog) Myotonia CLCN1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 16 g.6369245_6369246insAGAG c.436_437insCTCT p.(Y146Sfs*49) cDNA and protein position based on NM_001003124.2 and NP_001003124.1 2020 33246886
1570 OMIA:000698-9615 dog Mixed Breed (Dog) Myotonia CLCN1 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 16 g.[6367458_6367478del;6367482del;6367485A>C] c.[703T>G;706del;710_730del] p.[(F235V;V236fs)] NM_001003124.2; NP_001003124.1; published as c.[705T>G; 708del; 712_732del], coordinates in the table have been updated to the CanFam3.1 reference genome and reflect correction in PMID:37212506. 2023 37212506
161 OMIA:000698-9796 horse New Forest Pony (Horse) Myotonia CLCN1 missense Naturally occurring variant yes EquCab3.0 4 g.96518592A>C c.1775A>C p.(D592A) c.1775A>C, Genbank acc. XM_001915636); p.D592A, Genbank acc. XP_001915671 (Wijnberg et al., 2014) 2012 22197188 (FN thanks Izabela De Assis Rocha, who provided genomic location in EquCab3.0 and the Genbank acc IDs, working under the supervision of Professor Ernie Bailey; 15 April 2020) Revised genomic location kindly provided by Cord Drögemüller; 21 May 2021
1573 OMIA:000698-9685 domestic cat Domestic Longhair Myotonia CLCN1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A2 g.158967085_158967092del p.(L143Qfs3*) NP_001291956.1; published as chrA2:15897085‐15 897 092, coordinates in this table have been verified in Felis_catus_9.0 2022 35815860
1623 OMIA:000698-9685 domestic cat Myotonia CLCN1 missense Naturally occurring variant yes Felis_catus_9.0 A2 g.158976314G>C c.991G>C p.(A331P) NM_001305027.1; NP_001291956.1 2023 37668104
408 OMIA:000698-9685 domestic cat Myotonia CLCN1 splicing Naturally occurring variant yes Felis_catus_9.0 A2 g.158986498G>T c.1930+1G>T NM_001305027.1 2014 25356766 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
245 OMIA:000698-9940 sheep Rasa Aragonesa, Spain (Sheep) Myotonia CLCN1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.115541101G>A c.277G>A p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. cDNA and protein position predicted using Variant Effect Predictor ENSOART00020002372.1 rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1365 OMIA:000698-9823 pig Myotonia CLCN1 deletion, gross (>20) Naturally occurring variant yes Sscrofa11.1 18 g.6912538_6916702del 2019 31666547
1678 OMIA:000698-9615 dog French Bulldog (Dog) Myotonia CLCN1 duplication Naturally occurring variant unknown UU_Cfam_GSD_1.0 16 g.6074128_6074135dup c.2423_2430dup p.(F811Lfs*39) NM_001003124.2; NP_001003124.1; NC_049237.1 2024 38473107
210 OMIA:001887-9913 taurine cattle Belgian Blue (Cattle) Osteopetrosis with gingival hamartomas CLCN7 missense Naturally occurring variant yes ARS-UCD1.2 25 g.[1139611G>T; 1139613A>G] c.[2248T>C;2250C>A] p.(Y750Q) 2014 24159188 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
648 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 1 deletion, gross (>20) Naturally occurring variant yes 1 37kb deletion of exons 1-4 2000 10810088
781 OMIA:001135-9913 taurine cattle Japanese Black, Japan (Cattle) Renal dysplasia CLDN16 Type 2 deletion, gross (>20) Naturally occurring variant yes 1 "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised 2002 12047224 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1669 OMIA:002432-9913 taurine cattle Hereford (Cattle) Retinal degeneration, CLN3-realted CLN3 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 25 g.26043843del c.1106del p.(P369Rfs*8) NM_001075174.2; NP_001068642.2 2024 38516801
593 OMIA:001482-9913 taurine cattle Devon (Cattle) Neuronal ceroid lipofuscinosis, 5 CLN5 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 12 g.52112732_52112733insG c.662_663insG p.(R221Gfs*6) 2006 16935476 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG
279 OMIA:001482-9615 dog Australian Cattle Dog (Dog) Border Collie (Dog) Neuronal ceroid lipofuscinosis, 5 CLN5 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 22 g.30574637C>T c.619C>T p.(Q207*) rs1152388418 2005 16033706 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020: g. coordinate corrected, with thanks to Angelica K Kallenberg
541 OMIA:001482-9615 dog Golden Retriever (Dog) Neuronal ceroid lipofuscinosis, 5 CLN5 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 22 g.30574953_30574954del c.935_936del p.(E312Vfs*6) NM_001011556.1; NP_001011556.1,published as CLN5:c.934_935delAG; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 25934231 Breed information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
389 OMIA:001482-9940 sheep Borderdale, New Zealand (Sheep) Neuronal ceroid lipofuscinosis, 5 CLN5 splicing Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.56313269G>A c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
68 OMIA:001443-9615 dog Australian Shepherd (Dog) Neuronal ceroid lipofuscinosis, 6 CLN6 missense Naturally occurring variant yes CanFam3.1 30 g.32247875A>G c.829T>C p.(W277R) ROS_Cfam_1.0:g.32443458A>G ENSCAFT00845033654.1:c.829T>C ENSCAFP00845026347.1:p.Trp277Arg rs1152388420 2011 21234413 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1213 OMIA:001443-9685 domestic cat Domestic medium-haired Neuronal ceroid lipofuscinosis, 6 CLN6 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 B3 g.39334330G>A c.668G>A p.(W223*) ENSFCAT00000025909:c.668G>A; XM_003987007.5:c.668G>A (Katz et al. (2020) 2020 32518081
671 OMIA:001443-9940 sheep South Hampshire, New Zealand (Sheep) Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
234 OMIA:001443-9940 sheep Merino (Sheep) Neuronal ceroid lipofuscinosis, 6 CLN6 missense Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.16039510G>A c.184C>T p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1030 OMIA:001962-9542 Japanese macaque Neuronal ceroid lipofuscinosis, 7 CLN7 deletion, small (<=20) Naturally occurring variant yes 4 c.769delA p.(I257Lfs*36) 2018 30048804
690 OMIA:001506-9615 dog Alpine Dachsbracke (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 37 g.30852988_30902901del c.-14679_*18669del NM_001012343.1; a homozygous deletion encompassing the entire CLN8 gene 2017 28024876 g. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
971 OMIA:001506-9615 dog Saluki (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 37 g.30874636dupT c.349dupT p.(E117*) "an insertion of 1 bp (T) in the CLN8 gene (Fig. S2) in a short T repeat, thereby changing the stretch of 9 T's to a stretch consisting of 10 T's. The exact position of the inserted base could obviously not be verified, given that this was an insertion of a single base in a stretch of nine repeats of the same base (CFA37:g.30874628–30874636). According to the recommended nomenclature, the T insertion was noted as a T duplication in the T farthest in the 3′ direction (g.30874636dupT; c.349dupT)" 2018 29446145
69 OMIA:001506-9615 dog English Setter (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 missense Naturally occurring variant yes CanFam3.1 37 g.30874779T>C c.491T>C p.(L164P) 2005 15629147 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
338 OMIA:001506-9615 dog Australian Shepherd (Dog) German Shorthaired Pointer (Dog) Neuronal ceroid lipofuscinosis, 8 CLN8 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 37 g.30883950G>A c.585G>A p.(W195*) NM_001012343: c.585G>A (Guo et al., 2014) 2014 24953404 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; confirmed by Guo et al. (2019, pages 3, 4, 5 and 6), assuming that the g. coordinate (g.30,895,648) in the abstract of Guo et al. (2019) is a typo.
547 OMIA:001977-9615 dog Shetland Sheepdog (Dog) Progressive retinal atrophy, due to CNGA1 mutations CNGA1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.43831897_43831900del c.1752_1755del p.(T585Sfs*7) NM_001003222.1; published as c.1752_1755delAACT 2015 26202106 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
548 OMIA:001481-9615 dog Labrador Retriever (Dog) Achromatopsia-2 CNGA3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 10 g.44234198_44234200del c.1931_1933del p.(V644del) NM_001301112.1; published as c.1931_1933delTGG rs852784090 2015 26407004 Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn
97 OMIA:001481-9615 dog German Shepherd Dog (Dog) Achromatopsia-2 CNGA3 missense Naturally occurring variant yes CanFam3.1 10 g.44234861C>T c.1270C>T p.(R424W) NM_001301112.1; NP_001288041.1 2015 26407004 Genomic position in CanFam3.1 provided by Mateo Etcheveste.
1016 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.108958871C>T c.1618G>A p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
317 OMIA:001481-9940 sheep Awassi (Sheep) Achromatopsia-2 (day blindness) CNGA3 nonsense (stop-gain) Naturally occurring variant yes Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
918 OMIA:002723-9615 dog Papillon (Dog) Phalène (Dog) Progressive retinal atrophy CNGB1 delins, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.58622673_58622675delinsCTAGCTAC c.2387_2389delinsCTAGCTAC p.(Y796Sfs*7) NM_001284462.1; NP_001271391.1; published as c.2685delA2687_2688insTAGCTA and p.(Y889Sfs*5); coordinates in the table have been updated to a recent reference genome and / or transcript and updated to HGVS recommendations 2013 24015210
631 OMIA:001365-9615 dog Alaskan Malamute (Dog) Miniature Australian Shepherd Dog (Dog) Achromatopsia (cone degeneration, hemeralopia), AMAL CNGB3 cd^AMAL deletion, gross (>20) Naturally occurring variant yes 29 "deletion removing all exons of canine CNGB3" 2002 12140185
1400 OMIA:001365-9913 taurine cattle Brown Swiss (Cattle) Achromatopsia CNGB3 OH1 missense Naturally occurring variant yes ARS-UCD1.2 14 g.76011964G>A c.751G>A p.(D251N) XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn rs716218235 2021 34830323
27 OMIA:001365-9615 dog German Shorthaired Pointer (Dog) Achromatopsia (cone degeneration, hemeralopia), GSPT CNGB3 cd^GSPT missense Naturally occurring variant yes CanFam3.1 29 g.32837065C>T c.784G>A p.(D262N) 2002 12140185 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020 Chromosome corrected, thanks to Angelica K Kallenberg
1502 OMIA:002591-9615 dog Dalmatian (Dog) Lysosomal storage disease, CNP-related CNP deletion, small (<=20) Naturally occurring variant yes Dog10K_Boxer_Tasha 9 g.20350240del c.1107del p.(K370Nfs*11) ENSCAFT00000102206 2022 35447247
1680 OMIA:002591-9615 dog Weimaraner (Dog) Lysosomal storage disease, CNP-related CNP missense Naturally occurring variant yes Dog10K_Boxer_Tasha 9 g.20355460G>A c.125C>T p.(T42M) XM_844467.6; XP_849560.2; NC_006591.4 2024 38397235
1273 OMIA:002301-9615 dog Labrador Retriever (Dog) Leonberger (Dog) Pyrenean Shepherd (Dog) Saint Bernard (Dog) Laryngeal paralysis and polyneuropathy CNTNAP1 LPPN3 missense Naturally occurring variant yes CanFam3.1 9 g.20298261C>T c.2810G>A p.(G937E) XM_548083.6:c.2810G>A; XP_548083.3:p.Gly937Glu; variant initially identified in Labrador Retriever, Leonberger and Saint Bernard and later reported in a Pyrenean Shepherd (PMID: 37582787) rs24587752 2020 33261176
172 OMIA:001718-9823 pig Dwarfism, Schmid metaphyseal chondrodysplasia COL10A1 missense Naturally occurring variant yes Sscrofa11.1 1 g.81767089C>T c.1768G>A p.(G590R) 2000 11130976 The genomic and CDS position was determined by Stephanie Shields and the effect was confirmed with Ensembl VEP (27/05/2020)
1657 OMIA:002811-9615 dog Old English Sheepdog (Dog) Multiocular defect COL11A1 missense Naturally occurring variant yes CanFam3.1 6 g.47611886T>C c.1775T>C p.(F1592S) 2023 38153936
78 OMIA:001772-9615 dog Labrador Retriever (Dog) Skeletal dysplasia 2 (SD2) COL11A2 missense Naturally occurring variant yes CanFam3.1 12 g.2652874C>G c.143G>C p.(R48P) ROS_Cfam_1.0:g.2983602C>G ENSCAFT00845034709.1:c.143G>C ENSCAFP00845027184.1:p.Arg48Pro rs851399084 2013 23527306 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1634 OMIA:002793-9685 domestic cat American Shorthair (Cat) Epidermolysis bullosa, junctional, COL17A1-related COL17A1 splicing Naturally occurring variant yes F.catus_Fca126_mat1.0 D2 g.62124169del c.3019+1del XM_006938156.5; variant reported in a single affected cat 2023 37895184
1635 OMIA:002793-9685 domestic cat European Shorthair (Cat) Epidermolysis bullosa, junctional, COL17A1-related COL17A1 splicing Naturally occurring variant yes F.catus_Fca126_mat1.0 D2 g.62149308C>T c.769+5G>A p.([=,p.Val257Glyfs*82]) XM_006938156.5; XP_006938218.3, variant described in a single affected cat 2023 37895184
1031 OMIA:002127-9913 taurine cattle Red Angus (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 missense Naturally occurring variant yes ARS-UCD1.2 19 g.36463798G>A c.1063G>A p.(G355S) Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) rs3423092630 2019 30788588
839 OMIA:002127-9913 taurine cattle Simmental (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.36470764_36470767delinsT c.3145_3148delinsT p.(A1049_P1050delinsS) UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 rs876049195 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1289 OMIA:002127-9913 taurine cattle Holstein (black and white) (Cattle) Osteogenesis imperfecta, type II, COL1A1-related COL1A1 missense Naturally occurring variant yes ARS-UCD1.2 19 g.36473359T>A c.3917T>A p.(V1306E) NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) 2021 33672767
959 OMIA:002126-9615 dog Golden Retriever (Dog) Osteogenesis imperfecta, type III, COL1A1-related COL1A1 missense Naturally occurring variant yes CanFam3.1 9 g.26193593C>G c.1145G>C p.(G382A) NM_001003090.1; NP_001003090.1; published as c.1276G>C, p.(G208A); coordinates in the table have been updated to a recent reference genome and / or transcript rs1152388502 2000 11147834
762 OMIA:002112-9615 dog Beagle (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 delins, small (<=20) Naturally occurring variant yes CanFam3.1 14 g.(19918265_19918268delinsTGTCATTGG) c.3656_3859delinsTGTCATTGG p.(L1286Cfs*31) NM_001003187.1; NP_001003187.1; "a mutation in which nucleotides 3991-3994 ("CTAG") were replaced with "TGTCATTGG." The first seven bases of the inserted sequence were identical to nucleotides 4002-4008 of the normal canine COL1A2 sequence. The resulting frameshift changed 30 amino acids and introduced a premature stop codon." The genomic information is presented in brackets as the variant was detected in cDNA and the genomic position is predicted. Coordinates in the table have been updated to a recent reference genome and or transcripts. 2001 11393792
1114 OMIA:002112-9615 dog Lagotto Romagnolo (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 duplication Naturally occurring variant yes CanFam3.1 14 g.19898279_19898281dup c.877_879dup p.(P293dup) NM_001003187.1; NP_001003187.1 2019 31468557
852 OMIA:002112-9615 dog Chow Chow (Dog) Osteogenesis imperfecta, COL1A2-related COL1A2 splicing Naturally occurring variant yes CanFam3.1 14 g.19898487G>A c.936+1G>A 2018 29036614
840 OMIA:001926-9913 taurine cattle Charolais (Cattle) Salers (Cattle) Bulldog calf COL2A1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.32301746G>A c.1791G>A p.(G600D) 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1275 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 5 g.32301911_32308589del "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) 2021 33316082
1241 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 delins, gross (>20) Naturally occurring variant yes ARS-UCD1.2 5 g.32303127_32306640delinsTCTGGGGAGC 2020 32894162
842 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.32303739G>A c.2158G>A p.(G720S) 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
414 OMIA:001926-9913 taurine cattle Danish Holstein (Cattle) bulldog calf COL2A1 splicing Naturally occurring variant yes ARS-UCD1.2 5 g.32305226G>A c.2463+1G>A 2016 27296271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
223 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.32307658G>A p.(G960R) 2014 25017103
841 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.32308008G>A c.2986G>A p.(G996S) rs876243579 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1026 OMIA:001926-9913 taurine cattle Holstein (black and white) (Cattle) Bulldog calf COL2A1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.32308734G>A c.3166G>A p.(G1056S) 2019 30378686
278 OMIA:002618-9615 dog English Springer Spaniel (Dog) Nephropathy COL4A4 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 25 g.39893376G>A c.2713C>T p.(Q905*) NM_001031818.1; NP_001026988.1; published as c.2806C>T and p.(Q904*) 2012 22369189
277 OMIA:002618-9615 dog English Cocker Spaniel (Dog) Nephropathy COL4A4 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 25 g.39953906T>A c.115A>T p.(K39*) 2007 17552442 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
471 OMIA:001112-9615 dog Navasota (mixed breed) (Dog) Nephritis, X-linked COL4A5 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.82134508_82134517del c.513_522del p.(N172Ifs) XM_005640969.3; XP_005641026.1; a 10 base pair (TAATCCAGGA) deletion in exon 9 of COL4A5 2003 12879362
276 OMIA:001112-9615 dog Samoyed (Dog) Nephritis, X-linked COL4A5 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 X g.82196868G>T c.3079G>T p.(G1027*) 1994 8171024 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1124 OMIA:002165-9615 dog Labrador Retriever (Dog) Ehlers-Danlos syndrome, classic type, 1 COL5A1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.50806169del c.3038del p.(G1013Vfs*260) XM_022423936.1; XP_022279644.1; published as c.3038delG - "variant arose by a de novo mutation event during the development of the mother." (Bauer et al., 2019) 2019 31546637
1125 OMIA:002165-9615 dog Mixed Breed (Dog) Ehlers-Danlos syndrome, classic type, 1 COL5A1 missense Naturally occurring variant yes CanFam3.1 9 g.50832936G>A c.4711G>A p.(G1571R) XM_022423936.1,c.4711G>A; XP_022279644.1,p.(Gly1571Arg) 2019 31546637
1696 OMIA:002165-9685 domestic cat Maine Coon (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, gross (>20) Naturally occurring variant yes F.catus_Fcat126_mat1.0 D4 NC_058380.1:g.93561989_93595728del deletion of 33740 base pairs including the last two exons of COL5A1 2024 38745376
1465 OMIA:002165-9685 domestic cat Bombay (Cat) classical Ehlers-Danlos syndrome COL5A1 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 D4 g.93209345T>A c.3514A>T p.(Lys1172*) XM_023242950.1; XP_023098718.1 2022 35627182
1025 OMIA:002165-9685 domestic cat Domestic Shorthair classical Ehlers-Danlos syndrome COL5A1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D4 g.93210344del c.3420del p.(L1141Sfs*134) XM_023242951.1; XP_023098719.1; published as c.3420delG 2018 30246406
1466 OMIA:002165-9685 domestic cat Domestic Shorthair classical Ehlers-Danlos syndrome COL5A1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D4 g.93215496del c.3066del p.(Gly1023Valfs*50) XM_023242950.1; XP_023098718.1 2022 35627182
1609 OMIA:002165-9685 domestic cat Domestic medium-haired classical Ehlers-Danlos syndrome COL5A1 splicing Naturally occurring variant yes Felis_catus_9.0 D4 g.93290016T>G c.501-2A>C XM_023242950.1 2023 37594181
1464 OMIA:002165-9685 domestic cat Bengal (Cat) classical Ehlers-Danlos syndrome COL5A1 deletion, gross (>20) Naturally occurring variant yes Felis_catus_9.0 D4 g.93331577_93331598del c.112_118+15del r.spl? XM_023242950.1 2022 35627182
1263 OMIA:002295-9913 taurine cattle Holstein (black and white) (Cattle) Ehlers-Danlos syndrome, classic type, 2 COL5A2 missense Naturally occurring variant yes ARS-UCD1.2 2 g.7331916G>T c.2366G>T p.(G789V) XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) 2020 33143196
1460 OMIA:002295-9615 dog Chihuahua (Dog) Ehlers-Danlos syndrome, classic type, 2 COL5A2 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 36 g.30548697_30548723del c.3388_3414del p.(Lys1130_Asp1138del) XM_005640393.3; XP_005640450.1 2022 35627319
340 OMIA:001967-9615 dog Landseer (Dog) Muscular dystrophy, Ullrich type COL6A1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 31 g.39303964G>T c.289G>T p.(E97*) XM_003434001.5; XP_003434049.2; previously incorrectly listed in this table as c.289C>T; p.(Q97*) - corrected 8/2/2022 2015 26438297
1184 OMIA:002260-9913 taurine cattle Holstein (black and white) (Cattle) de novo mutation in an AI sire COL6A3 missense Naturally occurring variant yes ARS-UCD1.2 3 g.116826597G>A p.(T1894M) Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. 2017 28904385
1625 OMIA:002274-9615 dog American Staffordshire Terrier (Dog) Muscular dystrophy, COL6A3-related COL6A3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 25 g.48005972del c.6398del p.(P2133Rfs*109) NM_001103215.1; NP_001096685.1; published as g.48287602CG>C in CanFam4 2023 37706358
1208 OMIA:002274-9615 dog Labrador Retriever (Dog) Muscular dystrophy, COL6A3-related COL6A3 splicing Naturally occurring variant yes CanFam3.1 25 g.48007994C>T c.6210+1G>A NM_001103215.1; CanFam3.1 chr25:48,007,994C > T; NM_001103215.1 c.6210 + 1G > A (Bolduc et al., 2020) 2020 32439203
1207 OMIA:002274-9615 dog Labrador Retriever (Dog) Muscular dystrophy, COL6A3-related COL6A3 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 25 g.48014962G>A c.4726C>T p.(R1576*) NM_001103215.1; NP_001096685.1; CanFam3.1 chr25:48,014,962G > A; NM_001103215.1 c.4726C > T, p.R1576* (Bolduc et al., 2020) 2020 32439203
292 OMIA:000341-9913 taurine cattle Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) Epidermolysis bullosa, dystrophic COL7A1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 22 g.51301158C>T c.4762C>T p.(R1588*) rs876174537 2012 22715415 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
357 OMIA:000341-9615 dog Central Asian Shepherd Dog (Dog) Epidermolysis bullosa, dystrophic COL7A1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 20 g.40532043C>T c.4579C>T p.(R1527*) 2017 28493971 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
38 OMIA:000341-9615 dog Golden Retriever (Dog) Epidermolysis bullosa, dystrophic COL7A1 missense Naturally occurring variant yes CanFam3.1 20 g.40538034G>A c.5716G>A p.(G1906S) 2003 12874109 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1276 OMIA:000341-9615 dog Basset Hound (Dog) Epidermolysis bullosa, dystrophic COL7A1 complex rearrangement Naturally occurring variant yes CanFam3.1 20 g.[40524302_40524308del;40524267_40524380dup] c.[2028_2034del;1993_2050+56dup] p.(V677Sfs*11) NM_001002980.1; NP_001002980.1; complex duplication event spanning parts of exon 15 and intron 15 of the COL7A1 gene, starting at position 40,524,267 and ending at 40,524,380 on chromosome 20 (CanFam3.1 assembly) (Garcia et al., 2020). 2020 33291836
641 OMIA:001523-9615 dog Samoyed (Dog) Oculoskeletal dysplasia 2 COL9A2 deletion, gross (>20) Naturally occurring variant yes 15 a 1,267 bp deletion that eliminates part of the 5’UTR, all of exon 1 and part of intron 1 2010 20686772
581 OMIA:001522-9615 dog Labrador Retriever (Dog) Oculoskeletal dysplasia 1 COL9A3 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 24 g.46653422_46653423insG c.10_11insG p.(A4Gfs*46) NM_001197171.1; NP_001184100.1; published as "a 1-base insertion (guanine) in exon 1 that changes a string of four guanines (CFA24: 49,699,847–49,699,850; CanFam2) to a string of five guanines (c.7–10insG). ... (p.A4GX46)" Goldstein et al. (2010). Information in this table has been changed in accordance to HGVS 3'rule and updated to the current reference genome. 2010 20686772
1092 OMIA:001522-9615 dog Northern Inuit Dog (Dog) Oculoskeletal dysplasia 1 COL9A3 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 24 g.46660067C>T c.700C>T p.(R234*) 2019 31415586
944 OMIA:001621-9685 domestic cat Devon Rex (Cat) Sphynx (Cat) Muscular dystrophy-dystroglycanopathy (limb-girdle) COLQ missense Naturally occurring variant yes Felis_catus_9.0 C2 g.135068287C>T c.1190G>A p.(C397Y) rs869320615 2015 26327126 26374066 Genomic location obtained via Ensembl's VEP
643 OMIA:001988-9615 dog Bedlington Terrier (Dog) Wilson disease, COMMD1 type COMMD1 deletion, gross (>20) Naturally occurring variant yes 10 deletion "breakpoints were positioned at 65.3091 and 65.3489 Mb of dog chromosome 10, in intron 1 and intron 2 of COMMD1 respectively, a deletion of 39.7 kb" 2005 16293123
1506 OMIA:001274-452646 American mink Coat colour, black crystal COPA missense Naturally occurring variant unknown NNQGG.v01 FNWR01000261.1 g.4876673G>A c.478C>T p.(R160C) 2022 35729186
358 OMIA:002111-9913 taurine cattle Holstein (red and white) (Cattle) Cataract, recessive, CPAMD8-related CPAMD8 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 7 g.6073556C>T c.220C>T p.(Q74*) 2017 28683140
1418 OMIA:002519-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH24 CPT1C BH24 missense Naturally occurring variant yes ARS-UCD1.2 18 g.56098048G>A c.158G>A p.(G53D) XM_002695120.5 2021 34915862
1428 OMIA:002533-9685 domestic cat Domestic Shorthair Osteogenesis imperfecta CREB3L1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 g.100436508_100436509del c.370_371del p.(C124Lfs) XM_003993204.4; XP_003993253.1; published as c.370_371delTG 2022 35168412
916 OMIA:000881-9685 domestic cat Abyssinian (Cat) Rod-cone dysplasia CRX Rdy deletion, small (<=20) Naturally occurring variant yes F.catus_Fca126_mat1.0 E2 g.9492897del c.546del p.(P185Lfs*2) XM_045045412.1; XP_044901347.1; published as CRX: n.546delC; in the Felis_catus_9.0 assembly the CRX gene is duplicated and genomic coordinates in this table are given for a more recent reference genome 2010 20053974
1176 OMIA:000168-10141 domestic guinea pig Cataract Cryz splicing Naturally occurring variant yes "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) 1992 1390943
692 OMIA:000852-9925 goat Casein, alpha-S1, reduced concentration CSN1S1 insertion, gross (>20) Naturally occurring variant no 6 "a 457-bp insertion within exon 19 (last untranslated exon). This insert is a truncated long interspersed repeated element (LINE) containing part of the ORF-2, the 3' UTR and the poly(A) tail of the original retroposon." 1994 7926797
907 OMIA:001623-9925 goat Casein, alpha-S2, absence CSN1S2 nonsense (stop-gain) Naturally occurring variant no ARS1 6 g.86085134G>A c.763G>A p.(T110*) rs268293093 2001 11419340 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1312 OMIA:001424-9925 goat Absence of β‐casein CSN2 CSN2^0 deletion, small (<=20) Naturally occurring variant no ARS1 6 g.86008404del c.175del p.I59Sfs*10 Changed from g.86008401del to g.86008404del to adhere to the HGVS 3’rule [220110] ENSCHIT00000032661.1:c.175del ENSCHIP00000024801.1:p.Ile59SerfsTer10 Persuy et al. (1999): "allele CSN2^O had a one-nucleotide deletion in the 5' end of exon 7, which introduces a premature stop codon. The open reading frame of allele CSN2^O encodes a shortened polypeptide of 72 amino acids, compared to 223 amino acids for caprine pre beta-casein A." rs645737170 1999 10612234
1311 OMIA:001424-9925 goat Absence of β‐casein CSN2 CSN2^01 regulatory Naturally occurring variant no ARS1 6 g.86015651A>G Cosenza et al. (2016): "nucleotide C .... negatively affects the promoter activity of the CSN2 gene" Synonyms: dbSNP ss1245869815 rs654545998 2007 17931404 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1186 OMIA:002262-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire CSNK1G2 missense Naturally occurring variant yes ARS-UCD1.2 7 g.44265842G>C p.(D164H) Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. 2017 28904385
66 OMIA:001505-9615 dog American Bulldog (Dog) Neuronal ceroid lipofuscinosis, 10 CTSD missense Naturally occurring variant yes CanFam3.1 18 g.46013354C>T c.597G>A p.(M199I) 2006 16386934 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
905 OMIA:001505-9940 sheep Roslagsfår, Sweden (Sheep) Neuronal ceroid lipofuscinosis, 10 CTSD missense Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.51583020G>A c.883G>A p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1517 OMIA:002607-9685 domestic cat Domestic Longhair Pyknodysostosis CTSK nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 C1 g.105945826G>A c.724C>T p.(R242*) ENSFCAT00000003643; variant is reported in a single affected cat 2022 36532681
529 OMIA:001786-9615 dog Beagle (Dog) Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.19796293del c.786del p.(D262Efs*47) NM_001003148.1; NP_001003148.1; deletion C rs1152388404 2014 24164695
447 OMIA:001786-9615 dog Border Collie (Dog) Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.19974334del c.8392del p.(Q2798Rfs*3) NM_001003148.1; NP_001003148.1; deletion C 2013 23613799
1036 OMIA:001786-9615 dog Komondor (Dog) Intestinal cobalamin malabsorption, CUBN-related CUBN splicing Naturally occurring variant yes CanFam3.1 2 g.19981457G>A c.8746+1G>A NM_001003148.1 2018 30591068
287 OMIA:001697-9913 taurine cattle Jersey (Cattle) Abortion due to haplotype JH1 CWC15 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 15 g.15449431C>T c.163C>T p.(R55*) UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 rs1115118696 2013 23349982 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
850 OMIA:002131-9615 dog Mixed Breed (Dog) Methemoglobinaemia, CYB5R3-related CYB5R3 missense Naturally occurring variant yes CanFam3.1 10 g.22832963G>A c.214G>A p.(G72S) 2017 28963729 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
967 OMIA:002131-9615 dog Pomeranian (Dog) Methemoglobinaemia, CYB5R3-related CYB5R3 missense Naturally occurring variant yes CanFam3.1 10 g.22836951A>C c.580A>C p.(I194L) NM_001048084.1, NP_001041549.1 2018 29356095 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1548 OMIA:002131-9685 domestic cat Domestic Shorthair Methaemoglobinaemia, CYB5R3-related CYB5R3 splicing Naturally occurring variant yes F.catus_Fca126_mat1.0 B4 g.135605715C>T c.226+5G>A XM_045062469.1; two transcripts were observed in the cat with the splice variant resulting in two predicted protein variants: XP_044918404.1:p.(G76_Q77insERSPDPARVEPG) and XP_044918404.1:p.(V52Afs*58), 2023 37048064
1155 OMIA:002131-9685 domestic cat Domestic Shorthair Methaemoglobinaemia, CYB5R3-related CYB5R3 missense Naturally occurring variant yes Felis_catus_9.0 B4 g.137967506C>T c.625G>A p.(G209S) Jaffey e al. (2019): "p.Gly209Ser amino acid change in transcript CYB5R3-202 (ENSFCAT00000056925) at position B4:137967506" 2019 31650629
1156 OMIA:002131-9685 domestic cat Domestic Shorthair Methaemoglobinaemia, CYB5R3-related CYB5R3 splicing Naturally occurring variant yes Felis_catus_9.0 B4 g.137970815C>G c.232-1G>C Jaffey et al. (2019): "a putative loss of function splice acceptor variant at c.232-1G>C in the CYB5R3-202 transcript (ENSFCAT00000056925) at position B4:137970815 that is in the acceptor site for exon 4, which likely affects downstream translation of the protein." 2019 31650629
629 OMIA:000017-9986 rabbit Adrenal hyperplasia, congenital CYP11A1 deletion, gross (>20) Naturally occurring variant yes "a large deletion mutation in the P450scc gene" 1993 7682938
117 OMIA:001661-9685 domestic cat Adrenal hyperplasia, congenital, due to 11-beta hydroxylase deficiency CYP11B1 missense Naturally occurring variant yes Felis_catus_9.0 F2 g.84247412G>A c.1151G>A p.(R384Q) XM_004000154.3; XP_004000203.1 published as "a guanosine-to-adenosine mutation in exon 7 that results in an arginine to glutamine amino acid substitution; this latter mutation results in 11β-hydroxylase deficiency-associated CAH in people [Parajes et al. (2010) J Clin Endocrinol Metab 95:779–788]. 2012 22827537 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
720 OMIA:000452-9031 chicken Campine (Chicken) Sebright Bantams, United Kingdom of Great Britain and Northern Ireland (Chicken) Henny feathering CYP19A1 insertion, gross (>20) Naturally occurring variant no GRCg6a 10 g.9683879_9683880insN[7524] The insertion is 7524bp and "contains an intact endogenous retrovirus that was not found in chickens representing 31 different breeds not showing henny feathering or in samples of the ancestral red junglefowl. The sequence shows over 99% sequence identity to the avian leukosis virus ev-1 and ev-21 strains, suggesting a recent integration. The ERV 3’LTR, containing a powerful transcriptional enhancer and core promoter with TATA box together with binding sites for EFIII and Ig/EBP inside the CYP19A1 5′ untranslated region" (Li et al., 2019) 1991 1939054 Genomic location and size of the insertion provided by Li et al. (2019)
1251 OMIA:002288-9913 taurine cattle Hereford (Cattle) Mandibulofacial dysostosis CYP26C1 missense Naturally occurring variant yes ARS-UCD1.2 26 g.14404993T>C c.563T>G p.(L188P) ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg rs431913023 2020 33105751
656 OMIA:000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) Naturally occurring variant yes 5 the first of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) 2003 12915218
657 OMIA:000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) Naturally occurring variant yes 5 the second of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) 2003 12915218
502 OMIA:000837-9685 domestic cat Vitamin D-deficiency rickets, type I CYP27B1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B4 g.86180281del c.731del p.(R244Pfs*32) XM_003988966.3; XP_003989015.1; published as c.731delG 2009 19138382 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
315 OMIA:000837-9685 domestic cat Siamese (Cat) Vitamin D-deficiency rickets, type I CYP27B1 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 B4 g.86180375C>A c.637G>T p.(E213*) XM_003988966.3; XP_003989015.1; 2012 22553308 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1576 OMIA:000837-9615 dog Pug (Dog) Vitamin D-deficiency rickets, type IA CYP27B1 nonsense (stop-gain) Naturally occurring variant yes UU_Cfam_GSD_1.0 10 g.2182971G>T c.261C>A p.(Y87*) XM_038549826.1; XP_038405754.1 2023 37293695
1411 OMIA:002508-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH8 CYP2B6 SH8 missense Naturally occurring variant yes ARS-UCD1.2 18 g.50296371A>T c.938T>A p.(I313N) NM_001075173.1 2021 34944310
1137 OMIA:002221-9685 domestic cat Domestic Shorthair Vitamin D-deficiency rickets, type Ib CYP2R1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 g.72977336del c.1386del p.(F462Lfs*20) XM_003993015.5; XP_003993064.1; genomic position in accordance with HGVS 3'-rule 2019 30777056 Genomic position in Felis_catus_9.0 provided by Joshua Khamis.
52 OMIA:002684-9615 dog Australian Cattle Dog (Dog) Shetland Sheepdog (Dog) Leucodystrophy CYTB missense Naturally occurring variant yes CanFam3.1 M m.14474G>A c.14474G>A p.(V98M) 2006 16026996 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
784 OMIA:001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C splicing Naturally occurring variant yes Sscrofa11.1 10 g.46845535G>A 2015 26320255
785 OMIA:001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C nonsense (stop-gain) Naturally occurring variant yes Sscrofa11.1 10 g.46851262G>A p.(Trp267*) 2015 26320255
167 OMIA:000735-9796 horse Belgian Draft (Horse) Connemara Pony (Horse) Haflinger (Horse) Rocky Mountain, United States of America (Bighorn sheep) Ocular squamous cell carcinoma DDB2 missense Naturally occurring variant yes EquCab3.0 12 g.11726667C>T c.1013C>T p.(T338M) The EquCab2 coordinates, obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, are g.11608667, c.1013C>T and p.T338M rs1139682898 2017 28425625 The EquCab3 g. coordinates were provided by by Meredith O’Connell, working under the guidance of Professor Ernie Bailey, 5 March 2019
1624 OMIA:002582-9913 taurine cattle Japanese Black, Japan (Cattle) Hepatic fibrinogen storage disease DGKG missense Genome-editing (CRISPR-Cas9) yes ARS-UCD1.3 1 g.81082187C>T c.2162C>T p.T721I XM_002684869.5; XP_002684915.3 2023 37681469
565 OMIA:002095-9615 dog Rhodesian Ridgeback (Dog) Epilepsy, generalized myoclonic, with photosensitivity DIRAS1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 20 g.56474668_56474671del c.564_567del p.(D189Afs*11) XM_005633100.3; XP_005633157.1; published as DIRAS1:c.564_567delAGAC 2017 28223533 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
1412 OMIA:002505-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH5 DIS3 SH5 insertion, small (<=20) Naturally occurring variant unknown ARS-UCD1.2 12 g.47511687_47511687insT c.2032dup p.(I678N*2) NP_025000110.1, XM_025000110.1 2021 34944310
615 OMIA:002109-9913 taurine cattle Brown Swiss (Cattle) Tricho-dento-osseous-like syndrome DLX3 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.36665831_36665832insGGAGCACA c.584_585insGGAGCACAGG p.(S198Rfs*99) NM_001081622 position is g.37298375_37298376insGGAGCACA 2017 28670783 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
728 OMIA:001919-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cleft palate 1 DLX6 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 14 g.22068082_22068083insN[2056] "2056 bp insertion [including LINE1] . . within a highly conserved region of DLX6 intron 2 at cfa14.25016716"[CanFam2.0] 2014 24699068
1395 OMIA:001081-9823 pig Duchenne muscular dystrophy DMD DMD^ex52del delins, gross (>20) Transgenesis via somatic cell nuclear transfer (SCNT) yes X gene targeting and somatic cell nuclear transfer was used to replace DMD exon 52 with a neomycin resistance cassette 2013 23784375
922 OMIA:001081-9685 domestic cat Domestic Shorthair Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant yes X A deletion of the muscle promoter and first exon and the Purkinje neuronal first exon of the DMD gene 1994 7881288
923 OMIA:001081-9685 domestic cat Domestic Shorthair Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant yes X A large deletion that "involved regions of the dystrophin gene that are poorly characterized, including the cortical neuronal promoter and its first exon and the skeletal neuronal promoter and its first exon" 2014 24446404
680 OMIA:001081-9615 dog German Shorthaired Pointer (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant yes X a "deletion encompassing the entire dystrophin [DMD] gene" 1999 10407848
536 OMIA:001081-9615 dog Cocker Spaniel (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) Naturally occurring variant yes X deletion of four nucleotides in exon 65, with a reading frame shift predicting a premature stop codon at the site of the deletion 2012 22218699
681 OMIA:001081-9615 dog Tibetan Terrier (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant yes X "a large deletion of exons 8-29" 2012 22218699
729 OMIA:001081-9615 dog Labrador Retriever (Dog) Muscular dystrophy, Duchenne type DMD insertion, gross (>20) Naturally occurring variant yes X "184 nucleotide [pseudoexon] insertion between exon 19 and exon 20, which results in a premature stop codon at the next codon downstream of the insertion" 2012 22218699 Reference not in PubMed; see OMIA 001081-9615 for reference details
957 OMIA:001081-9615 dog Rottweiler (Dog) Muscular dystrophy, Duchenne type DMD nonsense (stop-gain) Naturally occurring variant yes X "nonsense mutation in exon 58" 1994 Reference not in PubMed; see OMIA 001081-9615 for reference details
989 OMIA:001081-9615 dog Poodle, Miniature (Dog) Muscular dystrophy, Duchenne type DMD deletion, gross (>20) Naturally occurring variant yes X "a >5 Mb deletion on the X chromosome, encompassing the entire DMD gene" 2018 29474464
367 OMIA:001081-9615 dog Cavalier King Charles Spaniel (Dog) Muscular dystrophy, Duchenne type DMD splicing Naturally occurring variant yes CanFam3.1 X g.26956239G>A c.7294+5G>T NM_001003343.1; NP_001003343.1; experimentally confirmed splice defect; a single nucleotide variant in the 5'-splice site of intron 51 that results in skipping of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein 2010 20072625
562 OMIA:001081-9615 dog Cavalier King Charles Spaniel (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.27442996_27443002del c.6057_6063del p.(N2021Pfs) NM_001003343.1; NP_001003343.1; published as c.6051_6057delTCTCAAT based on different transcript 2016 28028563
542 OMIA:001081-9615 dog Norfolk Terrier (Dog) Muscular dystrophy, Duchenne type DMD deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.27606021del c.3084delG p.(G1029Nfs*30) 2015 26401335
1249 OMIA:001081-9615 dog Jack Russell Terrier (Dog) Duchenne-type muscular dystrophy DMD deletion, gross (>20) Naturally occurring variant yes CanFam3.1 X g.27615280_27982912del c.94-10346_2807-6207del XM_005641029.1 2020 33049940
1236 OMIA:001081-9615 dog Australian Labradoodle (Dog) Australian Labradoodle dystrophinopathy DMD nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 X g.27621845G>A c.2668C>T p.(R890*) NM_001003343.1; NP_001003343.1; "a C to T transition at base pair 43 in exon 21 of the dystrophin gene" (Shrader et al., 2018) 2018 30286978
1234 OMIA:001081-9615 dog Labrador Retriever (Dog) Labrador Retriever muscular dystrophy (LRMD) DMD inversion Naturally occurring variant yes CanFam3.1 X g.27622834_29823788inv c.-1490357_2626-947inv XM_005641029.1 2020 32767978
1235 OMIA:001081-9615 dog Border Collie (Dog) Muscular dystrophy, Duchenne DMD deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.27626466del c.2841delT 2018 29843823
750 OMIA:001081-9615 dog Japanese Spitz (Dog) Muscular dystrophy, Duchenne type DMD inversion Naturally occurring variant yes CanFam3.1 X g.27631972_33069482inv c.-4736051_2384-5339inv XM_005641029.1; "an inversion of a 5.4-Mb fragment of the X chromosome, with one break point (BP1) in the DMD gene . . . and a second break point (BP2) in a gene farther toward the centromere, the RPGR gene". 2015 25644216
708 OMIA:001081-9615 dog Pembroke Welsh Corgi (Dog) Muscular dystrophy, Duchenne type DMD insertion, gross (>20) Naturally occurring variant yes CanFam3.1 X g.27721607_27721608insN[(4800)] "a long interspersed repetitive element-1 (LINE-1) insertion in intron 13, which introduced a new exon containing an in-frame stop codon" 2011 20714321
1492 OMIA:001081-9615 dog Labrador Retriever (Dog) Muscular dystrophy, Duchenne type DMD duplication Naturally occurring variant yes CanFam3.1 X g.27851768_28247504dup Shelton et al. (2022): "chrX:27,851,768-27,852,122 bp position (Intron 7 . . .) and chrX:28,247,150-28,247,504 bp position (Intron 1 . . .)" 2022 36041985
366 OMIA:001081-9615 dog Golden Retriever (Dog) Muscular dystrophy, Duchenne type DMD splicing Naturally occurring variant yes CanFam3.1 X g.27926946T>C c.531-2A>G NM_001003343.1; a point mutation in the consensus splice acceptor site in exon 6 , such that exon 7 is skipped rs1152388423 1992 1577476
1656 OMIA:001081-9685 domestic cat Domestic Shorthair Muscular dystrophy, Duchenne type DMD nonsense (stop-gain) Naturally occurring variant yes F.catus_Fca126_mat1.0 X g.27949145C>T c.4849C>T p.(Q1617*) XM_023249210.1 2024 38180235
1510 OMIA:001081-9685 domestic cat Maine Coon (Cat) Muscular dystrophy, Duchenne type DMD nonsense (stop-gain) Naturally occurring variant yes F.catus_Fca126_mat1.0 X g.28208148G>A c.1180C>T p.(R394*) XM_045050794.1; XP_044906729.1 2022 36359052
1531 OMIA:001888-9685 domestic cat Maine Coon (Cat) Becker muscular dystrophy DMD missense Naturally occurring variant yes F.catus_Fca126_mat1.0 X NC_058386.1:g.27988938G>A XM_045050787.1:c.4186C>T XP_044906722.1:p.(H1396Y) 2023 36834603
1684 OMIA:001888-9685 domestic cat Kinkalow (Cat) Muscular dystrophy, X-linked DMD nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 X NC_018741.3:g.27350268G>A XM_023249210.1:c.8467C>T XP_023104978.1:p.(Q2823*) likely de novo mutation reported in a single cat 2024 38613437
1667 OMIA:001888-9685 domestic cat Domestic Shorthair Muscular dystrophy, X-linked DMD nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 X NC_018741.3:g.27361452C>T XM_023249210.1:c.8333G>A XP_023104978.1:p.(W2778*) F.catus_Fca126_mat1.0 coordinates are g.27110574G>A 2024 38415938
1457 OMIA:001888-9823 pig Becker muscular dystrophy DMD insertion, gross (>20) Naturally occurring variant yes Sscrofa11.1 X Aihara et al. (2022): "Analysis of dystrophin mRNA showed a 62 base pair insertion between exons 26 and 27. The insertion was derived from intron 26." 2022 35220848
179 OMIA:001685-9823 OMIA:001888-9823 pig Stress syndrome DMD missense Naturally occurring variant yes Sscrofa11.1 X g.28309227G>A c.5872C>T p.(R1958W) Ensembl VEP was used to identify cDNA position in transcript ENSSSCT00000089893.1, SIFT score 0.01 rs196952080 2012 22691118
1615 OMIA:001081-9615 dog Brittany Spaniel (Dog) Muscular dystrophy, Duchenne DMD insertion, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 X RSPYR1 retrogene insertion in intron 20; reported in a single dog; reported in a single dog 2023 37628610
1614 OMIA:001081-9615 dog Brittany Spaniel (Dog) Muscular dystrophy, Duchenne DMD nonsense (stop-gain) Naturally occurring variant yes UU_Cfam_GSD_1.0 X g.26939052G>A c.8059C>T p.(Q2687*) NM_001003343.1; NP_001003343.1; reported in 2 related dogs 2023 37628610
1616 OMIA:001081-9615 dog French Bulldog (Dog) Muscular dystrophy, Duchenne DMD insertion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 X g.27774668_27774669insT c.3371_3372insA p.(F1125fs) NM_001003343.1; NP_001003343.1; published as p.(F1125*), reported in a single dog 2023 37628610
908 OMIA:001542-9940 sheep Corriedale (Sheep) Hypophosphatemic rickets, autosomal recessive, 1 DMP1 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.112910614C>T c.433C>T p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1352 OMIA:002442-9823 pig Large White (Pig) Sperm flagella defect DNAH17 deletion, small (<=20) Naturally occurring variant yes Sscrofa11.1 12 g.3556402_3556414del Nosková et al. (2021): "intronic 13-bp deletion ... causes exon skipping which results in the in-frame loss of 89 amino acids from DNAH17" 2021 33724408
1687 OMIA:002847-9615 dog Portuguese Water Dog (Dog) Microphthalmos with hematopoietic defects, congenital DNAJC21 insertion, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 4 NC_049225.1:g.74274883ins[T70]TGCTGCTTGGATT 2024 38682429
39 OMIA:001466-9615 dog Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Labrador Retriever (Dog) Exercise-induced collapse DNM1 missense Naturally occurring variant yes CanFam3.1 9 g.55282762C>A c.767G>T p.(R256L) ROS_Cfam_1.0:g.56204742C>A ENSCAFT00845051951.1:c.767G>T ENSCAFP00845040760.1:p.Arg256Leu rs852832685 2008 18806795 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1434 OMIA:002534-9615 dog Border Collie (Dog) Centronuclear myopathy 1 DNM2 missense Naturally occurring variant yes CanFam3.1 20 g.50423497G>A c.1393C>T p.(R465W) XM_005632882.3; XP_005632939.1. 2022 35244154
125 OMIA:001776-9685 domestic cat Dihydropyrimidinase deficiency DPYS missense Naturally occurring variant yes Felis_catus_9.0 F2 g.52064442C>T c.1303G>A p.(G435R) XM_023248231.1; XP_023103999.1 2012 23430934 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1194 OMIA:002266-9615 dog Rottweiler (Dog) Hyperkeratosis, palmoplantar, DSG1-related DSG1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 7 g.58163636_58163640del c.2541_2545del p.(G848Wfs*2) NM_001002939.1; NP_001002939.1; published as c.2541_2545delGGGCT 2020 32344723
1392 OMIA:002452-9685 domestic cat Domestic Shorthair Hair shaft dysplasia DSG4 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D3 g.55315010del c.76del p.(I26Lfs*4) XM_019815116.1; XP_019670675.1 2022 34878611
1393 OMIA:002452-9685 domestic cat Domestic Shorthair Hair shaft dysplasia DSG4 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D3 g.55336127del c.1777del p.(H593Tfs*23) XM_019815116.1; XP_019670675.1 2022 34878611
1408 OMIA:002243-9913 taurine cattle Highland (Cattle) Ichthyosis, DSP-related DSP missense Naturally occurring variant yes ARS-UCD1.2 23 g.47826600G>T c.6893C>A p.(A2298D) NM_001192368.2; NP_001179297.1 2022 34996433
1115 OMIA:002210-9823 pig Bama Xiang Zhu, China (Pig) Congenital hypothyroidosis DUOX2 missense Naturally occurring variant yes Sscrofa11.1 1 g.126625620A>G c.1226A>G p.(D409G) ENU mutagenesis was used to create these pigs, the mutation is located within an exonic splicing enhancer motif and causes aberrant splicing of DUOX2 transcripts (Cao et al., 2019) 2019 30651277
1056 OMIA:002186-9615 dog Boston Terrier (Dog) Bulldog (Dog) French Bulldog (Dog) Screw tail DVL2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.32195051del c.2051del p.(P684Lfs*26) XM_005619960.3; XP_005620017.1; published as g.32195043_32195044del; c.2044delC and changed to HGVS nomenclature in this table 2018 30521570
711 OMIA:000543-9913 taurine cattle Danish Holstein (Cattle) Anhidrotic ectodermal dysplasia EDA HED6 insertion, gross (>20) Naturally occurring variant yes X "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" 2011 22034998 Allele id was copied from Table 1 of Capuzzello et al. (2022)
645 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED1 deletion, gross (>20) Naturally occurring variant yes X c.397_502del p.(M133Vfs*111) a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised 2001 11591646 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
1120 OMIA:000543-9913 taurine cattle Prim'Holstein, France (Cattle) Generalized hypohidrotic ectodermal dysplasia EDA HED8 inversion Naturally occurring variant yes ARS-UCD1.2 X g.77174882_80737442inv Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" 2019 31533624 Allele id was copied from Table 1 of Capuzzello et al. (2022).
1293 OMIA:000543-9913 taurine cattle Red Angus-Simmental cross Hypohidrotic ectodermal dysplasia EDA HED9 deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 X g.80382423_80435202del GCF_002263795.1 (O'Toole et al., 2021) 2021 33801223 Allele id was copied from Table 1 of Capuzzello et al. (2022).
373 OMIA:000543-9913 taurine cattle Deutsche Holstein Schwarzbunt, Germany (Cattle) Anhidrotic ectodermal dysplasia EDA HED2 splicing Naturally occurring variant yes ARS-UCD1.2 X g.80411671A>C c.924+2T>G c.DNA position is based on NM_001081743.2 2002 12021844 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022)
1295 OMIA:000543-9913 taurine cattle Holstein Friesian (Cattle) Anhidrotic ectodermal dysplasia EDA HED5 splicing Naturally occurring variant yes ARS-UCD1.2 X g.80411795C>A c.802C>A "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) 2011 21740563 Allele id and c. information were copied from Table 1 of Capuzzello et al. (2022)
1294 OMIA:000543-9913 taurine cattle Red Angus-Charolais-Simmental cross Anhidrotic ectodermal dysplasia EDA HED3 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 X g.80415626G>A c.730C>T p.(R244*) 2007 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022).
1484 OMIA:000543-9913 taurine cattle British Blue x Holstein-Friesian cross Anhidrotic ectodermal dysplasia, EDA-related EDA HED10 deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 X g.80516615_80538514del c.397_502del p.(M133Vfs*111) NM_001081743.2; NP_001075212.1 2022 36068608 Allele id was copied from Table 1 of Capuzzello et al. (2022).
586 OMIA:000543-9913 taurine cattle Japanese Black, Japan (Cattle) Anhidrotic ectodermal dysplasia EDA HED7 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 X g.80802800_80802801insCCCT c.280_281insAGGG p.(G94Qfs*49) 2012 22497423 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022).
482 OMIA:000543-9913 taurine cattle Holstein (black and white) (Cattle) Anhidrotic ectodermal dysplasia EDA HED4 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 X g.80803015_80803033del c.48_66del p.(A16S22fs*55) "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." 2011 21410470 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022)
1661 OMIA:000543-9913 taurine cattle Limousin (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA HED11 missense Naturally occurring variant yes ARS-UCD1.3 X g.80411716T>C c.881A>G p.(E294G) NM_001081743.2; NP_001075212.1 rs439722471 2024 38252617
1665 OMIA:000543-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Hypohidrotic ectodermal dysplasia, X-linked EDA missense Naturally occurring variant yes ARS-UCD1.3 X g.80417567C>T c.679G>A p.(G227R) NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 rs1114816375 2023 38275590
1458 OMIA:000543-9615 dog Mixed Breed (Dog) X-linked hypohidrotic ectodermal dysplasia EDA splicing Naturally occurring variant yes CanFam3.1 X r.385_487del p.M129fs*112 NM_001014770.2; NP_001014770.1; EDA transcript lacks 103 nucleotides encoded by exon 2, exon skipping is likely to be caused by an intronic splice variant 2016 27449516
1017 OMIA:000543-9615 dog Dachshund (Dog) X-linked hypohidrotic ectodermal dysplasia EDA deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.54509504del c.842delT p.(L281Hfs*22) 2018 30276836
361 OMIA:000543-9615 dog German Shepherd Dog (Dog) Anhidrotic ectodermal dysplasia EDA splicing Naturally occurring variant yes CanFam3.1 X g.54511433G>A c.910-1G>A NM_001014770.2 rs1152388425 2005 16151697 Genomic coordinates in CanFam3.1 und EVA Id provided by Zoe Shmidt and Robert Kuhn.
724 OMIA:001695-8090 Japanese medaka Reduced scale-3 edar insertion, gross (>20) Naturally occurring variant yes "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" 2001 11516953
843 OMIA:002128-9913 taurine cattle Charolais (Cattle) Anhidrotic ectodermal dysplasia, EDAR-related EDAR insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 11 g.44599876_44599877insC p.(P161Rfs*97) UMD3.1 position is g.44462236_44462237insC 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1474 OMIA:002560-9913 taurine cattle Lidia, Spain (Cattle) Growth and respiratory lethal syndrome EDN2 missense Naturally occurring variant yes ARS-UCD1.2 3 g.104701617G>A c.149G>A p.(C50Y) ENSBTAG00000021434; ENSBTAT00000028571.3 2022 35912509
160 OMIA:000629-9796 horse American Paint (Horse) Miniature Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) Megacolon EDNRB frame overo delins, small (<=20) Naturally occurring variant yes EquCab3.0 17 g.50503041_50503042delinsCT c.353_354delinsAG p.(I118K) NM_001081837.2; NP_001075306.2 1998 9530628
930 OMIA:001765-9940 sheep West African Dwarf (Sheep) Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
1481 OMIA:002564-9615 dog English Springer Spaniel (Dog) Dyserythropoietic anemia and myopathy syndrome (DAMS) EHBP1L1 deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 18 g.52123541delG c.3120delC p.(F1041Sfs*30) XM_038563927.1; XP_038419855.1 2022 36140701
1483 OMIA:002564-9615 dog Labrador Retriever (Dog) Congenital dyserythropoietic anemia and polymyopathy EHBP1L1 nonsense (stop-gain) Naturally occurring variant yes UU_Cfam_GSD_1.0 18 g.52128140G>A c.388C>T p.(R130*) XM_038563927.1; 2022 36011338
1044 OMIA:001805-9615 dog Parson Russell Terrier (Dog) Amelogenesis imperfecta ENAM missense Naturally occurring variant yes CanFam3.1 13 g.59945218C>T c.716C>T p.(P239L) XM_539305.4; XP_539305.3 2019 30877375 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
452 OMIA:001805-9615 dog Italian Greyhound (Dog) Amelogenesis imperfecta ENAM deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.59946493_59946497del c.1991_1995delTTTCC p.(F665Rfs*3) XM_539305.4; XP_539305.3; published as c.1991_1995delTTTCC 2013 23638899 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1454 OMIA:002550-9615 dog Rhodesian Ridgeback (Dog) Early onset adult deafness EPS8L2 deletion, small (<=20) Naturally occurring variant yes UMICH_Zoey_3.1/canFam5 18 g.25868739_25868750del c.1033_1044del p.(V345_L348del) XM_038500406.1; XP_038356334.1; published as 12-bp inframe deletion in EPS8L2 (CFA18:25,868,739-25,868,751 in the UMICH_Zoey_3.1) corresponding to deletion of amino acids VHFL 2022 35385474
191 OMIA:001716-9913 taurine cattle Holstein (black and white) (Cattle) Ehlers-Danlos syndrome, Holstein variant EPYC missense Naturally occurring variant yes ARS-UCD1.2 5 g.20856381C>A c.258G>T p.(S87N) 1999 10357109 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1161 OMIA:000483-9925 goat Polled intersex syndrome ERG PIS complex rearrangement Naturally occurring variant yes 1 "a deletion with a total length of 10 159 bp and an inversely inserted approximately 480 kb-sized duplicated segment of a region located approximately 21 Mb further downstream on chromosome 1 containing two genes, KCNJ15 and ERG" (Simon et al., 2020) 2020 32060960
1169 OMIA:002543-9031 chicken Cleft primary palate ESRP2 deletion, small (<=20) Naturally occurring variant yes GRCg6a 11 g.3284041del ss5200091912 2020 32162363
1439 OMIA:001457-9685 domestic cat Multiple acyl-CoA dehydrogenase deficiency ETFDH missense Naturally occurring variant yes Felis_catus_9.0 B1 g.71374631A>C c.692T>G p.(F231C) NM_001290236.1; NP_001277165.1 2014 24142280 Thanks to Heidi Anderson for alerting OMIA to this paper; 31 March 2022
375 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 splicing Naturally occurring variant yes ARS-UCD1.2 6 g.103594013C>T c.1356C>T Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
617 OMIA:002540-9913 taurine cattle Japanese Brown, Japan (Cattle) Chondrodysplasia EVC2 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 6 g.103609778_103609779delinsG c.2327_2328delinsG p.(A776Gfs*22) Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
534 OMIA:002540-9913 taurine cattle Tiroler Grauvieh (Cattle) Chondrodysplasia EVC2 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 6 g.103651709_103651710del c.2993_2994del p.(D998Efs*13) 2014 24733244 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry.
346 OMIA:002042-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), EXOSC4 EXOSC4 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 14 g.755826G>A c.190G>A p.(R64*) 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1467 OMIA:002554-9685 domestic cat Osteochondromatosis (feline leukemia virus-negative) EXT1 duplication Naturally occurring variant yes F.catus_Fca126_mat1.0 F2 g.61870704dup c.1468dup p.(L490Pfs*31) XM_023248762.2; 2022 35719100
980 OMIA:001214-9615 dog American Staffordshire Terrier (Dog) Osteochondromatosis EXT2 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 18 g.45101754G>T c.924C>A p.(Y308*) XM_014121199.2; XP_013976674.1; published as c.969C>A and p.(Y323*); coordinates in the table have been updated to a recent reference genome and / or transcript 2018 29485212
713 OMIA:000363-9913 taurine cattle Holstein (black and white) (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 insertion, gross (>20) Naturally occurring variant yes 27 a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised 2004 15566468 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
591 OMIA:000363-9913 taurine cattle Japanese Black, Japan (Cattle) Sahiwal (Cattle) Factor XI deficiency F11 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 27 g.16305660delinsATATGTGCAGAATATA c.870delinsATATGTGCAGAATATA P.(F290delinsLYVQNI) 2005 16104386 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
702 OMIA:000363-9615 dog Kerry Blue Terrier (Dog) Factor XI deficiency F11 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 16 g.44477343_44477344ins90 c.819_820ins90 NM_001135123.1 "an insertion of 90 bp (SINE) inside of coding exon 7" resulting in a "30 amino acids insertion in the A3 domain of FXI serine protease" (Tcherneva et al., 2007). 2007 Reference not in PubMed; see OMIA 000363-9615 for reference details g. and c. coordinates kindly provided by Professor Urs Giger (27 August 2022)
1472 OMIA:000363-9685 domestic cat Maine Coon (Cat) Factor XI deficiency F11 missense Naturally occurring variant yes Felis_catus_9.0 B1 g.17176154G>A c.1546G>A p.(V516M) XM_003984601.5; XP_003984650.2 2022 35627175
533 OMIA:000364-9685 domestic cat Factor XII deficiency F12 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A1 g.175381114del c.1321del p.(L441Cfs*119) NM_001168212.2; NP_001161684.2; published as c.1321delC 2015 24793828 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
147 OMIA:000364-9685 domestic cat Domestic Shorthair Factor XII deficiency F12 missense Naturally occurring variant yes Felis_catus_9.0 A1 g.175382065G>C c.1631G>C p.(G544A) NM_001168212.2; NP_001161684.2 2017 28392508 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1532 OMIA:001818-9913 taurine cattle Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) Factor XIII deficiency F13A1 missense Naturally occurring variant yes UMD_3.1.1 23 g.48649432T>C c.248T>C p.(F83S) NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: 1996 Reference not in PubMed; see OMIA 001818-9913 for reference details Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023).
148 OMIA:000361-9783 Asiatic elephant Factor VII deficiency F7 missense Naturally occurring variant yes c.202A>G p.(R68G) 2017 28118558
40 OMIA:000361-9615 dog Airedale Terrier (Dog) Alaskan Klee Kai (Dog) American Foxhound (Dog) Beagle (Dog) Finnish Hound (Dog) German Wirehaired Pointer (Dog) Giant Schnauzer (Dog) Irish Water Spaniel (Dog) Japanese Spitz (Dog) Miniature Schnauzer (Dog) obsolete Alaskan Sled Dog (Dog) Papillon (Dog) Scottish Deerhound (Dog) Sealyham Terrier (Dog) Welsh Springer Spaniel (Dog) Factor VII deficiency F7 missense Naturally occurring variant yes CanFam3.1 22 g.60578895G>A c.407G>A p.(G136E) 2006 16961583 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; variant initially identified in Beagle and later reported in additional breeds: PMID:17939552; PMID: 27525650; PMID:34544496
363 OMIA:000437-9615 dog Irish Setter (Dog) Miniature Schnauzer (Dog) Haemophilia A F8 splicing Naturally occurring variant yes X intronic inversion that results in "aberrant splicing and premature termination" 2002 12008949
1038 OMIA:000437-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Haemophilia A F8 missense Naturally occurring variant yes ARS-UCD1.2 X g.36017426A>T c.134A>T p.(H45L) ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu rs1117392179 2018 29774585
194 OMIA:000437-9913 taurine cattle Japanese Brown, Japan (Cattle) Haemophilia A F8 missense Naturally occurring variant yes ARS-UCD1.2 X g.36145188T>A c.6458T>A p.(L2153H) 2009 19456318 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1655 OMIA:000437-9615 dog Border Collie (Dog) Haemophilia A F8 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.122956942delA c.3206delA NM_001003212.1 2023 38104983
350 OMIA:000437-9615 dog Old English Sheepdog (Dog) Haemophilia A F8 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 X g.122973422G>A c.1786C>T p.(R596*) 2016 27780008 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
100 OMIA:000437-9615 dog German Shepherd Dog (Dog) Haemophilia A F8 missense Naturally occurring variant yes CanFam3.1 X g.122975611C>T c.1700G>A p.(C567Y) NM_001003212.1; NP_001003212.1; published as c.1643G>A & p.(C548Y); coordinates in the table have been updated to a recent reference genome and / or transcript. 2014 25040606
99 OMIA:000437-9615 dog Boxer (Dog) Haemophilia A F8 missense Naturally occurring variant yes CanFam3.1 X g.122981181G>C c.1469C>G p.(P490R) NM_001003212.1; NP_001003212.1; published as c.1412C>G & p.(P471R); coordinates in the table have been updated to a recent reference genome and/ or transcript 2014 25040606
272 OMIA:000437-9615 dog German Shepherd Dog (Dog) Haemophilia A F8 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 X g.123043081C>T c.98G>A p.(W33*) 2011 21949058 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
621 OMIA:000437-9940 sheep Weißes Alpenschaf, Switzerland (Sheep) Haemophilia A F8 delins, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 X g.86301507_86301516delinsTAATTAATACC c.3108_3117delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. 210906 After checking the cDNA sequence in Fig. 3 of the paper, FN concluded that the 10bp deletion starts at c.3108 and ends at c.3117 and that the 11bp inserted sequence is GGTATTAATTA. Thus the HGVS-consistent notation is c.3108_3117delinsGGTATTAATTA, instead of c.3107del10ins11.
1284 OMIA:000437-9615 dog Rhodesian Ridgeback (Dog) Haemophilia A F8 insertion, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 X g.124073876_124073877insN[221] c.4824_4825insN[221] NM_001003212.1; published as c.4824_25ins221, genomic coordinates published as chrX: 1240738676_77. After review of the position in the reference genome on the 17/7/2023 the genomic coordinates have been updated to g.124073876_124073877insN[221] in this table. 2021 33494213
1588 OMIA:000437-9615 dog Labrador Retriever (Dog) Haemophilia A F8 deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 X g.124075777_124075778del c.2923_2924del p.(E975Kfs*8) NM_001003212.1; NP_001003212 2023 37438956
636 OMIA:000438-9615 dog Labrador Retriever (Dog) Haemophilia B F9 deletion, gross (>20) Naturally occurring variant yes X a deletion of the entire gene 1997 9394892
637 OMIA:000438-9615 dog obsolete Pit Bull Terrier (Dog) Haemophilia B F9 deletion, gross (>20) Naturally occurring variant yes X Gu et al. (1999): "A large deletion mutation was found in 1 breed variant, spanning the entire 5' region of the factor IX gene extending to exon 6". 1999 10544912 Following Table 3 from Kuder et al. (2021), the breed for this variant has been changed to Pit Bull Terrier. (18th October 2021)
1039 OMIA:000438-9615 dog Hovawart (Dog) Haemophilia B F9 regulatory Naturally occurring variant yes CanFam3.1 X g.109501492del c.-73del NM_001003323.2; Brenig et al. (2019): NC_006621.3:g.109501492delC; "The deletion is located 73 bp upstream of the F9 start codon in the conserved overlapping DNA binding sites of hepatocyte nuclear factor 4alpha and androgen receptor." 2019 30846504
705 OMIA:000438-9615 dog German Wirehaired Pointer (Dog) Haemophilia B F9 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 X g.109521130_109521131insN[(1500)] NM_001003323.2; published as "insert consists of a 5' truncated canine Line-1 followed by an approximately 200-bp 3' poly (A) tract, flanked by a 15-bp direct repeat"; g. coordinate of insertion obtained from Brenig et al. (2019) 2003 14722728 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
467 OMIA:000438-9615 dog Lhasa Apso (Dog) Haemophilia B F9 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.109521356_109521361delinsT c.548_553delinsT p.(R183Lfs*3) NM_001003323.2; NP_001003323.1; published as "a deletion including nucleotides 772-776 and a C-->T transition at nucleotide 777", coordinates in the table have been updated to a recent reference genome and / or transcript and to HGVS nomenclature 1996 8896410 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
47 OMIA:000438-9615 dog Rhodesian Ridgeback (Dog) Haemophilia B F9 missense Naturally occurring variant yes CanFam3.1 X g.109530868G>A c.731G>A p.(G244E) NM_001003323.2; NP_001003323.1; published as p.(G244E) by Mischke et al. (2011), g. and p. coordinates were copied on the 18th October 2021 from Table 3 of Kuder et al. (2021) (relating to NP_001003323.1 ) as g.109530847G>A and p.(G237E). These g. and p. positions were incorrect. After review of Figure 1 published by Mischke et al. (2011) it was confirmed that the published p. coordinates are consistent with NM_001003323.2:c.731G>A and NP_001003323.1:p.(G244E). The g. coordinates have been updated to a recent reference genome (5th April 2022) 2011 20303304 Thank you to Agustín Arasanz for identifying that the coordinates published by Kuder et al. (2021) were inconsistent with the originally published information by Mischke et al. (2011) (5th April 2022).
1363 OMIA:000438-9615 dog Newfoundland (Dog) Haemophilia B F9 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.109531586_109531587insA c.821_822insA p.(N274Kfs*23) NM_001003323.2; NP_001003323.1 2021 34680886
704 OMIA:000438-9615 dog Airedale Terrier (Dog) Haemophilia B F9 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 X g.109532012_109532013insN[(5000)] c.1247_1248insN[(5000)] NM_001003323.2; Gu et al. (1999): "An approximately 5 kb insertion disrupted exon 8 ... associated with alternative splicing between a donor site 5' and acceptor site 3' to the normal exon 8 splice junction, with introduction of a new stop codon. The resultant transcript lacked most of the factor IX catalytic domain and 3' untranslated region." 1999 10544912 CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021)
46 OMIA:000438-9615 dog Cairn Terrier (Dog) Haemophilia B F9 missense Naturally occurring variant yes CanFam3.1 X g.109532018G>A c.1253G>A p.(G418E) NM_001003323.2; NP_001003323.1, published as p.(G379E) by Evans et al. (1989), coordinates in the table have been updated to a recent reference genome and / or transcript 1989 2481310 c. and p. coordinates updated from Kuder et al. (2021)
127 OMIA:000438-9685 domestic cat Domestic Longhair Haemophilia B F9 missense Naturally occurring variant yes Felis_catus_9.0 X g.117091961G>A c.383G>A p.(C128Y) NM_001009377.3; NP_001009377.1; published as p.(C82Y); coordinates in the table have been updated to a recent reference genome and / or transcript 2005 15822564 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
310 OMIA:000438-9685 domestic cat Haemophilia B F9 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 X g.117111577C>T c.1150C>T p.(R384*) NM_001009377.3; NP_001009377.1; published as p.(R338*); coordinates in the table have been updated to a recent reference genome and / or transcript 2005 15822564 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1360 OMIA:002450-9913 taurine cattle Chianina (Cattle) Ichthyosis congenita FA2H insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 18 g.2205625_2205626insG c.9dupC p.(A4Rfs*142) NM_001192455.1; NP_001179384.1 2021 34599683
752 OMIA:002032-9615 dog Border Collie (Dog) Mixed Breed (Dog) Neuropathy, sensory FAM134B inversion Naturally occurring variant yes CanFam3.1 4 g.80439639_86910352inv "6.47 Mb inversion was identified with breakpoints in intron 3 of FAM134B (chr4:86,910,352) and in an upstream intergenic region (chr4:80,439,639) ... … Analysis of RNAseq data revealed FAM134B was majorly disrupted by the inversion, with novel exons occurring 3′ of the final normally transcribed exon before the inversion, due to cryptic splicing." 2016 27527794
1342 OMIA:002032-9615 dog Mixed Breed (Dog) Neuropathy, sensory FAM134B missense Naturally occurring variant yes CanFam3.1 4 g.86916562C>T c.656C>T p.(P219L) NM_001314111.1; NP_001301040.1 2021 34387380
925 OMIA:001918-9615 dog Tibetan Spaniel (Dog) Tibetan Terrier (Dog) Progressive retinal atrophy, type 3, FAM161A-related FAM161A insertion, gross (>20) Naturally occurring variant yes CanFam3.1 10 g.61822372_61822373insN[(230)] A ~230bp insertion containing a 132bp short interspersed nuclear element (SINE), near the splice acceptor site of exon 5 CanFam2.0 coordinate published as g.64974130 2014 24705771
1183 OMIA:002259-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire FAM189A1 missense Naturally occurring variant yes ARS-UCD1.2 21 g.28112913T>C p.(N192S) Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. 2017 28904385
102 OMIA:002015-9615 dog Border Collie (Dog) Dental hypomineralization FAM20C missense Naturally occurring variant yes CanFam3.1 6 g.16452327G>A c.899C>T p.(A300V) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
89 OMIA:001327-9615 dog Irish Terrier (Dog) Kromfohrlander (Dog) Hyperkeratosis, palmoplantar FAM83G missense Naturally occurring variant yes CanFam3.1 5 g.41055619G>C c.155G>C p.(R52P) 2014 24832243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1511 OMIA:002600-9986 rabbit New Zealand White (Rabbit) Amelogenesis imperfecta FAM83H deletion, gross (>20) Genome-editing (CRISPR-Cas9) yes large deletion of more then 900bp in exon 5 2022 36300761
460 OMIA:001683-9615 dog Cavalier King Charles Spaniel (Dog) Congenital keratoconjunctivitis sicca and ichthyosiform dermatosis FAM83H deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.37328057del c.977del p.(P326Hfs*258) NM_001289427.1; NP_001276356.1; genomic position in accordance with HGVS 3'-rule 2012 22253609 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
683 OMIA:002683-9615 dog Basenji (Dog) Fanconi syndrome FAN1 deletion, gross (>20) Naturally occurring variant yes 3 "317 bp of exon 14 were deleted starting at the second exon14 nucleotide and extending into the 3' untranslated region of FAN1" 2011 Reference not in PubMed; see OMIA 002683-9615 for reference details
646 OMIA:000151-9913 taurine cattle Holstein (black and white) (Cattle) Brachyspina FANCI deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 21 g.20773899_20777226del p.(V877Lfs*27) 2012 22952632 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
613 OMIA:002064-9685 domestic cat British Shorthair (Cat) Autoimmune lymphoproliferative syndrome FASLG duplication Naturally occurring variant yes Felis_catus_9.0 F1 g.16871916dup c.418dup p.(R140Kfs*37) NM_001009352.1; NP_001009352.1; published as c.413_414insA "insertion of an adenine at position 14,607,400 [Felis_Catus_6.2]" (Aberdein et al., 2017); changed in this table to a recent reference genome and HGVS nomenclature 2017 27770190
201 OMIA:000628-9913 taurine cattle Limousin (Cattle) Marfan syndrome FBN1 missense Naturally occurring variant yes ARS-UCD1.2 10 g.61831200G>A c.3598G>A p.(E1200K) 2005 15776436 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
377 OMIA:000628-9913 taurine cattle Japanese Black, Japan (Cattle) Marfan syndrome FBN1 splicing Naturally occurring variant yes ARS-UCD1.2 10 g.61917867G>A c.8227-1G>A 2012 22221020 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1402 OMIA:000628-9823 pig Marfan syndrome FBN1 deletion, small (<=20) Genome-editing (ZFN) yes Sscrofa11.1 1 g.123246159del p.(E433Nfs98*) 2016 27074716
910 OMIA:000836-9913 taurine cattle Blonde d'Aquitaine (Cattle) Limousin (Cattle) Protoporphyria FECH extension (stop-lost) Naturally occurring variant yes ARS-UCD1.2 24 g.56787697C>A c.1250G>T p.(*417Lext*27) 1998 9784594 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
576 OMIA:001525-9615 dog German Shepherd Dog (Dog) Leukocyte adhesion deficiency, type III FERMT3 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 18 g.52835932_52835933insGGCAGCCGTCTT c.1349_1350insAAGACGGCTGCC p.(L450_A451insRRLP) XM_038425194.1; XP_038281122.1; 12-base pair insertion 2010 20126836
1336 OMIA:002382-9615 dog Dachshund, Miniature Wire-Haired (Dog) Afibrinogenaemia FGA deletion, small (<=20) Naturally occurring variant yes CanFam3.1 15 g.52240694del c.1665delT p.(I555Mfs*33) Transcript XM_532697.6 / ENSCAFT00000043702.3 rs1152388481 2021 34356081
1529 OMIA:002625-9913 taurine cattle Japanese Black, Japan (Cattle) Skeletal dysplasia, FGD3 related FGD3 delins, small (<=20) Naturally occurring variant yes UMD_3.1.1 8 g.85826989_85826990delinsTG p.(H171C) 2015 26306008
1326 OMIA:002374-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Charcot Marie Tooth disease FGD4 splicing Naturally occurring variant yes ARS-UCD1.2 5 g.77262490C>T c.1671+1G>A Splice donor mutation based on XM_005206883.3 2021 34045765
941 OMIA:001723-9940 sheep Romney Marsh (Sheep) Familial episodic ataxia FGF14 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 10 g.88095843G>A c.46C>T p.(Q16*) Oar_v3.1 position is g.77593415 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
327 OMIA:000889-9031 chicken Israeli experimental line, Israel (Chicken) Storrs Connecticut scaleless low line, United States of America (Chicken) UC Davis line, United States of America (Chicken) Scaleless FGF20 nonsense (stop-gain) Naturally occurring variant yes GRCg6a 4 g.63270401A>T c.535A>T p.(R179*) 2012 22712610 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
929 OMIA:000272-9615 dog Rhodesian Ridgeback (Dog) Thai Ridgeback (Dog) Ridge & dermoid sinus FGF3 Ridge allele duplication Naturally occurring variant yes CanFam3.1 18 g.48372578_48505893dup133316 A large ~133,000 bp duplication on chromosome 18, encompassing three FGF genes (FGF3, FGF4, FGF19) and another gene ORAOV1. There is an additional single T inserted between the two copies of the duplication. This is not indicated in the genomic variant designation. 2007 17906623
855 OMIA:000157-9615 dog American Cocker Spaniel (Dog) Basset Hound (Dog) Beagle (Dog) Cardigan Welsh Corgi (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Coton de Tulear (Dog) Dachshund (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) Nova Scotia Duck Tolling Retriever (Dog) Intervertebral disc disease, type I FGF4 retrogene in CFA12 FGF4L2 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until it can be standardised 2017 29073074
853 OMIA:002133-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Skeletal dysplasia, FGF4-retrogene-related FGF4 retrogene on CFA12 FGF4L2 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until can be standardised 2017 29073074
559 OMIA:000439-10036 golden hamster Hair, long Fgf5 deletion, small (<=20) Naturally occurring variant no c.546delG p.(R184GfsX6) 2015 26481120
787 OMIA:002090-9913 taurine cattle Holstein (black and white) (Cattle) Facial dysplasia syndrome FGFR2 missense Naturally occurring variant yes ARS-UCD1.2 26 g.41489034C>A c.927G>T p.(W309C) 2017 28768473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1179 OMIA:001703-9913 taurine cattle Holstein (black and white) (Cattle) Chondrodysplasia, disproportionate FGFR3 extension (stop-lost) Naturally occurring variant yes ARS-UCD1.2 6 g.116767863C>A c.2408G>T p.(*803Lext*93) NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) 2020 32239744
225 OMIA:001703-9940 sheep Suffolk (Sheep) Chondrodysplasia, Spider lamb FGFR3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 6 g.128784747A>T c.1719T>A p.(V700E) 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
77 OMIA:001335-9615 dog German Shepherd Dog (Dog) Renal cystadenocarcinoma and nodular dermatofibrosis FLCN missense Naturally occurring variant yes CanFam3.1 5 g.42186445A>G c.764A>G p.(H255R) rs1152388411 2003 14532326 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
860 OMIA:001360-9031 chicken Beijing You, China (Chicken) Commercial strain- layer- ISA Brown (Chicken) Commercial strain- layer- Lohmann Brown (Chicken) Marans (Chicken) Rhode Island Red (Chicken) TETRA strain, United States of America (Chicken) Transylvanian Naked Neck (Chicken) Trimethylaminuria (fishy taint) FMO3 missense Naturally occurring variant yes 8 c.1034A>T p.(T329S) 2005 15916878
304 OMIA:001360-9913 taurine cattle Swedish Red and White (Cattle) Trimethylaminuria (fishy taint) FMO3 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 16 g.38666821C>T c.712C>T p.(R238*) rs797790546 2002 12466292 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
531 OMIA:000526-9615 dog Weimaraner (Dog) Hypomyelination of the central nervous system FNIP2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 15 g.55928287del c.1078del p.(I360Lfs*3) XM_005629382.3; XP_005629439.1; published as CanFam2:58974928delA, XM_532705:c.880delA and p.(I294fs*296) - coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature 2014 24272703
571 OMIA:000323-9615 dog Chinese Crested (Dog) Peruvian Hairless Dog (Dog) Xoloitzcuintli (Dog) Ectodermal dysplasia FOXI3 insertion, small (<=20) Naturally occurring variant yes ROS_Cfam_1.0 17 g.38764875_38764881dup c.57_63dup p.(A23Rfs*219) NM_001135646.1; NP_001129118.1 2008 18787161
1319 OMIA:001949-9685 domestic cat Birman (Cat) Hypotrichosis, with short life expectancy FOXN1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 E1 g.18255880_18255883del c.1030_1033del p.L344Gfs XM_019817475.2; XP_019673034.1; published as c.1030_1033delCTGT; predicted to cause a frameshift leading to a premature stop codon at position 547 2015 25781316 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
461 OMIA:000396-9615 dog English Springer Spaniel (Dog) Fucosidosis, alpha FUCA1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.75665866_75665879del c.379_392del p.(A127Vfs*26) NM_001003250.1; NP_001003250.1; a 14-bp deletion at the 3' end of exon 1 1996 8730282
178 OMIA:000862-9823 pig Resistance to oedema disease (F18 receptor) FUT1 missense Naturally occurring variant no Sscrofa11.1 6 g.54079560T>C c.304A>G p.(T103A) The variant was initially described as c.307G>A and p.A103T by Vögeli et al. 1997. VEP analysis identified the variant as c.304A>G p.T102A in transcript ENSSSCT00000051297.2 rs335979375 2000 11132149
1436 OMIA:002536-9615 dog Wirehaired Pointing Griffon (Dog) Juvenile cataract FYCO1 deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 20 g.42952995del c.2024delG p.(S675Tfs*5) XM_038566669.1; XP_038422597.1 2022 35205377
1361 OMIA:000418-9615 dog German Pinscher (Dog) Glycogen storage disease Ia G6PC insertion, gross (>20) Naturally occurring variant yes CanFam3.1 9 g.20134857_20134858insN[76] c.634_635insN[76] XM_038676372.1; insertion of 60 consecutive adenines and an additional 16 bp duplication of the integration site (Christen et al., 2021) 2021 34610166
44 OMIA:000418-9615 dog Maltese (Dog) Glycogen storage disease Ia G6PC missense Naturally occurring variant yes CanFam3.1 9 g.20138777C>G c.363G>C p.(M121I) NM_001002993.2; NP_001002993.2; published as c.450G>C; coordinates in the table have been updated to a recent reference genome and / or transcript 1997 9259982 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
488 OMIA:000419-9913 taurine cattle Shorthorn (Cattle) Glycogen storage disease II GAA E18 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.52484973_52484974del c.2454_2455del p.(T819R) 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
294 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Glycogen storage disease II GAA E13 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 19 g.52488949G>A c1783C>T p.(R595*) UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. 2000 10723725 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
487 OMIA:000419-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) Glycogen storage disease II GAA E7 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.52492405_52492406del c.1057_1058del p.(Y353L) UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
270 OMIA:000419-9615 dog Finnish Lapphund (Dog) Swedish Lapphund (Dog) Glycogen storage disease II GAA nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 9 g.1603730C>T c.2237G>A p.(W746*) 2013 23457621 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1544 OMIA:000419-9685 domestic cat Domestic Shorthair Glycogen Storage Disease Type II (Pompe Disease) GAA missense Naturally occurring variant yes Felis_catus_9.0 E1 g.60946737G>A c.1799G>A p.(R600H) XM_006940651.4; XP_006940713.4 2023 37106898 The OMIA curators thank Osamu Yamato for providing the variant information not included in Rakib et al. (2023); 17 April 2023.
517 OMIA:000578-9544 Rhesus monkey Krabbe disease GALC deletion, small (<=20) Naturally occurring variant yes c.387delAC 1997 9192853
953 OMIA:000578-9615 dog Irish Setter (Dog) Krabbe disease GALC insertion, gross (>20) Naturally occurring variant yes CanFam3.1 8 g.59294611_59294612insN[78] c.790_791insN[78] NM_001003238.1; NP_001003238.1; the 78 bp insertion includes a 16-bp insertion site duplication and a 62 bp U4 snRNA-derived sequence; the downstream reading frame is preserved (for sequence details see McGraw et al., 2006) 2006 16490723
51 OMIA:000578-9615 dog Cairn Terrier (Dog) West Highland White Terrier (Dog) Krabbe disease GALC missense Naturally occurring variant yes CanFam3.1 8 g.59311801T>G c.473A>C p.(Y158S) NM_001003238.1; NP_001003238.1 1996 8661004 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1607 OMIA:000578-9615 dog Mixed Breed (Dog) Krabbe disease GALC missense Naturally occurring variant yes Dog10K_Boxer_Tasha 8 g.58893972G>A c.149C>T p.(A50V) NM_001003238.1; NP_001003238.1; published as NC_006590.4:g.58893972G>A 2023 37593836
1327 OMIA:002375-9913 taurine cattle Holstein Friesian (Cattle) Jersey (Cattle) Congenital disorder of glycosylation GALNT2 splicing Naturally occurring variant yes ARS-UCD1.2 28 g.2281801G>A c.1561-1G>A Splice acceptor mutation based on NM_001193103.1. 2021 34045765
182 OMIA:001826-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH4 GART missense Naturally occurring variant yes ARS-UCD1.2 1 g.1997582A>C c.869A>C p.(N290T) rs465495560 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1501 OMIA:002559-9913 taurine cattle Holstein Friesian (Cattle) Persistent truncus arteriosus GATA6 nonsense (stop-gain) Naturally occurring variant unknown ARS-UCD1.2 24 g.34187181T>A c.1249A>T p.K417X ENSBTAT00000007537.6 2022 36333145
231 OMIA:002621-9940 sheep South Down (Sheep) Gaucher disease, type GBA missense Naturally occurring variant yes Oar_rambouillet_v1.0 1 g.111561271C>T c.1142G>A p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
322 OMIA:000420-9796 horse American Paint (Horse) Quarter Horse (Horse) Glycogen storage disease IV GBE1 nonsense (stop-gain) Naturally occurring variant yes EquCab3.0 26 g.8667651C>A c.102C>A p.(Y34*) NM_001081940.2; NP_001075409.1 rs3437568674 2004 15366377 The genomic position in EquCab3.0 was provided by Elizabeth Clark, working under the guidance of Professor Ernie Bailey in April 2022
742 OMIA:000420-9685 domestic cat Norwegian Forest Cat (Cat) Glycogen storage disease IV GBE1 delins, gross (>20) Naturally occurring variant yes Felis_catus_9.0 C2 g.34744479_34781895delinsN[334] published as "334 bp insertion at the site of a 6.2 kb deletion that extends from intron 11 to intron 12 (g. IVS11+1552_IVS12-1339 del6.2kb ins334 bp), removing exon 12" 2007 17257876 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley.
744 OMIA:001245-9031 chicken Rhode Island Red (Chicken) Retinal degeneration I GC1 complex rearrangement Naturally occurring variant yes 26 This allele is characterised by an 81bp insertion adjacent to a 642bp deletion 1998 9448321
1494 OMIA:002579-9913 taurine cattle Irish Moiled (Cattle) Perinatal mortality syndrome, GCK-related GCK splicing Naturally occurring variant yes ARS-UCD1.2 4 g.77173487A>T 2022 36105082
721 OMIA:000701-9031 chicken Naked neck GDF7 insertion, gross (>20) Naturally occurring variant yes 3 a large insertion approximately 260kb downstream from the BMP12 gene (now known as GFD7), increasing the expression of this gene in embryonic skin 2011 21423653
1221 OMIA:002366-9685 domestic cat Toyger (Cat) Holoprosencephaly GDF7 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A3 g.127002233_127002239del c.221_227del p.(R74Pfs*17) XM_023252074.1; XP_023107842.1; published as "a 7 bp deletion in the coding region of GDF7 (c.221_227delGCCGCGC [p.Arg74Profs*17]) at the position A3:127002233 (ENSFCAT00000063603)" (Yu et al., 2020) 2020 32575532
444 OMIA:001514-9615 dog English Pointer (Dog) English Springer Spaniel (Dog) French Spaniel (Dog) German Shorthaired Pointer (Dog) Acral mutilation syndrome GDNF regulatory Naturally occurring variant yes CanFam3.1 4 g.70875561C>T "This variant, located 90 kb upstream of the GDNF gene, a highly relevant neurotrophic factor candidate gene, lies in [the last exon of] a long intergenic non-coding RNAs (lincRNA), GDNF-AS." 2016 28033318
114 OMIA:001208-9615 dog Labrador Retriever (Dog) Alexander disease GFAP missense Naturally occurring variant yes CanFam3.1 9 g.18572769G>A c.719G>A p.(R240H) rs850986067 2016 26486469 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
293 OMIA:001442-9913 taurine cattle Japanese Black, Japan (Cattle) Forelimb-girdle muscular anomaly GFRA1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 26 g.36627244G>A c.430C>T p.(Q144*) 2013 Reference not in PubMed; see OMIA 001442-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
190 OMIA:001473-9915 indicine cattle (zebu) Brahman (Cattle) Dwarfism, growth-hormone deficiency GH1 missense Naturally occurring variant yes c.641C>T p.(T200M) Bos indicus cDNA position based on AF034386, protein position based on AAB92549 2009 19524387 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1232 OMIA:001473-9615 dog Chihuahua (Dog) Dwarfism, growth-hormone deficiency GH1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.11832438_11832443del c.573_578del p.(K191_D193delinsN) NM_001003168.1; NP_001003168.1; variant initially identified in Chihuahuas and later reported in additional breeds: PMID: 37582787 2020 32646299 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
660 OMIA:000309-9031 chicken Connecticut (CT) strain, United States of America (Chicken) S2 line, China (Chicken) Dwarfism, sex-linked GHR deletion, gross (>20) Naturally occurring variant yes Z deletion of 1773 bp in the 3' end of the coding region of the growth hormone receptor gene 1994 7964293
677 OMIA:001920-27706 largemouth bass Abortion due to deletion in GHRH GHRH deletion, gross (>20) Naturally occurring variant yes a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal 2014 24697798
794 OMIA:002119-9615 dog Leonberger (Dog) Polyneuropathy (LPN2) GJA9 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 15 g.3863524_3863525del c.1107_1108delAG p.(A370Nfs*12) 2017 28841859
41 OMIA:000402-9615 dog Portuguese Water Dog (Dog) Gangliosidosis, GM1 GLB1 missense Naturally occurring variant yes CanFam3.1 23 g.3754313G>A c.179G>A p.(R60H) NM_001037641.1; NP_001032730.1; published as c.200G>A; coordinates in the table have been updated to a recent reference genome and / or transcript 2000 11032334
462 OMIA:000402-9615 dog obsolete Shiba (Dog) Shiba Inu (Dog) Gangliosidosis, GM1 GLB1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 23 g.3796317delC c.1649delC p.(P550Rfs*50) 2002 12555949 The variant coordinates are those reported by Pervin et al. (2022) Animals 12(10), 1242.
573 OMIA:000402-9615 dog Alaskan Husky (Dog) Gangliosidosis, GM1 GLB1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 23 g.3796356_3796374dup c.1688_1706dup p.(T570Pfs*22) NM_001037641.1; NP_001032730.1; 19 base pair duplication in exon 15. Two different aberrant mRNA transcripts are produced from the mutant allele. The protein variant designation refers to one of these transcripts that includes the mutant exon 15. In the other aberrant transcript, the mutant exon 15 is skipped and a different truncated protein is encoded. 2005 15944348
126 OMIA:000402-9685 domestic cat Korat (Cat) Siamese (Cat) Gangliosidosis, GM1 GLB1 missense Naturally occurring variant yes Felis_catus_9.0 C2 g.158932167C>G c.1448G>C p.(R483P) 2008 18353697 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
230 OMIA:000402-9940 sheep Romney Marsh (Sheep) Gangliosidosis, GM1 GLB1 missense Naturally occurring variant yes Oar_rambouillet_v1.0 19 g.8003247C>A c.686G>T p.(C299F) cDNA position based on ENSOART00020038844.1 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
302 OMIA:000689-9913 taurine cattle Polled Hereford (Cattle) Myoclonus GLRA1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 7 g.63070074G>T c.156C>A p.(Y52*) 2001 11178872 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1571 OMIA:000689-9615 dog Miniature Australian Shepherd Dog (Dog) Hyperekplexia GLRA1 deletion, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 4 g.58338954_58338989del published as a 36-bp deletion encompassing part of the intron 1 and exon 2 (chr4:g.58,338,953); coordinates in the this table are in accordance with HGVS nomenclature 2023 37222814
496 OMIA:001427-9685 domestic cat Gangliosidosis, GM2, GM2A deficiency GM2A deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A1 g.198114664_198114667del c.516_519del p.(V173Sfs*17) XM_003981379.5; XP_003981428.2; published as c.516_519delGGTC 2005 16200419 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
515 OMIA:001368-9031 chicken Retinopathy globe enlarged GNB3 deletion, small (<=20) Naturally occurring variant yes 1 c.D153del 2006 17065478
1035 OMIA:001248-9685 domestic cat Domestic Shorthair Mucolipidosis II GNPTAB nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 B4 g.124431151G>A c.2644C>T p.(Q882*) XM_003989173.5; XP_003989222.2 2018 30591066 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
265 OMIA:000665-9925 goat Mucopolysaccharidosis IIID GNS nonsense (stop-gain) Naturally occurring variant yes ARS1 5 g.48406875C>T c.304C>T p.(R102*) 1995 7623459 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. Published as c.322C>T. Updated position based on ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000018630.1
778 OMIA:001985-9913 taurine cattle Simmental (Cattle) Dwarfism, Fleckvieh GON4L deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 3 g.15024245del c.4286del p.(G1430Kfs*66) rs723240647 2016 27036302 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 210909: to be consistent with HGVS, FN changed g.15079217delC to g.15079217del. An examination of the information for rs723240647 indicated that c.4285_4287delCCCinsCC should be changed to c.4286del
1097 OMIA:002207-9615 dog Cocker Spaniel (Dog) Bernard-Soulier syndrome, type C GP9 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 20 g.3025814_3028273del c.127_*2052del XM_846924.3; Gentilini et al. (2019): "The [2460bp] deletion truncates 104 (71%) of the 146 codons of the wildtype canine reading frame." 2019 31484196
383 OMIA:000821-9685 domestic cat Primary hyperoxaluria type II (Oxalosis II) GRHPR splicing Naturally occurring variant yes Felis_catus_9.0 D4 g.60968927G>A p.(N169Kfs*46) "point mutation, G to A, . . . at the 3# splice acceptor site of intron 4" ; protein position based on XP_006939354.1 2009 Reference not in PubMed; see OMIA 000821-9685 for reference details
693 OMIA:000078-9615 dog Coton de Tulear (Dog) Ataxia, cerebellar GRM1 insertion, gross (>20) Naturally occurring variant yes 1 "a 62-bp truncated retrotransposon insert in exon 8" 2011 21281350
1552 OMIA:002692-9796 horse American Saddle Horse (Horse) American Trotter (Horse) Miniature Horse (Horse) Missouri Fox Trotting Horse, United States of America (Horse) Morgan (Horse) Quarter Horse (Horse) Racking Horse (Horse) Rocky Mountain, United States of America (Horse) Spotted Saddle Horse (Horse) Tennessee Walking Horse (Horse) Night blindness, congenital stationary, GRM6-related GRM6 missense Naturally occurring variant yes EquCab3.0 14 g.2655618C>T c.533C>T p.(T178M) XM_001916934.4; XP_001916969.3; variant initially reported in Tennessee Walking horse and later reported in other breeds [PMID:37815029] rs1138010744 2021 32654228
1536 OMIA:002646-9615 dog German Spitz (Dog) Progressive retinal atrophy GUCY2D insertion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.32849537_32849538insT c.1598_1599insT p.(S534Efs*20) NM_001003207.1; NP_001003207.1 2023 36872573
1195 OMIA:002268-9823 pig Danish Landrace (Pig) Vitamin C deficiency GULO od deletion, gross (>20) Naturally occurring variant yes 14 "This deletion includes 77 bp of exon VIII, 398 bp of intron 7 and 3.7 kbp of intron 8, which leads to a frame shift. The mutant protein is truncated to 356 amino acids, but only the first 236 amino acids are identical to the wild-type GULO protein." (Hasan et al., 2004) 2004 15112110
58 OMIA:000667-9615 dog Brazilian Terrier (Dog) Mucopolysaccharidosis VII GUSB missense Naturally occurring variant yes CanFam3.1 6 g.740428G>A c.866C>T p.(P289L) 2012 22815736 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
57 OMIA:000667-9615 dog German Shepherd Dog (Dog) Mucopolysaccharidosis VII GUSB missense Naturally occurring variant yes CanFam3.1 6 g.741429C>T c.497G>A p.(R166H) ROS_Cfam_1.0:g.546709C>T ENSCAFT00845023689.1:c.482G>A ENSCAFP00845018598.1:p.Arg161His rs1152388412 1998 9521879 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
133 OMIA:000667-9685 domestic cat Mucopolysaccharidosis VII GUSB missense Naturally occurring variant yes Felis_catus_9.0 E3 g.16120173G>A c.1051G>A p.(E351K) NM_001009310.1; NP_001009310.1; published as "single G-to-A transition at nucleotide position 1074, predicting a glutamate-to-lysine substitution of amino acid residue 351 (E351K)" 1999 10366443 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
139 OMIA:000667-9685 domestic cat Mucopolysaccharidosis VII GUSB missense Naturally occurring variant yes Felis_catus_9.0 E3 g.[16123229T>G;16123232C>T] c.[1423T>G;1426C>T] p.(S475_R476delinsAW) NM_001009310.1; NP_001009310.1; published as c.1421T>G and c.1424C>T; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 26118695 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
163 OMIA:001158-9796 horse American Paint (Horse) Appaloosa (Horse) Quarter Horse (Horse) Polysaccharide storage myopathy/Exertional rhabdomyolysis GYS1 missense Naturally occurring variant yes EquCab3.0 10 g.19203501C>T c.926G>A p.(R309H) ENSECAT00000023453.3:c.926G>A ENSECAP00000019426.2:p.Arg309His rs1150416011 2008 18358695 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
924 OMIA:001374-9615 dog Labrador Retriever (Dog) Centronuclear myopathy, HACD1-related HACD1 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 2 g.19371988_19371989ins[N[236];CACACAAAGGTTT] c.203_204ins[N[236];CACACAAAGGTTT] NM_001025269.1; published as insertion of a 236 bp antisense canine tRNA-like SINE (EMBL accession no. AJ876906), flanked on both sides by a 13 bp direct duplication of the insertion site; resulting in multiple splicing defects 2005 15829503
1421 OMIA:002522-9615 dog Norwegian Elkhound (Dog) Ataxia, HACE1-related HACE1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 12 g.62282767del c.1001del p.(G334Vfs*34) ENSCAFT00000072236.1; ENSCAFP00000049888.1 2022 35061740
709 OMIA:001561-9615 dog Chinese Shar-Pei (Dog) Periodic Fever Syndrome HAS2 insertion, gross (>20) Naturally occurring variant yes 13 "several copies of a the "meatmouth" (CNV-E) duplication upstream of the HAS2 gene", variant is associated with the disease but may not be causal 2011 21437276
64 OMIA:000703-9615 dog Dachshund (Dog) Narcolepsy HCRTR2 missense Naturally occurring variant yes CanFam3.1 12 g.22517939G>A c.160G>A p.(E54K) NM_001002933.1; NP_001002933.1 2001 11282968 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
419 OMIA:000703-9615 dog Doberman Pinscher (Dog) Narcolepsy HCRTR2 splicing Naturally occurring variant yes CanFam3.1 12 g.22603767_22603768insN[226] c.647-36_647-35insN[226] NM_001002933.1; a 226 bp SINE insertion in intron 3 of the HCRTR2 gene leads to skipping of exon 4 1999 10458611
368 OMIA:000703-9615 dog Labrador Retriever (Dog) Narcolepsy HCRTR2 splicing Naturally occurring variant yes CanFam3.1 12 g.22620881G>A c.1105+5G>A NM_001002933.1; NP_001002933.1; experimentally confirmed splice defect; skipping of exon 6 in the HCRTR2 mRNA transcript due to a G to A transition at position +5 in the 5′-splice site of intron 6 1999 10458611
296 OMIA:002230-9913 taurine cattle Belted Galloway (Cattle) Brown Swiss (Cattle) Hypotrichosis HEPHL1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 29 g.721234T>A c.1684A>T p.(K562*) NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 2021 33926013
535 OMIA:001944-9615 dog Miniature Schnauzer (Dog) Spondylocostal dysostosis, autosomal recessive HES7 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.32945846del c.126delG p.(T43Pfs*24) 2015 25659135
145 OMIA:001987-9685 domestic cat Japanese domestic Bobtail HES7 JBT missense Naturally occurring variant yes Felis_catus_9.0 E1 g.2918735A>G c.5A>G p.(V2A) XM_003996191.4:c.5T>C; Felis_catus_6.2: g.2819475A>G 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
1178 OMIA:001461-9217 American flamingo Tay-Sachs disease HEXA missense Naturally occurring variant yes c.1406C>T p.(P469L) 2008 18693054
26 OMIA:001461-9615 dog Japanese Chin (Dog) Gangliosidosis, GM2, type I HEXA missense Naturally occurring variant yes CanFam3.1 30 g.35841247C>T c.967G>A p.(E323K) 2013 23266199 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
387 OMIA:001461-9940 sheep Jacob (Sheep) Gangliosidosis, GM2, type I (B variant) HEXA splicing Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.20584348C>G c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1318 OMIA:001461-9823 pig Wild boar Gangliosidosis, GM2, type I HEXA missense Naturally occurring variant yes Sscrofa11.1 7 g.60910365C>T c.1495C>T p.(R499C) cDNA positions based on NM_001123221.1 2021 34119419
463 OMIA:001462-9615 dog Poodle, Toy (Dog) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.57225684del c.391del p.(V131*) XM_022414769.1; XP_022270477.1; published as c.283delG and p.(V59fs); coordinates in the table have been updated to a recent reference genome and / or transcript 2012 22766310
798 OMIA:001462-9615 dog Shiba Inu (Dog) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.57243656_57243658del c.849_851del p.(L284del) XM_022414769.1; XP_022270477.1; published by Kolicheski et al. (2017) as p.Leu317del and reported by Wang et al. (2018) as p.(L207del) 2017 28833537
497 OMIA:001462-9685 domestic cat Korat (Cat) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A1 g.141540010del c.39del p.(L14Sfs*82) NM_001009333.2; NP_001009333.2; published as c.39delC 1994 8178934 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
309 OMIA:001462-9685 domestic cat Japanese domestic Gangliosidosis, GM2, type II (Sandoff or variant 0) HEXB nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 A1 g.141565348C>T c.667C>T p.(R223*) NM_001009333.2; NP_001009333.2 2007 16872651 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
381 OMIA:001462-9685 domestic cat Burmese (Cat) Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB splicing Naturally occurring variant yes Felis_catus_9.0 A1 g.141571030_141571044del c.1244-8_1250del NM_001009333.2 2009 19231264 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
741 OMIA:001462-9685 domestic cat Domestic Shorthair Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB inversion Naturally occurring variant yes Felis_catus_9.0 A1 g.141571788_141571812inv c.1467_1491inv p.(F489Lfs*4) NM_001009333.2; NP_001009333.2 2004 15081585 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1584 OMIA:001243-9601 Sumatran orangutan Alkaptonuria HGD missense Naturally occurring variant yes Susiae_PABv2/ponAbe3 3 g.17314095G>A c.1081G>A p.(G361R) 2023 37354891
1170 OMIA:001311-9615 dog Miniature Schnauzer (Dog) Progressive retinal atrophy, Miniature Schnauzer, type 1 HIVEP3 probably not causal, can be used as linked marker for genetic testing not known Naturally occurring variant unknown CanFam3.1 15 g.1432293G>A "intronic variant in HIVEP3/ENSCAFG00000035604" (Kaukonen et al., 2020). The genetic evidence is unable to distinguish between the HIVEP3 and PPT1 variants as potential causes of PRA. ... functional considerations favor causality of the coding PPT1 structural variant over the intronic HIVEP3 SNV" (Aguirre et al. 2020). 2020 32150541
596 OMIA:001493-9685 domestic cat Siamese (Cat) Porphyria, acute intermittent HMBS insertion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 16541468dup c.189dup p.(L64Sfs*2) NM_001177808.1; NP_001171279.1; published as c.189dupT 2010 19934113 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
530 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 g.16540928_16540931del c.107_110del p.(D36Vfs*6) NM_001177808.1; NP_001171279.1; published as c.107_110delACAG 2013 24239138 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
135 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS missense Naturally occurring variant yes Felis_catus_9.0 D1 g.16541614G>A c.250G>A p.(A84T) NM_001177808.1; NP_001171279.1 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
136 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS missense Naturally occurring variant yes Felis_catus_9.0 D1 g.16542541C>T c.445C>T p.(R149W) NM_001177808.1; NP_001171279.1 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
402 OMIA:001493-9685 domestic cat Porphyria, acute intermittent HMBS splicing Naturally occurring variant yes Felis_catus_9.0 D1 g.16544575G>A c.826-1G>A NM_001177808.1 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
501 OMIA:001493-9685 domestic cat Siamese (Cat) Porphyria, acute intermittent HMBS deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 g.16544592_16544594del c.842_844del p.(G281del) NM_001177808.1; NP_001171279.1; published as c.842_844delGAG 2013 24239138 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
689 OMIA:000299-9986 rabbit Dwarf, long-haired Holland Lop (Rabbit) Netherland dwarf (Rabbit) Dwarfism HMGA2 dw deletion, gross (>20) Naturally occurring variant yes 4 "that the dwarf allele constitutes a ~12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene." 2017 27986804
727 OMIA:000317-9913 taurine cattle Highland (Cattle) Ears, crop HMX1 insertion, gross (>20) Naturally occurring variant no 6 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly 2013 24194898
1153 OMIA:001952-9940 sheep Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) Microtia HMX1 duplication Naturally occurring variant yes Oar_v4.0 6 g.114173249_114173324dup He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). 2020 31691317
624 OMIA:001952-9823 pig Microtia HOXA1 delins, small (<=20) Naturally occurring variant yes Sscrofa11.1 18 g.45478109delinsTC c.451delinsTC p.(L151fs) 2015 26035869 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: XM_003134844.5 by Stephanie Shields (27/05/2020)
751 OMIA:000668-9031 chicken Huiyang Bearded, China (Chicken) Muffs and beard HOXB8 complex rearrangement Naturally occurring variant no 27 "The Mb allele differs from the wild-type mb allele by three duplications, one in tandem and two that are translocated to that of the tandem repeat around 1.70 Mb on GGA27 2016 27253709
691 OMIA:000081-9796 horse Arab (Horse) Atlanto occipital fusion HOXD3 deletion, gross (>20) Naturally occurring variant yes 18 "a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3." 2017 28111759
789 OMIA:002116-69293 three-spined stickleback Coat colour, albinism, oculocutaneous, HPS5-related Hps5 casper insertion, small (<=20) Naturally occurring variant yes "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" 2017 28739598
1423 OMIA:002116-9685 domestic cat Donskoy (Cat) Pink-eye HPS5 splicing Naturally occurring variant yes Felis_catus_9.0 D1 g.76211236C>T c.2571-1G>A XM_006937131.3 2020 32558164
1222 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^TN duplication Naturally occurring variant yes Felis_catus_9.0 B1 g.36040784_36040785dup c.1255_1256dup p.(Q420Sfs*100) ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as c.1255_1256dupGT 2020 32580512
1224 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^Fr splicing Naturally occurring variant yes Felis_catus_9.0 B1 g.36040933delinsCAG c.1404+2delinsCAG ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as c.1404+2delTinsCAG; changed to HGVS nomenclature in this table; "This variant should extend and change the reading frame, including an additional 24 amino acids in the aberrant protein before a stop codon is recognized. Alternatively, a cryptic splice site may be used from within intron 4." (Buckley et al., 2020) 2020 32580512
1225 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^TX splicing Naturally occurring variant yes Felis_catus_9.0 B1 g.36045776G>A c.2112G>A ENSFCAT00000012982.5; ENSFCAP00000012037.2; "This variant likely disrupts the splice donor allowing read-through for an additional 12 amino acids until a stop codon is encountered .... Alternatively, a cryptic splice site may be used from within intron 8." (Buckley et al., 2020) 2020 32580512
1226 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^NC nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 B1 g.36047047C>T c.2243C>T p.(R748*) 2020 32580512
1227 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^Ca nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 B1 g.36047518C>T c.2593C>T p.(Q865*) ENSFCAT00000012982.5; ENSFCAP00000012037.2 2020 32580512
1223 OMIA:002229-9685 domestic cat Lykoi (Cat) Hypotrichia and Roaning HR hr^VA insertion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B1 g.36051555_36051556insGACA c.3389_3390insGACA p.(S1130Rfs*29) ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as g.36051555insGACA and c.3389insGACA; changed to HGVS nomenclature in this table 2020 32580512
331 OMIA:001348-9544 Rhesus monkey Atrichia with papular lesions HR nonsense (stop-gain) Naturally occurring variant yes MMUL_1 8 g.22046679C>T c.1831C>T p.(R611*) 2002 11831740 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
319 OMIA:002229-9940 sheep Valle del Belice, Italy (Sheep) Hypotrichosis HR nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.45703202C>T c.1312C>T p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1095 OMIA:002777-9615 dog Dachshund (Dog) Disorder of sexual development, HSD17B3-related HSD17B3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 1 g.70554301_70554302del c.159_160del p.(T54Wfs*13) XM_003638870.2; XP_003638918.1; deletion CA 2019 31476086
456 OMIA:001758-9615 dog Australian Shepherd (Dog) Cataract, early onset HSF4 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.82198114del c.971del p.(P324Hfs*87) NM_001048121.1; NP_001041586.1; published as g.85286582delC 2006 16939467
568 OMIA:001758-9615 dog Boston Terrier (Dog) Staffordshire Bull Terrier (Dog) Cataract, early onset HSF4 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 5 g.82198114_82198115insG c.971_972insC p.(L325Tfs*28) NM_001048121.1; NP_001041586.1; published as g.85286582_85286583insC 2006 16939467
919 OMIA:001319-9913 taurine cattle Holstein Friesian (Cattle) Myopathy of the diaphragmatic muscles HSPA1A deletion, gross (>20) Naturally occurring variant yes 23 Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex 2003 12755819
204 OMIA:001817-9913 taurine cattle Japanese Black, Japan (Cattle) Perinatal weak calf syndrome IARS missense Naturally occurring variant yes ARS-UCD1.2 8 g.83909754C>G c.235G>C p.(V79L) 2013 23700453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1604 OMIA:000706-9615 dog Nederlandse Kooikerhondje (Dog) Necrotising myelopathy IBA57 missense Naturally occurring variant yes CanFam3.1 14 g.801179G>A c.439C>T p.(R147W) XM_038686047.1; XP_038541975.1 2023 37588046
1237 OMIA:000664-9615 dog Golden Retriever (Dog) Mucopolysaccharidosis I IDUA deletion, gross (>20) Naturally occurring variant yes CanFam3.1 3 g.91523238_91523524del c.1400-76_1521+89del p.(G467_E507del) NM_001313883.1; NP_001300812.1 2020 32785987
911 OMIA:000664-9615 dog Plott Hound (Dog) Mucopolysaccharidosis I IDUA splicing Naturally occurring variant yes CanFam3.1 3 g.91534420C>T c.155+1G>A NM_001313883.1 rs1152388407 1992 1339393
1190 OMIA:000664-9615 dog Boston Terrier (Dog) Mucopolysaccharidosis I IDUA insertion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.91534556_91534557insGGGGGCCG c.19_20insCGGCCCCC p.(R7Pfs) NM_001313883.1; NP_001300812.1 2020 32300136
500 OMIA:000664-9685 domestic cat Mucopolysaccharidosis I IDUA deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B1 g.207800586_207800588del c.1042_1044del p.(D348del) NM_001305032.1; NP_001291961.1; a 3 bp deletion in the IDUA gene; HGVS 3'-rule applied to variant coordinates in this table 1999 10356309 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1301 OMIA:002320-9615 dog Lapponian Herder (Dog) Progressive retinal atrophy IFT122 missense Naturally occurring variant yes CanFam3.1 20 g.5648046C>T c.3176G>A p.(R1059H) Protein and CDS positions based on XP_533734.2 and XM_533734.6 2021 33606121
1396 OMIA:001823-9913 taurine cattle Holstein Friesian (Cattle) Haplotype with homozygous deficiency-HH2 IFT80 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 1 g.107172616delT c.1140del p.(L381Ffs*3) g.107172616delT rs523422030 2021 34873723 ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3
687 OMIA:000006-9031 chicken Chinese Xingyi bantam, China (Chicken) Achondroplasia, creeper IHH deletion, gross (>20) Naturally occurring variant yes Gallus_gallus-4.0 7 g.21798705_21810600del "a 11,896bp large deletion region (chr7: 21,798,705-21,810,600) covering the entire Indian hedgehog (IHH) gene" 2016 27439785
337 OMIA:001899-9796 horse Quarter Horse (Horse) Incontinentia pigmenti IKBKG nonsense (stop-gain) Naturally occurring variant yes EquCab3.0 X g.126898409C>T c.202C>T p.(R68*) 2013 24324710 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1202 OMIA:002271-9913 taurine cattle Holstein (black and white) (Cattle) Immunodeficiency, IL17Ra-related IL17RA deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 5 g.108813251del c.180del p.(C61Afs*62) XM_015460734.2: c.180delC; XP_015316220.2: p.(Cys61AlafsTer62) (Häfliger et al., 2020) 2020 32448141
584 OMIA:000899-9615 dog Cardigan Welsh Corgi (Dog) Severe combined immunodeficiency disease, X-linked IL2RG insertion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.55483461_55483462insG c.583_584insC p.(R195Pfs*5) NM_001003201.1; NP_001003201.1; "a single nucleotide insertion causing a frameshift". The variant could also be described as a duplication of a cytosine (c.583dup). 1995 8571541
476 OMIA:000899-9615 dog Basset Hound (Dog) Severe combined immunodeficiency disease, X-linked IL2RG deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.55484657_55484660del c.30_33del p.(L11Yfs) NM_001003201.1; NP_001003201.1; c.30_33delCCTC 1994 7829104
1622 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease IL2RG nonsense (stop-gain) Base-editing yes Macaca_fascicularis_5.0 X g.68110639G>A c.391C>T p.(Q131*) XM_005593892.2; XP_005593949.1 2023 37661226
1253 OMIA:002289-9615 dog Lhasa Apso (Dog) Progressive retinal atrophy 4 (PRA4) IMPG2 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 33 " LINE-1 insertion was identified within the critical region in this PRA-affected LA, situated within 200 bp upstream of the interphotoreceptor matrix proteoglycan 2 (IMPG2) gene within the following coordinates: CANFA33: 7,785,475-7,785,491" (Hitti-Malin et al., 2020) 2020 32894063
1034 OMIA:002173-9615 dog Norwich Terrier (Dog) Diffuse cystic renal dysplasia and hepatic fibrosis INPP5E splicing Naturally occurring variant yes CanFam3.1 9 g.49069064G>A c.1572+5G>A Dillard et al. (2018): "the identified variant introduces a novel splice site in INPP5E causing a frameshift and formation of a premature stop codon." 2018 30235266
962 OMIA:001675-61379 black-footed cat Cone-rod dystrophy 2 IQCB1 deletion, small (<=20) Naturally occurring variant yes c.1282delCT p.(L428*) 2017 28322220
606 OMIA:001675-9615 dog American Pit Bull Terrier (Dog) Cone-rod dystrophy 2 IQCB1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 33 g.25078909_25078910insC c.952_53insC p.(S319Ifs*12) 2013 24045995
336 OMIA:001886-9615 dog Karelian Bear Dog (Dog) Norwegian Elkhound (Dog) Chondrodysplasia, disproportionate short-limbed ITGA10 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 17 g.58703935G>A c.2083C>T p.(R695*) XM_845262.4; XP_850355.1 2013 24086591 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1569 OMIA:001000-9615 dog Golden Retriever (Dog) Thrombastenia ITGA2B deletion, small (<=20) Naturally occurring variant yes 9 Published in a conference proceeding as (1924delC) 2017 Reference not in PubMed; see OMIA 001000-9615 for reference details
80 OMIA:001000-9615 dog Otterhound (Dog) Thrombasthenia ITGA2B missense Naturally occurring variant yes CanFam3.1 9 g.19054488G>C c.1192G>C p.(D398H) NM_001003163.2; NP_001003163.1; published as c.1193G>C / c.1100G>C; substitution of histidine for aspartic acid at position 398 (367). Coordinates in the table have been updated to a recent reference genome and or transcripts. 2001 11703027 Breed was incorrectly listed as Scottish Deerhound. Changed to Otterhound [19/5/2023]
1568 OMIA:001000-9615 dog Mixed Breed (Dog) Thrombasthenia ITGA2B nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 9 g.19057141C>T 1357C>T p.(R453*) NM_001003163.2; NP_001003163.1; published as (C1264T) and (R422X), coordinates in this table have been updated to a recent reference genome 2016 26764135
369 OMIA:001000-9615 dog Great Pyrenees (Dog) Thrombasthenia ITGA2B splicing Naturally occurring variant yes CanFam3.1 9 g.19057144_19057157dup c.1360_1373dup NM_001003163.2; NP_001003163.1; experimentally confirmed splice defect; a 14-base duplication in exon 13 and defective splicing of intron 13 2000 11105947
164 OMIA:001000-9796 horse Quarter Horse (Horse) Thoroughbred (Horse) Thrombasthenia ITGA2B missense Naturally occurring variant yes EquCab3.0 11 g.19245752G>C c.215G>C p.(R72P) NM_001081793.1; NP_001075262.1; originally published as p.(R41P) and listed by Leite et al. (2019) as c.122G>C; coordinates in this table have been updated to a recent reference genome and / or transcript 2006 16407493
512 OMIA:001000-9796 horse Peruvian Paso (Horse) Quarter Horse (Horse) Thrombasthenia ITGA2B deletion, small (<=20) Naturally occurring variant yes EquCab3.0 11 g.19247983_19247992del g.19247983_19247992delCAGGTGAGGA 2007 17338169 g. coordinates obtained from Dahlgren et al. (2020)
1245 OMIA:001000-9685 domestic cat Domestic Shorthair Glanzmann's thrombasthenia ITGA2B deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 E1 g.44416063del c.1986delC p.(P662fs) ENSFCAT00000003056.6:c.1986delC; p.Pro662fs (Li et al., 2020) 2020 32935881
1185 OMIA:002261-9913 taurine cattle Holstein (black and white) (Cattle) de novo mutation in an AI sire ITGA3 missense Naturally occurring variant yes ARS-UCD1.2 19 g.36586185G>A p.(T252M) Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. 2017 28904385
1577 OMIA:002718-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctional, ITGA6-related ITGA6 splicing Naturally occurring variant yes ARS-UCD1.2 2 g.24112740C>A c.2160+1G>T p.(I657Mfs) NM_001109981.1 2023 37308849
197 OMIA:000595-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) Leukocyte adhesion deficiency, type I ITGB2 BLAD missense Naturally occurring variant yes ARS-UCD1.2 1 g.144770078T>C c.383A>G p.(D128G) Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. rs445709131 1992 1384046 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
53 OMIA:000595-9615 dog Irish Setter (Dog) Leukocyte adhesion deficiency, type I ITGB2 missense Naturally occurring variant yes CanFam3.1 31 g.38537012C>G c.107G>C p.(C36S) ROS_Cfam_1.0: g.38142116C>G ENSCAFT00845038113.1:c.107G>C ENSCAFP00845029856.1:p.Cys36Ser rs1152388503 1999 10512685 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
775 OMIA:000595-9685 domestic cat Leukocyte adhesion deficiency, type I ITGB2 ITGB-2 missing exon 2 deletion, gross (>20) Naturally occurring variant yes Felis_catus_9.0 C2 g.1772101_1772124del c.46_58+11del XM_011285804.3; Bauer et al. (2017) "24 bp deletion at the exon 2 to intron 2 boundary (c.46_58 + 11del), predicting premature translational termination due to abnormal splicing of exon 1 to exon 3 or 4." 2017 28750142 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
684 OMIA:001948-9913 taurine cattle Charolais (Cattle) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, gross (>20) Naturally occurring variant yes 19 "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene 2015 25890340
1272 OMIA:001948-9940 sheep Mouton vendéen, France (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7412626C>T c.2653C>T p.(R885*) c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 2020 33225458
543 OMIA:001948-9940 sheep Spanish Churro (Sheep) Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 11 g.7425460_7425463del c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
754 OMIA:002097-9615 dog Italian Spinone (Dog) Ataxia, spinocerebellar ITPR1 complex rearrangement Naturally occurring variant yes 20 Forman et al. (2015) identified an expanded GAA-repeat in intron 35 of the ITPR1 gene in affected dogs. The wildtype sequence contains 8 GAA repeats. The expanded disease-associated alleles carry an estimated 318-651 GAA repeats. 2015 25354648
739 OMIA:000809-9615 dog Polycythemia JAK2 delins, small (<=20) Naturally occurring variant yes CanFam3.1 1 g.93416506_93416510delinsTTCCT c.1849_1853delinsTTCCT p.(V617_C618delinsFL) XM_022421838.1; XP_022277546.1; published as a three-base change in codons 617 and 618 of JAK2 giving rise to V617F and C618L, SOMATIC MUTATION/MOSAICISM 2011 21320566
1390 OMIA:002483-9913 taurine cattle Neuromuscular channelopathy KCNG1 missense Naturally occurring variant yes ARS-UCD1.2 13 g.78918850C>A c.1248G>T p.(W416C) NM_001205719.1; NP_001192648.1 2021 34828398
1154 OMIA:002240-9615 dog Norwegian Buhund (Dog) Ataxia, cerebellar, KCNIP4-related KCNIP4 missense Naturally occurring variant yes CanFam3.1 3 g.88890674T>C c.436T>C p.(T146R) XM_005618660.3; XP_005618717.1 2020 31999692
945 OMIA:002089-9615 dog Dachshund (Dog) Jack Russell Terrier (Dog) Parson Russell Terrier (Dog) Smooth Fox Terrier (Dog) Ataxia, cerebellar, KCNJ10-related KCNJ10 missense Naturally occurring variant yes CanFam3.1 38 g.22140300C>G c.627C>G p.(I209M) XM_545752.6; XP_545752.3; reference for Dachshund is PMID:37905444 rs1152388456 2014 24708069 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
947 OMIA:002089-9615 dog Belgian Shepherd Dog, Malinois (Dog) Spongy degeneration with cerebellar ataxia 1 (SDCA1) KCNJ10 missense Naturally occurring variant yes CanFam3.1 38 g.22140659T>C c.986T>C p.(L329P) XM_545752.6; XP_545752.3 2017 27966545 28007838 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
612 OMIA:002089-9615 dog Jack Russell Terrier (Dog) Ataxia, cerebellar, KCNJ10-related KCNJ10 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 38 g.22141027insC c.*214_*215insC XM_005640901.1; Gast et al. (2016) "Bioinformatic analysis using RegRNA indicated the KCNJ10:g.22141027insC affecting regulation of gene expression via a regulatory RNA motif or miRNA target site." 2016 27724896
1596 OMIA:002332-9615 dog English Springer Spaniel (Dog) Long QT syndrome KCNQ1 missense Naturally occurring variant yes CanFam3.1 18 g.46604412C>A c.770C>A p.(T257K) XM_022405121.1; XP_022260829.1; published as "Genbank KF439050, KCNQ1_T377K" - coordinates in this table are updated to a recent reference genome. 2015 25779927
196 OMIA:001722-9913 taurine cattle Marchigiana (Cattle) Romagnola (Cattle) Lethal multi-organ developmental dysplasia KDM2B missense Naturally occurring variant yes ARS-UCD1.2 17 g.53761149G>A c.2503G>A p.(D835N) 2012 23029151 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
207 OMIA:002390-9913 taurine cattle Brown Swiss (Cattle) Spinal muscular atrophy KDSR missense Naturally occurring variant yes ARS-UCD1.2 24 g.61620302C>T c.562G>A p.(A188T) 2007 17420465 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
604 OMIA:000979-9031 chicken Talpid-3 KIAA0586 insertion, small (<=20) Naturally occurring variant yes 5 insT 2006 16702409
1005 OMIA:000527-9913 taurine cattle Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) Progressive ataxia KIF1C missense Naturally occurring variant yes ARS-UCD1.2 19 g.26407668C>T c.608G>A p.(R203Q); p.(R203_T204delinsQ*) ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). rs800926237 2018 30067756
1231 OMIA:002283-9823 pig Large White (Pig) Arthrogryposis multiplex congenita, KIF21A-related KIF21A insertion, gross (>20) Naturally occurring variant yes Sscrofa11.1 5 g.70964237_70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT p.(V41_F42ins*) (NC_010447.5:g70964237_ g70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT; p.Val41_Phe42insTer) (Fang et al., 2020) 2020 32686171
1191 OMIA:002267-9685 domestic cat Bengal (Cat) Progressive retinal atrophy KIF3B missense Naturally occurring variant yes Felis_catus_9.0 A3 g.26784019C>T c.1000G>A p.(A334T) ENSFCAT00000022266; c.1000G>A (p.Ala334Thr) 2020 32386558 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770)
1440 OMIA:001836-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Abortion due to haplotype HH13 KIR2DS1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 18 g.62758881G>A c.475C>T p.(Q159*) NM_001097567.1; NP_001091036.1 2022 35361830
748 OMIA:000426-9913 taurine cattle Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) Gonadal hypoplasia KIT cs(29) complex rearrangement Naturally occurring variant yes 6 "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" 2013 24086604
464 OMIA:001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.47178531_47178536del c.1664_1669del NM_001003181.1; deletion of AGTGGA; SOMATIC MUTATION 2010 20950418
465 OMIA:001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.47178534_47178539del c.1667_1672del NM_001003181.1; deletion of GGAAGG; SOMATIC MUTATION 2010 20950418
1505 OMIA:000449-452646 American mink Shadow coat colour KIT S^h missense Naturally occurring variant unknown NNQGG.v01 NWR01000037.1 g.6253028G>T c.2374G>T p.(D792Y) 2022 35481560
1248 OMIA:002287-9823 pig Bama Xiang Zhu, China (Pig) Hypopigmentation (piebald) and deafness KIT missense Naturally occurring variant yes Sscrofa11.1 8 g.41485957T>A c.2418T>A p.(D806E) ENU mutagenesis was used to create these pigs, NM_001044525.1; c.2418T>A; NP_001037990.1; p.(D806E) (Xu et al., 2020) 2020 33042408
74 OMIA:000819-9615 dog Shih Tzu (Dog) Prekallikrein deficiency KLKB1 missense Naturally occurring variant yes CanFam3.1 16 g.44501415A>T c.988T>A p.(F330I) 2011 20736516 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1495 OMIA:002425-9615 dog Chinese Shar-Pei (Dog) Ichthyosis, KRT1-related KRT1 deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 27 g.44229728_44229730del c.567_569del p.(N190del) NM_001003392.1; NP_001003392.1 2022 36251712
364 OMIA:001415-9615 dog Norfolk Terrier (Dog) Hyperkeratosis, epidermolytic KRT10 splicing Naturally occurring variant yes CanFam3.1 9 g.21866234G>T c.1125+1G>T XM_038676544.1; XP_038532472.1; experimentally confirmed splice defect; a single base GT>TT change in the consensus 5'-splice site of intron 5 2005 16029326
1579 OMIA:001415-9615 dog Chihuahua (Dog) Ichthyosis, epidermolytic KRT10 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 9 g.21814695G>A c.437G>A p.(R146H) XM_038547368.1; XP_038403296 2023 37332248
1229 OMIA:002281-9685 domestic cat Domestic Shorthair Epidermolysis bullosa, simplex, KRT14-related KRT14 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 E1 g.42361726G>A c.979C>T p.(Q327*) XM_003996860.5; XP_003996909.2 2020 32657488 Genomic position in Felis_catus_9.0 provided by Joshua Khamis.
936 OMIA:002088-9615 dog Dogue de Bordeaux (Dog) Palmoplantar keratoderma, nonepidermolytic, focal 1 KRT16 delins, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.[21170012_21170013delinsCGGA;21170030del] c.[1147_1148delinsCGGA;1165del] p.(V383Rfs) XM_548101.4; XP_548101.2; published as p.(E392*) - protein coordinates updated to HGVS nomenclature 2015 25521457
1265 OMIA:002081-9913 taurine cattle Epidermolysis bullosa, simplex, KRT5-related` KRT5 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 5 g.27367604_27367606del c.534_536del p.(N178del) "27367604delCAA (NM_001008663.1:c.534_536delCAA), leading to a loss of an asparagine amino acid at residue 178 of the encoded KRT5 protein (NP_001008663.1:p.Asn178del)" (Jacinto et al., 2020). 2020 33135329 In an email dated 5 November 2020, Cord Drögemüller confirmed that the genomic specification for this variant is g.27367604_27367606delCAA
192 OMIA:002081-9913 taurine cattle Friesian cross (Cattle) Jersey cross Epidermolysis bullosa KRT5 missense Naturally occurring variant yes ARS-UCD1.2 5 g.27371128G>A c.1432G>A p.(E478K) 2005 15955091 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1480 OMIA:002081-9615 dog Cardigan Welsh Corgi (Dog) Epidermolysis bullosa, simplex, KRT5-related KRT5 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 27 g.44080887C>T c.1426G>A p.(E476K) NM_001346035.1; NP_001332964.1 2022 36004757
1697 OMIA:002081-9615 dog German Shepherd Dog (Dog) Epidermolysis bullosa simplex, localized, KRT5-related KRT5 delins, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 27 NC_049248.1:g.44081942_44091959del NM_001346035.1:c.988_1005del NP_001332964.1:p.(N330_D335del) 2024 38742646
662 OMIA:000394-9031 chicken Frizzle KRT6A deletion, gross (>20) Naturally occurring variant no GRCg6a 33 g.5251413_5251496del p.(V311_K333del) NM_001001313.2; NP_001001313.2; published as a 84bp deletion that covers positions −24 of exon 5 to +59 of intron 5 of KRT6A (called KRT75 in an earlier genome assembly); the deletion activates a cryptic splice site resulting in a 69 bp in-frame deletion in mRNA after splicing and a deletion of 23-amino acids (position 311–333) 2012 22829773
1337 OMIA:002114-9913 taurine cattle Hereford (Cattle) Hypotrichosis, KRT71-related KRT71 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 5 g.27331221_27331228del c.281_288del p.(M94Nfs*14) cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively 2021 34356054 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del.
382 OMIA:001583-9685 domestic cat Sphynx (Cat) Sphynx hairless KRT71 Re^HR splicing Naturally occurring variant yes Felis_catus_9.0 B4 g.81048680C>T c.816+1G>A 2010 20953787 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
735 OMIA:001371-9615 dog Staffordshire Bull Terrier (Dog) L-2-hydroxyglutaricacidemia L2HGDH delins, small (<=20) Naturally occurring variant yes CanFam3.1 8 g.26723470_26723472delinsAAG c.1298_1300delinsCTT p.(L433_H434delinsPY) XM_858437.5; XP_863530.2; published as ENSCAFG00000014237; CanFam1.0: (c[1297T→C; 1299c→t]; p[Leu433Pro; His434Tyr]; coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17475916
427 OMIA:001371-9615 dog Yorkshire Terrier (Dog) L-2-hydroxyglutaricacidemia L2HGDH missense Naturally occurring variant yes CanFam3.1 8 g.26760351T>C c.1A>G p.(M1?) XM_858437.5; published as p.(Met1?) 2012 22843824 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
1535 OMIA:001371-9685 domestic cat Domestic Shorthair L-2-hydroxyglutaricacidemia L2HGDH nonsense (stop-gain) Naturally occurring variant yes F.catus_Fca126_mat1.0 B3 g.97881395G>A c.397C>T p.(Q133*) XM_023255678.2; XP_023111446.2 2023 36880414
1317 OMIA:001371-9685 domestic cat Domestic Longhair L-2-hydroxyglutaric aciduria L2HGDH missense Naturally occurring variant yes Felis_catus_9.0 B3 g.100207200T>C c.1301A>G p.(H434R) XM_023255678.1; XP_023111446.1 2021 34062805
1399 OMIA:002459-9615 dog Staffordshire Bull Terrier (Dog) Congenital muscular dystrophy LAMA2 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 1 g.67734331_67736575del c.610-1412_789+653del XM_003432522.2; 2022 34854126
1389 OMIA:002459-9615 dog Italian Greyhound (Dog) Congenital muscular dystrophy LAMA2 CMD nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 1 g.67883271G>A c.3285G>A p.(W1095*) XM_022419950.1; XP_022275658.1 2021 34828429
701 OMIA:001677-9615 dog German Pointer (Dog) Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 insertion, gross (>20) Naturally occurring variant yes 7 "insertion (4818+207ins6.5 kb) of repetitive satellite DNA within intron 35 of the gene (LAMA3)" 2005 15737193
909 OMIA:001677-9913 taurine cattle Belgian Blue (Cattle) Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 nonsense (stop-gain) Naturally occurring variant unknown ARS-UCD1.2 24 g.32749369G>A c.7549C>T p.(R2517*) 2015 26370913 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1324 OMIA:001677-9615 dog Australian Cattle Dog X Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 missense Naturally occurring variant yes CanFam3.1 7 g.64427161T>A c.8615T>A p.(D2867V) cDNA and protein positions based on XM_537297.6 and XP_537297.2, respectively 2021 34250689
658 OMIA:001677-9796 horse American Saddle Horse (Horse) Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 deletion, gross (>20) Naturally occurring variant yes EquCab3.0 8 NC_009151.3:g.48678342_48684920del "6589-bp deletion spanning exons 24-27 . . . in the LAMA3 gene in American Saddlebred foals" 2009 19016681 Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey.
1387 OMIA:002479-9913 taurine cattle Romagnola (Cattle) Hemifacial microsomia LAMB1 HFM missense Naturally occurring variant unknown ARS-UCD1.2 4 g.49019693G>A c.2002C>T p.(R668C) NM_001206519.1; NP_001193448.1; 2022 34796979
1239 OMIA:002269-9615 dog Australian Shepherd (Dog) Epidermolysis bullosa, junctionalis, LAMB3-related LAMB3 JEB missense Naturally occurring variant yes CanFam3.1 7 g.8286613A>G c.1174T>C p.(C392R) NC_006589.3:g.8286613A>G; XM_014115071.2:c.1174T>C; XP_013970546.1:p.Cys392Arg 2020 32906717
682 OMIA:001678-9913 taurine cattle Hereford (Cattle) Epidermolysis bullosa, junctionalis, LAMC2 LAMC2 deletion, gross (>20) Naturally occurring variant yes 16 "2.4 kb deletion encompassing the first exon of the LAMC2 gene" 2015 25888738
599 OMIA:001678-9796 horse Belgian Draft (Horse) Breton, France (Horse) Cavallo Agricolo Italiano da Tiro Pesante Rapido, Italy (Horse) Comtois (Horse) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 insertion, small (<=20) Naturally occurring variant yes EquCab3.0 5 g.17498175dup c.1372dup p.(R458Pfs) NM_001081768.1; NP_001075237.1; published as c.1368insC; coordinates in the table have been updated to HGVS nomenclature (3'-rule) and recent reference genome and / or transcript inforamtion 1,372 Protein position: 458 2002 12230513 The genomic position in EquCab3.0 was provided by Margaret Higgins, working under the guidance of Professor Ernie Bailey [April 2022]
507 OMIA:001678-9940 sheep German Blackheaded Mutton (Sheep) Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 12 g.68856318_68856319del c.2746_2747del p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1168 OMIA:002251-9615 dog Airedale Terrier (Dog) Surfactant metabolism dysfunction, pulmonary LAMP3 missense Naturally occurring variant yes CanFam3.1 34 g.16092728C>T c.1159G>A p.(E387K) 2020 32150563
1371 OMIA:002460-9615 dog Labrador Retriever (Dog) Muscular dystrophy-dystroglycanopathy LARGE nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 10 g.30357716C>T c.1363C>T p.(R455*) 2021 34654610
449 OMIA:001160-9986 rabbit Hyperlipidaemia LDLR deletion, small (<=20) Naturally occurring variant yes "an in-frame deletion of 12 nucleotides that eliminates four amino acids from the cysteine-rich ligand binding domain of the LDL receptor" 1986 3010466
1556 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR nonsense (stop-gain) Naturally occurring variant yes 19 p.(W284*) G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) 1990 2326270
1557 OMIA:000499-9544 Rhesus monkey Hypercholesterolaemia LDLR missense Naturally occurring variant yes 19 c.245G>A p.(C82Y) 2023 37186395
987 OMIA:000499-9823 pig Hypercholesterolaemia LDLR missense Naturally occurring variant yes Sscrofa11.1 2 g.69841413C>T c.250C>T p.(R84C) rs701604154 1998 9556295 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcripts: XM_021080444.1, XM_021080449.1, XM_021080452.1, XM_021080457.1 by Stephanie Shields (27/05/2020)
269 OMIA:001596-9615 dog Lagotto Romagnolo (Dog) Epilepsy, benign familial juvenile LGI2 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 3 g.85210442A>T c.1558A>T p.(K520*) XM_022416405.1; XP_022272113.1; published as c.1552A>T & p.(K518*); coordinates in the table have been updated to a recent reference genome and / or transcript 2011 21829378
362 OMIA:002314-9615 dog Czechoslovakian Wolfdog (Dog) German Shepherd Dog (Dog) Saarloos Wolfhond (Dog) Tibetan Terrier (Dog) Pituitary dwarfism LHX3 splicing Naturally occurring variant yes 9 "a deletion of one of six 7 bp [GTGTTTT] repeats in intron 5 of LHX3" 2011 22132174
608 OMIA:002314-9615 dog German Shepherd Dog (Dog) Pituitary dwarfism LHX3 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.49252491_49252493dup c.545_547dup p.(N182dup) NM_001197187.1; NP_001184116.1; published as c.545_547dupACA 2011 22132174 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1415 OMIA:002516-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency OH4 LIG3 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.15080336_15080341del c.2483_2484+4delAGGTG p.K828fs NM_001038107.2 2021 34915862
649 OMIA:002389-9685 domestic cat Maine Coon (Cat) Spinal muscular atrophy LIX1 deletion, gross (>20) Naturally occurring variant yes Felis_catus_9.0 A1 g.161036890_161176706del published as "a ~140 kb deletion removing exons 4-6 of LIX1 and all except exon 1 of LNPEP" 2006 16899656 Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley.
663 OMIA:001612-9031 chicken Silkie (Chicken) Oligozeugodactyly LMBR1 deletion, gross (>20) Naturally occurring variant yes 2 "a large deletion in LMBR1-intron 5, eliminating most of the limb-specific enhancer conserved sequence." 2011 21509895
434 OMIA:000810-9685 domestic cat Polydactyly LMBR1 Pd^UK2 regulatory Naturally occurring variant yes Felis_catus_9.0 A2 g.169532842T>A regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACACAG[A/T]AATGAG 2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis.
432 OMIA:000810-9685 domestic cat Maine Coon (Cat) Polydactyly LMBR1 Pd^Hw regulatory Naturally occurring variant yes Felis_catus_9.0 A2 g.169532844T>C regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACAC[A/G]GAAATGAG 2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley.
433 OMIA:000810-9685 domestic cat Polydactyly LMBR1 Pd^UK1 regulatory Naturally occurring variant yes Felis_catus_9.0 A2 g.169533066C>G regulatory variant in the ZPA regulatory sequence (ZRS); published as CC[G/C]GTG 2008 18156157 Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley.
1521 OMIA:001213-9986 rabbit Emery-Dreifuss muscular dystrophy LMNA missense Base-editing yes p.(L530P) 2022 35282412
1672 OMIA:002796-9541 crab-eating macaque Cardiomyopathy, dilated, LMNA-related LMNA splicing Base-editing yes MFA1912RKSv2 1 NC_052255.1:g.93546791T>C XM_045371898.1:c.357-2A>G 2024 38559624
1401 OMIA:001213-9823 pig Yucatan Miniature, United States of America (Pig) Hutchinson-Gilford progeria syndrome LMNA splicing Genome-editing (CRISPR-Cas9) yes Sscrofa11.1 4 g.93900345G>A c.1824C>T 2019 30911407
1638 OMIA:002796-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cardiomyopathy, dilated, LMNA-related LMNA deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 7 g.41688530del c.1726del p.(D576Tfs*124) NM_001287151.1; NP_001274080 2023 37925523
393 OMIA:000344-9031 chicken Fayoumi (Chicken) Epilepsy LOC430486 splicing Naturally occurring variant yes 25 c581-4CC>TG 2011 22046416
108 OMIA:002071-9615 dog Labrador Retriever (Dog) Macular corneal dystrophy LOC489707 missense Naturally occurring variant yes CanFam3.1 5 g.75279699C>A c.814C>A p.(R272S) 2016 26585178 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1151 OMIA:001928-9615 dog Golden Retriever (Dog) Myasthenic syndrome, congenital, COLQ-related LOC608697 missense Naturally occurring variant yes CanFam3.1 23 g.27175559G>A c.880G>A p.(G294R) 2020 31769119
900 OMIA:001928-9615 dog Labrador Retriever (Dog) Myasthenic syndrome, congenital LOC608697 missense Naturally occurring variant yes CanFam3.1 23 g.27176737T>C c.1010T>C p.(I337T) XM_858278.5; XP_863371.1 2014 25166616 Genomic position in CanFam3.1 provided by Robert Kuhn
1314 OMIA:002336-9615 dog Rottweiler (Dog) Nonsyndromic hearing loss LOXHD1 missense Naturally occurring variant yes CanFam3.1 7 g.44806821G>C c.5747G>C p.(G1914A) XM_022421426.1, c.5747G>C; J9PAE4, p.(G1914A) (Hytönen et al., 2021) 2021 33983508
131 OMIA:001210-9685 domestic cat Hyperlipoproteinaemia LPL missense Naturally occurring variant yes Felis_catus_9.0 B1 g.38078551C>T c.1315G>A p.(G439R) NM_001042567.1; NP_001036032.1; published as c.1234G>A and p.(G412R); coordinates in the table have been updated to a recent reference genome and / or transcript 1996 8636438 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1260 OMIA:001486-9615 dog Beagle (Dog) Night blindness, congenital stationary, LRIT3-related LRIT3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 32 g.30038863del c.763del p.(K245Nfs*5) c.763delG 2019 31578364
378 OMIA:000963-9913 taurine cattle Angus (Cattle) Syndactyly (mule foot) LRP4 splicing Naturally occurring variant yes ARS-UCD1.2 15 g.76792588C>T c.5385+1G>A "a G to A transition at the first nucleotide in the splice donor site of intron 37" 2006 16963222 Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
627 OMIA:000963-9913 taurine cattle Holstein Friesian (Cattle) Syndactyly (mule foot) LRP4 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 15 g.76800972_76800973delinsAT c.4863_4864delinsAT p.(N1621_G1622delinsKC) Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 2006 16859890
769 OMIA:000963-9913 taurine cattle Simmental (Cattle) Syndactyly (mule foot) LRP4 missense Naturally occurring variant yes ARS-UCD1.2 15 g.76807508C>T c.3595G>A p.(G1199S) 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
768 OMIA:000963-9913 taurine cattle Simmental Charolais Cross Syndactyly (mule foot) LRP4 missense Naturally occurring variant yes ARS-UCD1.2 15 g.76812187C>T c.2719G>A p.(G907R) 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
610 OMIA:002017-9685 domestic cat Siamese (Cat) Glaucoma 3, primary congenita LTBP2 duplication Naturally occurring variant yes Felis_catus_9.0 B3 g.121929604_121929607dup c.1449_1452dup p.(A485Gfs) ENSFCAT00000064963.2; ENSFCAP00000046761.2; published as "a 4-bp insertion in exon 8 located at chrB3: 120995236"[felCat5] 2016 27149523 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1394 OMIA:002485-9685 domestic cat British Shorthair (Cat) Skeletal dysplasia, LTBP3-related LTBP3 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 D1 g.110690432del c.158del p.(G53Afs*16) XM_023240055.1; XP_023095823.1 2021 34946872
518 OMIA:000185-452646 American mink Chediak-Higashi syndrome LYST deletion, small (<=20) Naturally occurring variant yes c.9468delC 2013 22762706
183 OMIA:000185-9913 taurine cattle Japanese Black, Japan (Cattle) Chediak-Higashi syndrome LYST missense Naturally occurring variant yes ARS-UCD1.2 28 g.8464077T>C c.6044A>G p.(H2015R) 1999 10594238 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1147 OMIA:000185-9685 domestic cat Persian (Cat) Chediak-Higashi disease LYST repeat variation Naturally occurring variant yes Felis_catus_9.0 D2 g.13289500_13308861dup c.8347-2422_9548+1749dup Buckley et al. (2020): "a tandem segmental duplication encompassing exons 30 through to 38 (NM_001290242.1:c.8347-2422_9548 + 1749dup) (NC_018733.3:g.13289500_13308861dup)" 2020 31919397
249 OMIA:000625-10141 domestic guinea pig Mannosidosis, alpha Man2b1 missense Naturally occurring variant yes c.679C>T p.(R227W) 2002 11959458
199 OMIA:000625-9913 taurine cattle Galloway (Cattle) Mannosidosis, alpha MAN2B1 missense Naturally occurring variant yes ARS-UCD1.2 7 g.12840983G>A c.662G>A p.(R221H) 1997 9208932 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
198 OMIA:000625-9913 taurine cattle Angus (Cattle) Murray Grey (Cattle) Mannosidosis, alpha MAN2B1 missense Naturally occurring variant yes ARS-UCD1.2 7 g.12842292T>C c.961T>C p.(F321L) 1997 9208932 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1628 OMIA:000625-9615 dog Doberman Pinscher (Dog) Mannosidosis, alpha MAN2B1 missense Naturally occurring variant unknown Dog10K_Boxer_Tasha 20 g.49320989A>G c.311A>G p.(D104G) XM_005632833.4; XP_005632890.1 2023 37761886
499 OMIA:000625-9685 domestic cat Persian (Cat) Mannosidosis, alpha MAN2B1 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 A2 g.9011118_9011121del c.1749_1752del p.(Q584Afs) NM_001009222.1; NP_001009222.1 1997 9396732 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
297 OMIA:000626-9913 taurine cattle Salers (Cattle) Mannosidosis, beta MANBA nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 6 g.22188765G>A c.2574G>A p.(W858*) 1999 10594236 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
451 OMIA:000626-9925 goat Mannosidosis, beta MANBA deletion, small (<=20) Naturally occurring variant yes ARS1 6 g.22409150del c.1398del 1996 8921369 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
1093 OMIA:000626-9615 dog Mixed Breed (Dog) Beta mannosidosis MANBA duplication Naturally occurring variant yes CanFam3.1 32 g.24057654_24057658dup c.2377_2381dup p.(H794Hfs) XM_005639236.3; XP_005639293.1; published as c.2377_2381dupTATCA 2019 31439511 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
1072 OMIA:000626-9615 dog German Shepherd Dog (Dog) Beta mannosidosis MANBA missense Naturally occurring variant yes CanFam3.1 32 g.24147500A>T c.560T>A p.(I187N) 2019 30983534
1636 OMIA:000626-9685 domestic cat Domestic Shorthair Mannosidosis, beta MANBA missense Naturally occurring variant yes Felis_catus_9.0 B1 g.121800342G>A c.2506G>A p.(G836R) ENSFCAT00000007560, variant was reported in a single affected cat 2023 37913889
1473 OMIA:002381-9913 taurine cattle Romagnola (Cattle) Skeletal-cardio-enteric dysplasia MAP2K2 missense Naturally occurring variant yes ARS-UCD1.2 7 g.19923991C>T c.535G>A p.(R179W) NM_001038071.2; NP_001033160.2; possible de-novo causal variant 2021 34209498
943 OMIA:001432-9615 dog Dachshund, Miniature Long-Haired (Dog) Cone-rod dystrophy 4 MAP9 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 15 g.52905336_52927296del c.75+181_1378-215del XM_005629374.1; An approximately 22kb deletion "approximately 30 Mb upstream of RPGRIP1 . . . The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene." … " The size of the deletion based on genome build CanFam3.1 MAP9_corrected is 21,961 bp, with deletion breakpoints in intron 10 of MAP9 and MAP9." 2016 27017229
1416 OMIA:002517-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH6 MARS2 BH6 missense Naturally occurring variant yes ARS-UCD1.2 2 g.86191230G>A c.1553G>A p.(R518Q) NM_001098971.1 2021 34915862
1167 OMIA:001544-9913 taurine cattle Rat-tail syndrome MC1R E^D missense Naturally occurring variant no ARS-UCD1.2 18 g.14705671T>C c.296T>C p.(L99P) rs109688013 2016 27037038
1437 OMIA:002716-9615 dog German Shepherd Dog (Dog) Congenital idiopathic megaesophagus MCHR2 repeat variation Naturally occurring variant yes CanFam3.1 12 Bell et al. (2022): "Within the first intron of MCHR2, we identified a 33 bp variable number tandem repeat (VNTR) containing a consensus binding sequence for the T-box family of transcription factors. Across dogs and wolves, the major allele includes two copies of the repeat, whereas the predominant alleles in GSDs have one or three copies. The single-copy allele is strongly associated with CIM (P-val = 1.32x10-17), with homozygosity for this allele posing the most significant risk". 2022 35271580
1658 OMIA:002814-9615 dog Eurasier (Dog) Polioencephalopathy MECR missense Naturally occurring variant yes UU_Cfam_GSD_1.0 2 g.70793040A>G c.823A>G p.(M275V) XM_038531348.1; XP_038387276.1, variant reported in 3 affected dogs 2023 38041431
558 OMIA:002043-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MED22-related MED22 deletion, small (<=20) Naturally occurring variant yes 11 p.(L38Rfs*25) 2016 27646536
819 OMIA:001932-9615 dog Swedish Vallhund (Dog) Progressive retinal atrophy, MERTK-related MERTK insertion, gross (>20) Naturally occurring variant yes CanFam3.1 17 An insertion of "a full-length [6.401 kb] LINE-1 element comprising the 15 bp target site duplication [indicated by 'ins' in the g. notation], a 5’UTR, 900 bp 5’ ORF1, a 49 bp intergenic spacer, a 3,828 bp 3’ ORF2, a 3’UTR and poly(A) tail. The LINE-1 element has been inserted in the same orientation as the MERTK gene.". 200922: g. info has been moved to here (g.36338043-36338057ins) until it can be standardised 2017 28813472 Genomic location provided by Sally Ricketts
1489 OMIA:002551-9615 dog Bull Mastiff (Dog) Mitochondrial fission encephalopathy MFF delins, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 25 g.40322999_40323003delinsCGCTCT c.471_475delinsCGCTCT p.(E158Afs*14) XM_038574000.1; XP_038429928.1 2022 36085405
374 OMIA:001106-9913 taurine cattle Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) Axonopathy MFN2 splicing Naturally occurring variant yes ARS-UCD1.2 16 g.41686003G>A c.2229C>T "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 2011 21526202 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
472 OMIA:002153-9615 dog Schnauzer-Beagle Cross (Dog) Neuroaxonal dystrophy MFN2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.84289962_84289964del c.1617_1619del p.(E539del) NM_001284441.1; NP_001271370.1; published as c.1617_1619delGGA; genomic position considers 3' rule of the HGVS 2011 21643798 Genomic position in CanFam3.1 provided by Robert Kuhn.
1637 OMIA:002371-9940 sheep Kerry Hill (Sheep) Microcephaly, MFSD2A-related MFSD2A duplication Naturally occurring variant yes ARS-UI_Ramb_v2.0 1 g.14577421dup c.285dup p.(D96Rfs*9) XM_004001833.5; XP_004001882.2 2023 37921236
1694 OMIA:001962-9986 rabbit Lionhead Dwarf Neuronal ceroid lipofuscinosis, 7 MFSD8 duplication Naturally occurring variant yes 15 NC_013683.1:g.103727963_103738667dup XM_002717263.3:c.202_701dup XP_002717309.2:p.(E235Lfs*23) 2024 38712841
551 OMIA:001962-9615 dog Chihuahua (Dog) Chinese Crested (Dog) Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 19 g.13010761del c.846del p.(F282Lfs*13) XM_014121438.2;XP_013976913.1; published as c.843delT; coordinates in the table have been updated to a recent reference genome and / or transcript 2015 25551667 Breed and p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1148 OMIA:001962-9685 domestic cat Domestic Shorthair Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B1 g.98935076del c.780del p.(Q262Kfs*33) XM_019828986.2; XP_019684545.1; published as c.780delT 2020 31860737
1374 OMIA:002465-9615 dog Italian Cane Corso (Dog) Dental-skeletal-retinal anomaly MIA3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 38 g.16920529_16920530del c.3822+3_3822+4del p.(V1238_K1274del) XM_005640835.3; XP_005640892.1; published as g.16920529_16920530delAT, leads to skipping of two exons: XM_005640835.3:r.3712_3822del 2021 34680893
644 OMIA:001565-9913 taurine cattle Ayrshire (Cattle) Abortion and stillbirth due to mutation in MIMT1 MIMT1 deletion, gross (>20) Naturally occurring variant yes 18 a 110 kb deletion in the MIMT1 gene 2010 21152099
1287 OMIA:002309-9646 giant panda Cataract MIP missense Naturally occurring variant yes c.686G>A p.(S229N) 2021 33530927
385 OMIA:001401-10036 golden hamster Waardenburg syndrome, type 2A MITF splicing Naturally occurring variant yes A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. 2003 12871913
505 OMIA:000755-93934 Japanese quail Osteopetrosis MITF deletion, small (<=20) Naturally occurring variant yes same MITF variant as for silver, as reported in 1998 2001 11169846
678 OMIA:001931-9913 taurine cattle Holstein (black and white) (Cattle) Depigmentation associated with microphthalmia MITF deletion, gross (>20) Naturally occurring variant yes 22 a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 2014 25199536
1378 OMIA:001401-9823 pig Bama Xiang Zhu, China (Pig) Waardenburg syndrome, type 2A MITF missense Chemical mutagenesis (ENU) yes 13 c.740T>C p.(L247S) 2017 29094203
837 OMIA:001680-9913 taurine cattle Holstein (black and white) (Cattle) Glass-eyed albino MITF deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 22 g.31628127_31628129del p.(R211del) UMD3.1 position g.31746506_31746508del 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
189 OMIA:001680-9913 taurine cattle Fleckvieh-Simmental, Germany (Cattle) Dominant white with bilateral deafness MITF missense Naturally occurring variant yes ARS-UCD1.2 22 g.31628131C>A c.629G>T p.(R210I) UMD3.1 position is g.31746502 2011 22174915 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1205 OMIA:001680-452646 American mink Hedlund MITF h splicing Naturally occurring variant yes MusPutFur1.0.86 c.33+1G>A GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) 2019 30872653
849 OMIA:001401-9823 pig Rongchang, China (Pig) Waardenburg syndrome, type 2A MITF insertion, small (<=20) Naturally occurring variant yes Sscrofa11.1 13 g.51377987_51377988insTTTAGTTTAAAAAA a 14 bp insertion "in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene generated a novel silencer" 2016 27349893
976 OMIA:002146-9615 dog Bull Terrier (Dog) Miniature Bull Terrier (Dog) Lethal acrodermatitis MKLN1 splicing Naturally occurring variant yes CanFam3.1 14 g.5731405T>G c.400+3A>C p.(G105Sfs*10) This variant is "located within the 5’-splice site of intron 4 of the MKLN1 gene" 2018 29565995
1209 OMIA:001654-8932 rock pigeon Almond MLANA st repeat variation Naturally occurring variant yes "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) 2020 32433666
1014 OMIA:002145-9544 Rhesus monkey Colorectal cancer, MLH1-related MLH1 nonsense (stop-gain) Naturally occurring variant yes 2 c.1029C<G p.(Y343*) Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. 2018 30108684
1013 OMIA:002145-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MLH1-related MLH1 deletion, small (<=20) Naturally occurring variant yes 2 g.99561829_99561830del Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" 2018 29490919
360 OMIA:000031-9615 dog American Staffordshire Terrier (Dog) Beagle (Dog) Doberman Pinscher (Dog) German Pinscher (Dog) Large Munsterlander (Dog) Miniature Pinscher (Dog) Rhodesian Ridgeback (Dog) Dilute MLPH d^1 splicing Naturally occurring variant yes CanFam3.1 25 g.48121642G>A c.-22G>A 2007 17519392 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
1216 OMIA:000031-9615 dog Chihuahua (Dog) Italian Greyhound (Dog) Mudi (Dog) Pekingese (Dog) Pumi (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Tibetan Mastiff (Dog) Yorkshire Terrier (Dog) Dilute MLPH d^3 insertion, small (<=20) Naturally occurring variant no CanFam3.1 25 g.48150749_50insC c.667_668insC p.(H223Pfs*41) "(NM_001103219.2: c.667_668insC or chr25: g.48150749_50insC" (van Buren et al. (2020) 2020 32531980
948 OMIA:000031-9615 dog Chow Chow (Dog) Sloughi (Dog) Thai Ridgeback (Dog) Dilute MLPH d^2 missense Naturally occurring variant yes CanFam3.1 25 g.48150787G>C c.705G>C p.(Q235H) 2018 29349785
1690 OMIA:002849-9940 sheep Manech Tête Rousse, France (Sheep) Methylmalonyl-CoA mutase deficiency MMUT nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 20 NC_040271.1:g.23776347G>A XM_004018875.4:c.1225C>T XP_004018923.1:p.(Q409*) 2024 38424485
1433 OMIA:000884-9031 chicken Rose comb MNR2 R2 complex rearrangement Naturally occurring variant no galGal3 7 g.16499781_16499782ins[23881384_23790414inv;16499583–16499781] predicted to be the result of a recombination event between the wild-type allele and the R1 allele: "R2 does not carry the entire inversion but instead has two duplicated segments, one 91 kb fragment (23,790,414–23,881,384 bp) that represents a remaining fragment of the inverted region together with a small duplicated fragment of 198 bp (16,499,583–16,499,781 bp)" 2012 22761584
745 OMIA:000884-9031 chicken Rose comb MNR2 R1 inversion Naturally occurring variant no galGal3 7 g.16499782_23881391delins23881384_16499781 published as a 7.38 Mb inversion 2012 22761584
492 OMIA:001819-9913 taurine cattle Brown Swiss (Cattle) Tiroler Grauvieh (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 24 g.20911933del c.1881del p.(S628Vfs9*) Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) 2016 27919260 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
446 OMIA:001819-9913 taurine cattle Japanese Black, Japan (Cattle) Xanthinuria, type II MOCOS deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 24 g.20936257_20936259del c.769_771del p.(Y257del) published as c.769_771delTAC 2000 10801779 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1356 OMIA:001819-9615 dog Cavalier King Charles Spaniel (Dog) English Cocker Spaniel (Dog) Xanthinuria, type II MOCOS deletion, small (<=20) Naturally occurring variant yes CanFam3.1 7 g.53989863del c.383del p.(A128Gfs*30) c.383delC; transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) 2021 34584846
1355 OMIA:001819-9615 dog Manchester Terrier (Dog) Xanthinuria, type II MOCOS splicing Naturally occurring variant yes CanFam3.1 7 g.53995018C>A c.232G>T p.(G48_Y77del) ENSCAFT00000028243.4; “Ensembl VEP determined the consequence of the variant to be a missense, splice region variant … the variant results in the removal of all 90 bp (30 amino acids) of exon 2 (p.Gly48_Tyr77del); the genomic position is based on supplementary table S3 (Tate et al., 2021)”; transcript ENSCAFT00000028243.4 2021 34584846
1357 OMIA:001819-9615 dog Dachshund (Dog) Xanthinuria, type II MOCOS missense Naturally occurring variant yes CanFam3.1 7 g.54001790A>G c.137T>C p.(L46P) transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) 2021 34584846
483 OMIA:001541-9913 taurine cattle Simmental (Cattle) Arachnomelia, BTA23 MOCS1 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 23 g.13837657_13837658del c.1224_1225del p.(H408Qfs*51) 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 rs383500843 2011 21255426 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
326 OMIA:001366-9031 chicken Retinal dysplasia and degeneration MPDZ nonsense (stop-gain) Naturally occurring variant yes GRCg6a Z g.31023848G>A c.1372C>T p.(R458*) 2011 21862650 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
342 OMIA:002028-9615 dog Italian Hound (Dog) Myeloperoxidase deficiency MPO nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 9 g.32929382G>A c.1936C>T p.(R646*) XM_847352.4; XP_852445.2; published as c.1987C>T (Ensembl transcript ID:ENSCAFT00000027699) 2016 27296514
1592 OMIA:002739-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, MPZ-related MPZ missense Naturally occurring variant yes UU_Cfam_GSD_1.0 38 g.22037876T>C c.434T>C p.(I145T) XM_038585926.1; XP_038441854.1; heterozygous in a single affected dog 2023 37400349
208 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 missense Naturally occurring variant yes ARS-UCD1.2 19 g.47089627T>G c.1906T>G p.(C636G) rs466131011 2012 22497452 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
491 OMIA:001452-9913 taurine cattle Belgian Blue (Cattle) Tail, crooked MRC2 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 19 g.47095176_47095177del c.2904_2905del p.(G934*) 2009 19779552 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del
1417 OMIA:002518-9913 taurine cattle Brown Swiss (Cattle) Haplotype with homozygous deficiency BH14 MRPL55 BH14 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 7 g.2996436C>T c.169C>T p.(R57*) NM_001303490.1 2021 34915862
1015 OMIA:002160-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MSH6-related MSH6 missense Naturally occurring variant unknown Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" 2018 30108684
212 OMIA:000683-9913 taurine cattle Gelbvieh (Cattle) Muscular hypertrophy (double muscling) MSTN missense Naturally occurring variant yes ARS-UCD1.2 2 g.6279187T>C c.191T>C p.(L64P) UMD3.1 position is g.6213889T>C rs449270213 2015 25515003 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
771 OMIA:000683-9913 taurine cattle Angus (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN missense Naturally occurring variant yes ARS-UCD1.2 2 g.6279278C>A c.282C>A p.(F94L) UMD3.1 position is g.6213980A>C rs110065568 1998 9501304 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
772 OMIA:000683-9913 taurine cattle Parthenais (Cattle) Muscular hypertrophy (double muscling) MSTN missense Naturally occurring variant yes ARS-UCD1.2 2 g.6279310C>G c.314C>G p.(S105C) UMD3.1 position is g.6214012C>G 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
618 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN nt419(del7-ins10) delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 2 g.6281243_6281249delinsAAGCATACAA c.419_425delinsAAGCATACAA p.(F140*) cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively 1998 9501304 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021)
773 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Muscular hypertrophy (double muscling) MSTN D182N missense Naturally occurring variant yes ARS-UCD1.2 2 g.6281368G>A c.544G>A p.(D182N) 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
299 OMIA:000683-9913 taurine cattle Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 2 g.6281434C>T c.610C>T p.(Q204*) UMD3.1 position is g.6216138C>T rs110344317 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
300 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 2 g.6281500G>T c.676G>T p.(E226*) UMD3.1 position is g.6216204G>T 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
489 OMIA:000683-9913 taurine cattle Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 2 g.6283674_6283684del c.821_831del p.(D273RfsX14) UMD3.1 position is g.6218379delATGAACACTCC rs382669990 1997 9288100 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021).
301 OMIA:000683-9913 taurine cattle Maine-Anjou (Cattle) Marchigiana (Cattle) Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 2 g.6283727G>T c.1004G>T p.(E291*) UMD3.1 position is g.6218432G>T 2013 22497537 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
203 OMIA:000683-9913 taurine cattle Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) Muscular hypertrophy (double muscling) MSTN missense Naturally occurring variant yes ARS-UCD1.2 2 g.6283794G>A c.938G>A p.(C313Y) UMD3.1 position is g.6218499G>A 1997 9314496 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" ( The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1019 OMIA:002161-9823 pig Large White (Pig) Leg weakness, MSTN-related MSTN nonsense (stop-gain) Naturally occurring variant yes Sscrofa11.1 15 g.94623834C>A c.820G>T p.(E274*) 2019 30699111
112 OMIA:001561-9615 dog Chinese Shar-Pei (Dog) Periodic Fever Syndrome MTBP missense Naturally occurring variant yes CanFam3.1 13 g.19383758G>A c.2623G>A p.(E875K) rs1152388482 2017 28472921 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
63 OMIA:001508-9615 dog Labrador Retriever (Dog) Myotubular myopathy 1 MTM1 missense Naturally occurring variant yes CanFam3.1 X g.118885117C>A c.465C>A p.(N155K) XM_005641935.3; XP_005641992.1 rs1152388426 2010 20682747 Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn
91 OMIA:001508-9615 dog Rottweiler (Dog) Myotubular myopathy 1 MTM1 missense Naturally occurring variant yes CanFam3.1 X g.118901282A>C c.1151A>C p.(Q384P) XM_005641935.3; XP_005641992.1 2015 25664165 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1459 OMIA:001508-9615 dog Boykin Spaniel (Dog) Myotubular myopathy 1 MTM1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 X g.118903496C>T c.1467C>T p.(R512*) ENSCAFP00000028221.3 2020 32417001
1475 OMIA:001508-9685 domestic cat Maine Coon (Cat) Myotubular myopathy 1 MTM1 missense Naturally occurring variant yes Felis_catus_9.0 X g.125938001C>T c.455C>T p.(A152V) XM_004000974.4; XP_004001023.1 2022 35962713
1591 OMIA:002727-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, MTMR2-related MTMR2 splicing Naturally occurring variant unknown UU_Cfam_GSD_1.0 21 g.5387227G>A c.1479+1G>A XM_038568229.1, reported in two dogs 2023 37400349
1524 OMIA:001467-9615 dog Golden Retriever (Dog) Neuropathy, sensory ataxic MTTY deletion, small (<=20) Naturally occurring variant yes M m.5304del 2009 19492087
437 OMIA:000175-9796 horse Arab (Horse) Bashkir Curly (Horse) Trakehner (Horse) Welsh Pony (Horse) Cerebellar abiotrophy MUTYH not known Naturally occurring variant yes EquCab3.0 2 g.13122415C>T c.541-13539C>T ENSECAT00000009202.3:c.541-13539C>T ENSECAT00000024892.2:c.284G>A ENSECAP00000020698.1:p.Arg95His A SNP "located in exon 4 of TOE1 and approximately 1200 base pairs upstream of MUTYH, adjacent to a possible binding site for the transcription factor GATA2" (Brault et al., 2011). EquCab3.1 coordinate provided by Meredith O’Connell, working under the supervision of Professor E. Bailey. rs397160943 2011 21126570
14 OMIA:001534-9031 chicken Resistance to myxovirus MX1 missense Naturally occurring variant no GRCg6a 1 g.110260061G>A c.1892G>A p.(S631N) rs313590198 2002 11932243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
217 OMIA:001978-9913 taurine cattle Holstein Friesian (Cattle) Arthrogryposis, distal, type 1B MYBPC1 missense Naturally occurring variant yes ARS-UCD1.2 5 g.65446598T>G c.884T>G p.(L295R) 2015 26289121 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
902 OMIA:000515-9685 domestic cat Ragdoll (Cat) Cardiomyopathy, hypertrophic MYBPC3 missense Naturally occurring variant yes Felis_catus_9.0 D1 g.101329646G>A c.2453C>T p.(R818W) XM_019812397.1; XP_019667956.1; published as p.(R820W); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17521870 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
901 OMIA:000515-9685 domestic cat Maine Coon (Cat) Munchkin (Cat) Scottish Fold (Cat) Cardiomyopathy, hypertrophic MYBPC3 missense Naturally occurring variant yes Felis_catus_9.0 D1 g.101340772C>G c.91G>C p.(A31P) XM_019812397.1; XP_019667956.1; variant initially reported in Main Coon cats and in a later study (Akiyama et al., 2023) identified in other breeds. 2005 16236761 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
973 OMIA:002141-9796 horse Quarter Horse (Horse) Immune-mediated myositis MYH1 missense Naturally occurring variant yes EquCab3.0 11 g.53345548T>C p.(E321G) The location of this likely causal variant was given as chr11:52,993,878T>C by Finno et al. (2018) in relation to the EquCab2.0 assembly. Applying NCBI's remap gives the EquCab3.0 coordinate as chr11:53,345,548 2018 29510741
1500 OMIA:002590-9913 taurine cattle Limousin (Cattle) Cleft palate MYH3 deletion, small (<=20) Naturally occurring variant unknown ARS-UCD1.2 19 g.[29609605-29609615del;29609623A>G] c.[2864T>C;2872_2882del] c.[I955T; p.L958Tfs*5] NM_001101835.1 2022 36309651
556 OMIA:002039-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), MYH6-related MYH6 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 10 g.21538917_21538919del p.(K1730del) 2016 27646536 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1121 OMIA:002212-9685 domestic cat Domestic Shorthair Cardiomyopathy, hypertrophic, MYH7-related MYH7 missense Naturally occurring variant yes Felis_catus_9.0 B3 g.76166296C>T c.5647G>A p.(E1883K) XM_006932746.4; XP_006932808.1 2019 31164718 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
598 OMIA:001200-9823 pig Tremor, high-frequency (Campus syndrome) MYH7 insertion, small (<=20) Naturally occurring variant yes Sscrofa11.1 7 g.75668349_75668350insGGCGGG c.4320_4321insCCCGCC p.(A1440_A1441insPA) 2012 23153285 The genomic location on Sscrofa10.2 was determined by Stephanie Shields (27/05/2020) and updated to the genomic Sscrofa11.1 location by Imke Tammen
55 OMIA:001608-9615 dog Pug (Dog) May-Hegglin anomaly MYH9 missense Naturally occurring variant yes CanFam3.1 10 g.28120346G>A c.5521G>A p.(E1841L) NM_001110767.1; NP_001104237.1; previously incorrectly listed in OMIA as p.(Q1841L) (corrected 11/2/2022) 2011 21554370 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1372 OMIA:001501-9615 dog Dachshund, Miniature (Dog) Coat colour dilution and neurological defects MYO5A insertion, small (<=20) Naturally occurring variant yes CanFam3.1 30 g.18004551_18004552insT c.4973_4974insA p.(N1658Kfs*28). cDNA and protein positions based on XM_022412522.1 and XP_022268230.1, respectively 2021 34680875
510 OMIA:001501-9796 horse Arab (Horse) Lavender foal syndrome MYO5A deletion, small (<=20) Naturally occurring variant yes EquCab3.0 1 g.139290592del c.4249del p.(R1417Afs*13) XM_023617258.1; XP_023473026.1; published as g.138235715delC; coordinates in the table have been updated to a recent reference genome 2010 20419149 The genomic position in EquCab3.0 was provided by Gracie Zinsmeister, working under the guidance of Professor Ernie Bailey in April 2022
1079 OMIA:002148-9615 dog Doberman Pinscher (Dog) Deafness, bilateral, and vestibular dysfunction MYO7A missense Naturally occurring variant yes CanFam3.1 21 g.21563111C>T c.3719G>A p.(R1240Q) 2019 31097876
1316 OMIA:002148-9823 pig Duroc (Pig) Vestibular dysfunction MYO7A nonsense (stop-gain) Naturally occurring variant yes Sscrofa11.1 9 g.11280403C>T c.541C>T p.(Q181*) cDNA position is based on transcript NM_001099928.1 2021 33955556
519 OMIA:001342-8790 emu Mucopolysaccharidosis IIIB NAGLU deletion, small (<=20) Naturally occurring variant yes c.1098_1099delGG 2001 11414757
202 OMIA:001342-9913 taurine cattle Santa Gertrudis (Cattle) Mucopolysaccharidosis IIIB NAGLU missense Naturally occurring variant yes ARS-UCD1.2 19 g.42624367G>A c.1354G>A p.(E452K) 2007 17458708 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
956 OMIA:001342-9615 dog Schipperke (Dog) Mucopolysaccharidosis IIIB NAGLU insertion, gross (>20) Naturally occurring variant yes CanFam3.1 9 g.20407670_20407671ins[A[(40_70)];20407660_20407670] c.2110_2111ins[A[(40_70)];2100_2110] XM_548088; an insertion of 40 to 70 A nucleotides and an 11bp duplication of the sequence directly upstream of the poly-A 2020 32081995
986 OMIA:001788-9615 dog Great Dane (Dog) Rottweiler (Dog) Leukoencephalomyelopathy NAPEPLD insertion, small (<=20) Naturally occurring variant yes CanFam3.1 18 g.16987327_16987328insC c.345_346insC p.(E116Rfs*186) 2018 29643404
985 OMIA:001788-9615 dog Leonberger (Dog) Leukoencephalomyelopathy NAPEPLD missense Naturally occurring variant yes CanFam3.1 18 g.16987520G>C c.538G>C p.(A180P) 2018 29643404
1469 OMIA:002557-9913 taurine cattle Cikasto govedo, Slovenia (Cattle) Leber optic neuropathy ND4L missense Naturally occurring variant yes m.10432T>C Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" 2019 Reference not in PubMed; see OMIA 002557-9913 for reference details
1315 OMIA:002348-9615 dog English Cocker Spaniel (Dog) Retinal dysplasia NDP insertion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.37950668_37950668insC c.653_654insC p.(M114Hfs*16) 2021 33945575
474 OMIA:002120-9615 dog Greyhound (Dog) Polyneuropathy NDRG1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 13 g.29691070_29691079del10 c.1080_1089del10 p.(R361Sfs*60) NM_001284434.1; NP_001271363.1 2010 20582309 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
73 OMIA:002120-9615 dog Alaskan Malamute (Dog) Polyneuropathy NDRG1 missense Naturally occurring variant yes CanFam3.1 13 g.29714606C>A c.293G>T p.(G98V) NM_001284434.1; NP_001271363.1 2013 23393557 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1679 OMIA:002840-9615 dog Mixed Breed (Dog) Leigh syndrome NDUFS7 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 20 g.57913322G>A c.535G>A p.(V179M) XM_038568001.1; XP_038423929.1 2024 38316835
961 OMIA:002137-9615 dog American Bulldog (Dog) Nemaline myopathy, NEB-related NEB nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 19 g.52734272G>T p.(S8042*) NP_001258137.1 2016 27215641
1083 OMIA:002198-9615 dog Giant Schnauzer (Dog) Progressive retinal atrophy, NECAP1-related NECAP1 missense Naturally occurring variant yes CanFam3.1 27 g.37468611G>A c.544G>A p.(G182R) 2019 31117272
316 OMIA:000545-93934 Japanese quail Hypotrophic axonopathy NEFL nonsense (stop-gain) Naturally occurring variant yes c.352C>T p.(Q114*) 1993 8468353
632 OMIA:000218-9615 dog Collie eye anomaly NHEJ1 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 37 g.25698028_25705826del c.588+462_588+8260del XM_005640671.1; a deletion of 7799bp in the NHEJ1 gene; for limitations on the utility of testing for the published likely causal variant, see the results of Fredholm et al. (2016) and Brown et al. (2018) 2007 17916641
756 OMIA:000690-9615 dog Beagle (Dog) Chihuahua (Dog) Dachshund, Miniature Wire-Haired (Dog) Newfoundland (Dog) Pembroke Welsh Corgi (Dog) Myoclonus epilepsy of Lafora NHLRC1 repeat variation Naturally occurring variant yes 35 19 to 26 copies of a sequence of 12 nucleotides (12-mer; dodecamer) in the canine EPM2B gene (now called NHLRC1) 2005 15637270
766 OMIA:002103-9913 taurine cattle Angus (Cattle) Developmental duplications NHLRC2 missense Naturally occurring variant yes ARS-UCD1.2 26 g.34340886T>C c.932T>C p.(V311A) 2014 Reference not in PubMed; see OMIA 002103-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
679 OMIA:001936-9913 taurine cattle Romagnola (Cattle) Cataract, recessive, Romagnola NID1 deletion, gross (>20) Naturally occurring variant yes 28 "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" 2014 25347398
563 OMIA:001980-9615 dog American Bulldog (Dog) American Bully (Dog) Ichthyosis, NIPAL4-related NIPAL4 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 4 g.52737379del c.744delC p.(I249*) 2017 28122049
622 OMIA:000938-9615 dog Weimaraner (Dog) Spinal dysraphism NKX2-8 delins, small (<=20) Naturally occurring variant yes CanFam3.1 8 g.15149895delinsAA c.449delinsTT p.(A150Vfs*6) XM_847109.4; XP_852202.1 2013 23874236
1370 OMIA:002464-9823 pig Large White (Pig) Cryopyrin-associated periodic syndrome NLRP3 missense Genome editing (CRISPR/Cpf1) yes 2 p.(R259W) 2020 32958688
1096 OMIA:002206-9615 dog Alaskan Malamute (Dog) Ciliary dyskinesia, primary, NME5-related NME5 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 11 g.25792084del c.43delA p.(T15Lfs*56) XM_003639378.4:c.43delA; XP_003639426.1:p.(Thr15LeufsTer56) 2019 31479451
664 OMIA:001101-9031 chicken Polymorphic Nucleolar [PNU] strain, United States of America (Chicken) Ribosomal RNA deficiency NOR deletion, gross (>20) Naturally occurring variant yes "Embryos exhibiting a nucleolar phenotype of one large and one very small nucleolus (Pp) are heterozygous for a reduced rDNA cluster (+/p1) and were shown in the present study to contain about 66% of the complement of rRNA genes in normal individuals (+/+) that show two large equal-sized nucleoli (PP)" 1994 8014461
1244 OMIA:000725-9913 taurine cattle Angus (Cattle) Niemann-Pick type C1 NPC1 missense Naturally occurring variant yes ARS-UCD1.2 24 g.33099467C>G c.2969C>G p.(P990R) NM_174758.2:c.2969C>G rs482882512 2020 32970694
134 OMIA:000725-9685 domestic cat Domestic Shorthair Niemann-Pick disease, type C1 NPC1 missense Naturally occurring variant yes Felis_catus_9.0 D3 g.48234217C>G c.2864G>C p.(C955S) 2003 12809639 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
146 OMIA:000725-9685 domestic cat Domestic Shorthair Niemann-Pick disease, type C1 NPC1 missense Naturally occurring variant yes Felis_catus_9.0 D3 g.48250290T>G c.1322A>C p.(H441P) 2017 28233346 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1572 OMIA:002065-9685 domestic cat Japanese domestic Siamese (Cat) Niemann-Pick disease, type C2 NPC2 missense Naturally occurring variant unknown Felis_catus_9.0 B3 g.121865210G>A c.367G>A p.(V126M) XM_003987833.6; XP_003987882.1 2023 37458497
420 OMIA:002065-9685 domestic cat Niemann-Pick disease, type C2 NPC2 splicing Naturally occurring variant yes Felis_catus_9.0 B3 g.121872988C>T c.82+5G>A p.(G28_S29ins35) 2014 25396745 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
634 OMIA:001455-9615 dog Dachshund, Miniature Wire-Haired (Dog) Dachshund, Standard Wire-Haired (Dog) Cone-rod dystrophy, Standard Wire-haired Dachshund NPHP4 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 5 g.59912991_59913168del c.479_526+130del NM_001135788.1; 178-bp deletion in exon/intron 5 of NPHP4 (nephronophthisis 4, also known as nephroretinin) 2008 18687878
1171 OMIA:002254-9615 dog Mixed Breed (Dog) Glucocorticoid resistance NR3C1 splicing Naturally occurring variant yes 2 c.2032_2033insN[69] An insertion of "69 nucleotides between nucleotides 2032 and 2033 compared with dog wild type GR [i.e. NR3C1]. These extra 69 nucleotides matched a part of the nucleotide sequence of dog genomic DNA corresponding to intron 6 . . . . Insertion of these extra 69 nucleotides between exons 6 and 7 introduced a frameshift and a premature termination codon (TGA) 15 bp downstream of the insertion. This insertion is thus predicted to result in a truncated protein of 682 amino acids, compared to the normal (wild type) 780 amino acids" (Yamanaka et al., 2019) The cause of this splice variant could not be determined in genomic DNA. 2019 31651346
1264 OMIA:002296-9615 dog Yorkshire Terrier (Dog) XY difference of sexual development, NR5A1-related NR5A1 deletion, gross (>20) Naturally occurring variant yes 9 "a large deletion consisting of four exons of the NR5A1 gene" (Nowacka-Woszuk et al., 2020) 2020 33128907
790 OMIA:002117-9615 dog Labrador Retriever (Dog) CHILD-like syndrome NSDHL deletion, gross (>20) Naturally occurring variant yes CanFam3.1 X g.120749179_120763577del c.507+220_*9662del XM_005641965.1; deletion of 14,399bp 2017 28739597
1243 OMIA:002117-9615 dog Chihuahua (Dog) Verrucous epidermal keratinocytic nevi NSDHL missense Naturally occurring variant yes CanFam3.1 X g.120752468G>A c.700G>A p.(G234R) CanFam3.1 ChrX:120,752,468G>A; XM_014111859.2:c.700G>A; XP_013967334.1: p.Gly234Arg 2019 31571289
1268 OMIA:002117-9615 dog Chihuahua (Dog) Verrucous epidermal keratinocytic nevi NSDHL deletion, small (<=20) Naturally occurring variant yes CanFam3.1 X g.120752486_120752490del c.718_722delGAACA p.(E240Pfs*17) NC_006621.3: g.120,752,486_120,752,490delGAACA; XM_014111859.2:c.718_722delGAACA; XP_013967334.1:p.(Glu240Profs*17) (Christen et al., 2020) 2020 33143176
1055 OMIA:002117-9685 domestic cat Domestic Shorthair Inflammatory linear verrucous epidermal nevi NSDHL missense Naturally occurring variant yes Felis_catus_9.0 X g.127926365A>G c.397A>G p.(S133G) XM_004000985.5; XP_004001034.1 2019 30474267 Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley.
1686 OMIA:002117-9615 dog Appenzeller Sennenhund (Dog) Verrucous epidermal keratinocytic nevi NSDHL deletion, gross (>20) Naturally occurring variant yes UU_Cfam_GSD_1.0 X UU_Cfam_GSD_1.0;  large heterozygous deletion of at least 120 kb at ChrX:121.96-122.08 Mb; a more complex structural rearrangement is possible 2024 38659285
1410 OMIA:002509-9913 taurine cattle Simmental (Cattle) Haplotype with homozygous deficiency SH9 NUBPL SH9 missense Naturally occurring variant yes ARS-UCD1.2 21 g.42154344C>A c.428C>A p.(S143Y) NM_001193042.1 2021 34944310
1468 OMIA:002556-9913 taurine cattle Chianina (Cattle) Double-outlet right ventricle NUMB missense Naturally occurring variant yes ARS-UCD1.2 10 g.84751870G>A c.416C>T p.(T139M) NM_001101951.1; NP_001095421.1 2022 35748177
555 OMIA:002035-9913 taurine cattle Jersey (Cattle) Abortion (embryonic lethality), OBFC1-related OBFC1 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 26 g.24461804_24461805del c.379_380del p.(K127Vfs*29) rs455647476 2016 27646536 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del
1242 OMIA:001595-9940 sheep Merino (Sheep) Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 2 g.236304072del c.1716del p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
1602 OMIA:002130-9544 Rhesus monkey Coat colour, oculocutaneous albinism OCA2 missense Naturally occurring variant yes c.2363C>T p.(S788L) 2020 32259106
846 OMIA:002130-9615 dog German Spitz (Dog) Coat colour, oculocutaneous albinism, OCA2-related OCA2 splicing Naturally occurring variant yes CanFam3.1 3 g.31715704A>C "LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G) . . . Comparative sequence analyses revealed that LOC100855460 actually represents the 5'-end of the canine OCA2 gene. The CanFam 3.1 reference genome assembly is incorrect and separates the first two exons from the remaining exons of the OCA2 gene. We amplified a canine OCA2 cDNA fragment by RT-PCR and determined the correct full-length mRNA sequence (LT844587.1)." 2017 28973042
288 OMIA:000162-9913 taurine cattle Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) Cardiomyopathy, dilated OPA3 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 18 g.53152213G>A c.343C>T p.(Q115*) UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 rs479222100 2011 20923700 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
1141 OMIA:002227-9940 sheep Istrska pramenka (Sheep) Otocephaly OTX2 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 7 g.71478714G>A c.265C>T p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
454 OMIA:001564-9615 dog Greater Swiss Mountain Dog (Dog) Bleeding disorder, P2RY12-related P2RY12 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 23 g.45909987_45909989del c.516_518del p.(S173del) NM_001003365.1; NP_001003365.1; c.516_518delCTC; "a 3 base-pair deletion predicted to result in elimination of a serine from the extracellular domain was identified in the gene encoding P2RY12" 2011 21554368
103 OMIA:002031-9615 dog Lundehund (Dog) Lundehund syndrome P3H2 missense Naturally occurring variant yes CanFam3.1 34 g.22046092C>G c.1849G>C p.(E617Q) XM_535843.6; XP_535843.2 2016 27485430
428 OMIA:001437-9913 taurine cattle Brown Swiss (Cattle) Beta-lactoglobulin, aberrant low expression PAEP regulatory Naturally occurring variant yes ARS-UCD1.2 11 g.103255964C>A c.-215C>A "C to A transversion at position 215 bp upstream of the translation initiation site" 2006 17033029 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1659 OMIA:001688-9685 domestic cat Dominant blue eye colour PAX3 unpublished Naturally occurring variant no C1 2024 Reference not in PubMed; see OMIA 001688-9685 for reference details
1605 OMIA:001688-9796 horse Purebred Spanish (Horse) Splashed white PAX3 SW10 nonsense (stop-gain) Naturally occurring variant unknown EquCab3.0 6 g.11196181G>A c.583C>T p.(R195*) XM_005610643.3; XP_005610700.1; association with increased depigmentation, published as c.927C>T 2023 37406837
791 OMIA:001688-9796 horse Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) Splashed white PAX3 SW2 missense Naturally occurring variant no EquCab3.0 6 g.11199026C>T c.209G>A p.(C70Y) 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
978 OMIA:001688-9796 horse Appaloosa (Horse) Splashed white PAX3 SW4 missense Naturally occurring variant no EquCab3.0 6 g.11199140G>C c.95C>G p.(P32R) 2013 23659293
1685 OMIA:001688-9685 domestic cat Celestial Maine Coon (Cat) Siberian (Cat) Blue eye colour, domianant PAX3 DBE insertion, gross (>20) Naturally occurring variant no Felis_catus 9.0 C1 NC_018730.3:g.206974029_206974030insN[395] 2024 38644700
583 OMIA:001575-9615 dog Gordon Setter (Dog) Irish Setter (Dog) Old Danish Pointing Dog (Dog) Polish Lowland Sheepdog (Dog) Polish Tatra Sheepdog (Dog) Poodle, Miniature (Dog) Poodle, Standard (Dog) Tibetan Terrier (Dog) Rod-cone dysplasia 4 PCARE insertion, small (<=20) Naturally occurring variant yes CanFam3.1 17 g.22907394_22907395insG c.3149_3150insC p.(C1051Vfs*90) NM_001284459.1; NP_001271388.1; genomic position adjusted based on HGVS 3' rule; EVA variant with equivalent alleles: rs397510935 rs1152388416 2013 22686255
1443 OMIA:002548-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Deficiency of haplotype HH35 PCDH15 missense Naturally occurring variant yes ARS-UCD1.2 26 g.5325675C>G c.2599C>G p.(L867V) XM_015460562.2; XP_015316048.2 2022 35361830
1515 OMIA:002606-9615 dog Vizsla (Dog) skeletal dysplasia 3 PCYT1A missense Naturally occurring variant yes UU_Cfam_GSD_1.0 33 g.30067814A>G c.673T>C p.Y225H XM_038583131.1; XP_038439059.1 2022 36553621
1662 OMIA:002728-9615 dog Saarloos Wolfhond (Dog) PCYT2 deficiency PCYT2 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 9 g.1207490A>G c.4A>G p.(I2V) XM_038546296.1; XP_038402224.1 2024 38277988
475 OMIA:001314-9615 dog Cardigan Welsh Corgi (Dog) Chinese Crested (Dog) Pomeranian (Dog) Rod-cone dysplasia 3 PDE6A deletion, small (<=20) Naturally occurring variant yes CanFam3.1 4 g.59145362del c.1847del p.(N616Tfs*29) NM_001003073.1; NP_001003073.1; published as c.1940delA (based on GenBank Z68340); variant initially identified in Cardigan Welsh Corgi and later reported in additional breeds: PMID:27525650 1999 10393029 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
582 OMIA:001669-9615 dog Sloughi (Dog) Rod-cone dysplasia 1a PDE6B insertion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.91747685_91747686insACTTCAGG c.2448_2449insTGAAGTCC p.(K817*) NM_001002934.2; NP_001002934.2; "an 8-bp insertion after codon 816" of the PDE6B gene 2000 11124530
282 OMIA:000882-9615 dog Irish Setter (Dog) Rod-cone dysplasia 1 PDE6B nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 3 g.91747713C>T c.2421G>A p.(W807*) NM_001002934.1; NP_001002934.1 1993 8387203
528 OMIA:001674-9615 dog American Staffordshire Terrier (Dog) Cone-rod dystrophy 1 PDE6B deletion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.91747728_91747730del c.2404_2406del p.(802del) NM_001002934.1; NP_001002934.1 2013 24045995
1230 OMIA:002282-9615 dog Spanish Water Dog (Dog) PRA, PDE6B-related PDE6B deletion, small (<=20) Naturally occurring variant yes CanFam3.1 3 g.91749865_91749870del c.2218-2223del p.(F740_F741del) NM_001002934.1; NP_001002934.1 2020 32639685
1022 OMIA:002163-9544 Rhesus monkey Cone dystrophy 4, PDE6C-related PDE6C missense Naturally occurring variant yes Mmul_8.0.1 9 p.(R565Q) 2019 30667376
281 OMIA:001406-9615 dog Clumber Spaniel (Dog) Sussex Spaniel (Dog) Pyruvate dehydrogenase deficiency PDP1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 29 g.38788845C>T c.829C>T p.(Q277*) XM_005638127.1; XP_005638184.1; published as c.754C>T, p.(Q252*); coordinates in the table have been updated to a recent reference genome and / or transcript 2007 17095275
1461 OMIA:002552-9940 sheep Pancreatic agenesis PDX1 deletion, gross (>20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 10 g.33940517_33940724del c.195_403del XM_027973895.1; 208bp deletion 2017 29234093
1278 OMIA:002303-9685 domestic cat Cerebral dysgenesis PEA15 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 F1 g.66768324del c.176del p.(N59Tfs*29) XM_023247767.1; XP_023103535.1; published as felCat9 chrF1:66768323 GT -> G; c.176delA by Graff et al. (2020) 2020 33290415
820 OMIA:001827-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH1 PFAS missense Naturally occurring variant yes ARS-UCD1.2 19 g.27895397C>T c.3613C>T p.(R1205C) rs455876205 2017 28803020 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
271 OMIA:000421-9615 dog American Cocker Spaniel (Dog) English Springer Spaniel (Dog) Whippet (Dog) Glycogen storage disease VII PFKM nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 27 g.6620819C>T c.2228G>A p.(W473*) NM_001003199.1; NP_001003199.1 1996 8702726 Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn
45 OMIA:000421-9615 dog Deutscher Wachtelhund (Dog) Glycogen storage disease VII PFKM missense Naturally occurring variant yes CanFam3.1 27 g.6631627G>A c.550C>T p.(R184W) NM_001003199.1; NP_001003199.1 2012 22446493 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
1288 OMIA:001128-9823 pig Duroc (Pig) Pale soft exudative meat PHKG1 splicing Naturally occurring variant yes Sscrofa11.1 3 g.16830320C>A c.919-5C>A ENSSSCT00000008491.4:c.919-5C>A Ma et al. 2014: "a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon" rs330928088 2014 25340394
406 OMIA:001953-9913 taurine cattle Belgian Blue (Cattle) Arthrogryposis, lethal syndrome PIGH splicing Naturally occurring variant yes ARS-UCD1.2 10 g.79469727G>C c.211-10C>G rs451004237 2015 25895751 Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
109 OMIA:002084-9615 dog Soft Coated Wheaten Terrier (Dog) Dyskinesia, paroxysmal, PIGN PIGN missense Naturally occurring variant yes CanFam3.1 1 g.14705240C>T c.398C>T p.(T133I) XM_022415750.1; XP_022271458.1 2016 27891564 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1305 OMIA:002324-9615 dog Parson Russell Terrier (Dog) Epilepsy, mitochondrial dysfunction and neurodegeneration PITRM1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 2 g.32188565_32188570del c.175_180del p.(L59_S60del) ENSCAFT00000008673; ENSCAFT00000008673.4 2021 33835239
232 OMIA:000649-9940 sheep Texel (Sheep) Microphthalmia PITX3 missense Naturally occurring variant yes Oar_rambouillet_v1.0 22 g.25497953C>G c.338G>C p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1404 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^insG/+ insertion, small (<=20) Genome-editing (CRISPR-Cas9) yes 3 c.152_153insG 2022 34980882
1406 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^Tins/+ insertion, small (<=20) Genome-editing (ZFN) yes 3 c.642_643insT 2015 25798056
1405 OMIA:000807-9823 pig Polycystic kidney disease PKD1 PKD1^TGCTins/+ insertion, small (<=20) Genome-editing (ZFN) yes 3 c.642_643insTGCT 2015 25798056
72 OMIA:000807-9615 dog Bull Terrier (Dog) Polycystic kidney disease PKD1 missense Naturally occurring variant yes CanFam3.1 6 g.38856816G>A c.9559G>A p.(E3187K) rs397509460 2011 21818326 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1610 OMIA:000807-9685 domestic cat Scottish Fold (Cat) Polycystic kidney disease PKD1 delins, small (<=20) Naturally occurring variant yes Felis_catus_9.0 E3 g.42848725del c.5250del p.(G1641fs) variant reported in a single cat 2023 37489504
1611 OMIA:000807-9685 domestic cat American Shorthair (Cat) Polycystic kidney disease PKD1 missense Naturally occurring variant yes Felis_catus_9.0 E3 g.42850283C>T c.6808C>T p.(R2162W) variant reported in a single cat 2023 37489504
314 OMIA:000807-9685 domestic cat American Shorthair (Cat) Exotic Shorthair (Cat) Munchkin (Cat) Persian (Cat) Scottish Fold (Cat) Polycystic kidney disease PKD1 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 E3 g.42858112C>A c.9882C>A p.(C3294*) This variant was published as c.10063C>A, p.(C3284*); positions in this table are based on NC_018738.3 and XP_023102816.1, respectively. The varaint has been initially identified in Persian cats but has since been reported in other breeds, e.g. PMID:31155548; PMID:37489504 2004 15466259
1585 OMIA:000807-9615 dog Lagotto Romagnolo (Dog) Polycystic kidney disease PKD1 nonsense (stop-gain) Naturally occurring variant yes UU_Cfam_GSD_1.0 6 g.39295382G>T c.7195G>T p.(E2399*) NM_001006650.1; NP_001006651.1 2023 37372390
1523 OMIA:002525-9823 pig PKD2 overexpression PKD2 insertion, gross (>20) Genome-editing (CRISPR-Cas9) yes insertion of transgene vector pCAG-muhPKD2 (c.1532A > T/p.511D > V)-3 × FLAG-floxP-neo-pH11 into the pH11 safe harbor site 2022 36452154
1424 OMIA:002525-9685 domestic cat Siberian (Cat) Polycystic kidney disease 2 PKD2 deletion, small (<=20) Naturally occurring variant yes Felis_catus_9.0 B1 g.134992553del c.2211del (p.K737Nfs*2) XM_011281830.3; XP_011280132.2; published as c.2211delG 2021 33785770
897 OMIA:000844-9615 dog Basenji (Dog) Pyruvate kinase deficiency of erythrocyte PKLR deletion, small (<=20) Naturally occurring variant yes CanFam3.1 7 g.42267825del c.433del p.(P145Rfs*23) NM_001256262.1; NP_001243191.1 1994 7520391
896 OMIA:000844-9615 dog Labrador Retriever (Dog) Pyruvate kinase deficiency of erythrocyte PKLR nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 7 g.42268632C>T c.799C>T p.(Q267*) NM_001256262.1; NP_001243191.1 2012 22805166 20181218 Thanks to Maarten de Groot for advising FN of the genomic location
894 OMIA:000844-9615 dog Pug (Dog) Pyruvate kinase deficiency of erythrocyte PKLR missense Naturally occurring variant yes CanFam3.1 7 g.42268681T>C c.848T>C p.(V283A) NM_001256262.1; NP_001243191.1 2012 22805166
895 OMIA:000844-9615 dog Beagle (Dog) Pyruvate kinase deficiency of erythrocyte PKLR missense Naturally occurring variant yes CanFam3.1 7 g.42268927G>A c.994G>A p.(G332S) NM_001256262.1; NP_001243191.1 2012 22805166
898 OMIA:000844-9615 dog West Highland White Terrier (Dog) Pyruvate kinase deficiency of erythrocyte PKLR insertion, small (<=20) Naturally occurring variant yes CanFam3.1 7 g.42269752_42269757dup c.1333_1338dup p.(K445_T446dup) NM_001256018.1; NP_001242947.1; the original publication described "a 6 base pair insertion in exon 10". In accordance with HGVS recommendations, the variant is annotated in this table as a 6 bp duplication and updated a recent reference sequences. This shifts the position of the predicted amino acid change by about 21 amino acids. 1999 10490091
899 OMIA:000844-9685 domestic cat Abyssinian (Cat) Bengal (Cat) Egyptian Mau (Cat) LaPerm (Cat) Maine Coon (Cat) Norwegian Forest Cat (Cat) Savannah (Cat) Siberian (Cat) Singapura (Cat) Somali (Cat) Pyruvate kinase deficiency of erythrocyte PKLR splicing Naturally occurring variant yes Felis_catus_9.0 F1 g.70310110G>A c.707-53G>A XM_023247386.1:c.707-53G>A; published as c.693+304G>A 2012 23110753 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770); Grahn et al. (2012) reported that the variant is present in many breeds and suggested genotyping in Bengals, Egyptian Maus, La Perms, Maine Coon cats, Norwegian Forest cats, Savannahs, Siberians, and Singapuras,
417 OMIA:001864-9615 dog Chesapeake Bay Retriever (Dog) Golden Retriever (Dog) Ectodermal dysplasia/skin fragility syndrome PKP1 splicing Naturally occurring variant yes CanFam3.1 7 g.1966531C>G c.202+1G>C 2012 22384142 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
113 OMIA:002105-9615 dog Papillon (Dog) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 missense Naturally occurring variant yes CanFam3.1 10 g.26544820G>A c.1579G>A p.(T527A) 2017 28107443 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1267 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 nonsense (stop-gain) Naturally occurring variant yes Oar_rambouillet_v1.0 3 g.230750869G>A c.1186C>T p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
1266 OMIA:002105-9940 sheep Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) Neuroaxonal dystrophy, PLA2G6-related PLA2G6 splicing Naturally occurring variant unknown Oar_rambouillet_v1.0 3 g.230766713T>C c.336-2A>G p.(L71Wfs*3) Oar_rambouillet_v1.0: g.230766713T>C; XM_012175630.3: c.336-2A>G; XP_012031020.2: p.Leu71TrpfsTer3 (Letko et al., 2020) 2021 33159255
339 OMIA:001935-9913 taurine cattle Simmental (Cattle) Zinc deficiency-like syndrome PLD4 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 21 g.69352995G>A c.702G>A p.(W234*) UMD3.1 position is g.71001232G>A rs378824791 2014 25052073 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
351 OMIA:002080-9615 dog Eurasier (Dog) Epidermolysis bullosa, simplex, PLEC PLEC nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 13 g.37461941C>T c.3947G>A p.(W1316*) CanFam3 chr13: g.37461941G>A; XM_539204.6:c.3947G>A; XP_539204.2:p.Trp1316Stop: 2016 27878870 Updated variant coordinates kindly provided by Tosso Leeb on 8 May 2020
412 OMIA:002020-9615 dog Scottish Terrier (Dog) Ligneous membranitis PLG splicing Naturally occurring variant yes 1 c.1256+2T>A possibly NM_001286960.1 c.1262+2T>A; CanFam3.1 g.49514382A>T 2015 26360520
1338 OMIA:002020-9615 dog Maltese (Dog) Ligneous membranitis PLG deletion, gross (>20) Naturally occurring variant yes CanFam3.1 1 g.49534880_49540865del c.-5645_49+292del XM_005615560.1; a deletion of 5986 bp involving exon 1 and the flanking region 2021 34370320
1078 OMIA:002195-9615 dog Welsh Springer Spaniel (Dog) Cardiomyopathy, dilated, PLN-related PLN missense Naturally occurring variant yes CanFam3.1 1 g.58588129C>T c.26G>A p.(R9H) NM_001003332.1; NP_001003332.1 2019 30794913 c. coordinate kindly provided by Tosso Leeb
165 OMIA:001982-9796 horse Thoroughbred (Horse) Warmblood breeds Fragile Foal Syndrome PLOD1 missense Naturally occurring variant yes EquCab3.0 2 g.39927817C>T c.2032G>A p.(G678R) rs1136065234 2015 25637337 rsID and Variant coordinates obtained from Zhang et al. (2020): "g.39927817C>T (rs1136065234; NC_009145.3, Equ-Cab3.0)" c. and p. coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
248 OMIA:000770-9986 rabbit Chinchilla (Rabbit) Tremor, X-linked PLP1 pt missense Naturally occurring variant yes X T>A 1994 7525875
82 OMIA:000770-9615 dog Springer Spaniel (Dog) Tremor, X-linked PLP1 missense Naturally occurring variant yes CanFam3.1 X g.77200833A>C c.110A>C p.(H37P) 1990 1723945 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1493 OMIA:002578-9913 taurine cattle Holstein (black and white) (Cattle) Mast cell tumour, congenital PLP2 missense Naturally occurring variant yes ARS-UCD1.2 X g.87216480C>T c.50C>T p.(T17I) NM_203363.1; XP_005642144.1 2022 36139188
697 OMIA:000211-9615 dog Classic Merle PMEL M insertion, gross (>20) Naturally occurring variant yes 10 "an insertion of a tRNA-derived SINE . . . . The insertion occurs at the boundary of intron 10 and exon 11 and is flanked by a 15-bp target site duplication . . . . The SINE insertion is in reverse orientation, with the 5' end closer to exon 11." Allele M (265-269bp); phenotype = Classic Merle = "standard" of Murphy et al. (2018) 2006 16407134
1103 OMIA:000211-9615 dog No Merle pattern - solid coat PMEL Mc insertion, gross (>20) Naturally occurring variant no 10 Mc (208-230bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
1104 OMIA:000211-9615 dog No Merle pattern - solid coat PMEL Mc+ insertion, gross (>20) Naturally occurring variant no 10 Mc+ (231-245bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
1105 OMIA:000211-9615 dog No Merle pattern - diluted - brownish hue PMEL Ma insertion, gross (>20) Naturally occurring variant no 10 Ma (247-254bp); phenotype = No Merle pattern – diluted–brownish hue; = "cryptic" of Murphy et al. (2018) 2018 30235206
1106 OMIA:000211-9615 dog Muted, undefined, diluted - brownish hue PMEL Ma+ insertion, gross (>20) Naturally occurring variant no 10 Ma+ (255-264bp); phenotype = Muted, undefined, diluted–brownish hue = "dilute" of Murphy et al. (2018) 2018 30235206
1107 OMIA:000211-9615 dog Minimal Merle, areas deleted to white, tweed PMEL Mh insertion, gross (>20) Naturally occurring variant yes 10 Mh (269-277bp); phenotype = Minimal Merle, areas deleted to white, tweed = "harlequin" of Murphy et al. (2018) 2018 30235206
1166 OMIA:001544-9913 taurine cattle Rat-tail syndrome PMEL deletion, small (<=20) Naturally occurring variant unknown ARS-UCD1.2 5 g.57345302_57345304del c.50_52del p.(L19del) rs385468954 2016 27037038
903 OMIA:001438-9796 OMIA:000733-9796 horse American Miniature Horse (Horse) Ardennes (Horse) Comtois (Horse) Iceland Pony (Horse) Missouri Fox Trotter, Germany (Horse) Morgan (Horse) Rocky Mountain, United States of America (Bighorn sheep) Coat colour, silver AND Multiple congenital ocular anomalies PMEL missense Naturally occurring variant no EquCab3.0 6 g.74569773G>A c.1849C>T p.(R617C) NM_001163889.1; NP_001157361.1; previously listed in OMIA as g.73665304 and published a C (wild type) to T (Silver) transition, p.Arg618Cys, as well as p.(R625C); coordinates in this table have been updated to a recent reference genome and / or transcript rs3448111155 2006 17029645 The genomic position in EquCab3.0 was provided by Mary Katherine Easterwood, working under the guidance of Professor Ernie Bailey in April 2022
1054 OMIA:002183-9823 pig Landrace (Pig) Embryonic lethality PNKP missense Naturally occurring variant yes Sscrofa11.1 6 g.54880241T>C p.(Q96R) Derks et al. (2019): "deleterious missense mutation in the PNKP gene (6:g.54880241G>T), predicted to be strongly deleterious by SIFT (0.02) and PROVEAN (-2.9). The missense mutation causes a glutamine to arginine amino acid substitution (ENSSSCP00000003467:p.Gln96Arg)" 2019 30875370
616 OMIA:001588-9615 dog Golden Retriever (Dog) Ichthyosis, PNPLA1-related PNPLA1 delins, small (<=20) Naturally occurring variant yes CanFam3.1 12 g.5417388_5417390delinsTACTACTA c.1445_1447delinsTACTACTA p.(N482Ifs*11) NM_001290109.2; NP_001277038.2 2012 22246504
765 OMIA:000827-9913 taurine cattle Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Progressive degenerative myeloencephalopathy (Weaver syndrome) PNPLA8 missense Naturally occurring variant yes ARS-UCD1.2 4 g.49600585C>T c.1703G>A p.(S568N) rs800397662 2016 26992691 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1470 OMIA:000827-9615 dog Australian Shepherd (Dog) hereditary ataxia PNPLA8 duplication Naturally occurring variant yes CanFam3.1 18 g.12143242_12143243dup c.1169_1170dup p.(H391Ffs*4) XM_005630935.2; XP_005630992.1 2022 35864734
1052 OMIA:002181-9823 pig Landrace (Pig) Embryonic lethality POLR1B splicing Naturally occurring variant yes Sscrofa11.1 3 g.43952776T>G Derks et al. (2019): "Skipping of exon 14 introduces a glutamic acid and a premature stop codon in the second codon of the terminal exon, lacking the final 370 amino acids located in the conserved subunit 2, hybrid-binding domain (binding to the DNA strand)" 2019 30875370
1291 OMIA:002315-9615 dog Karelian Bear Dog (Dog) Pituitary dwarfism POU1F1 splicing Naturally occurring variant yes CanFam3.1 31 g.784534C>A c.605-3C>A Kyöstilä et al. (2021) "the NNSPLICE 0.9 splice prediction tool (Reese et al. 1997) predicted this variant to weaken the splice acceptor of POU1F1 intron 4 from a score of 0.97 to 0.67." 2021 33550451
157 OMIA:000327-9796 horse Quarter Horse (Horse) Ehlers-Danlos syndrome PPIB missense Naturally occurring variant yes EquCab3.0 1 g.129307092G>A c.115G>A p.(G39R) rs396329681 2007 17498917 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
588 OMIA:000161-9913 taurine cattle Polled Hereford (Cattle) Cardiomyopathy and woolly haircoat syndrome PPP1R13L duplication Naturally occurring variant yes ARS-UCD1.2 18 g.53013747_53013753dup c.956-962dupACAGGCG p.(G335Efs*36) 2009 19016676 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
423 OMIA:001504-9615 dog Italian Cane Corso (Dog) Neuronal ceroid lipofuscinosis, 1 PPT1 splicing Naturally occurring variant yes CanFam3.1 15 g.2860424G>A c.124+1G>A 2017 28008682
1068 OMIA:001311-9615 dog Miniature Schnauzer (Dog) Photoreceptor dysplasia PPT1 PPT1^dci complex rearrangement Naturally occurring variant yes CanFam3.1 15 g.2874661_2875048con2877563_2877607inv 2019 30541930
579 OMIA:001504-9615 dog Dachshund (Dog) Neuronal ceroid lipofuscinosis, 1 PPT1 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 15 g.2883477_2883478insC c.736_737insC p.(F246Lfs*29) NM_001010944.1; NP_001010944.1 2010 20494602 p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1353 OMIA:001504-9940 sheep Neuronal ceroid lipofuscinosis, 1 PPT1 delins, small (<=20) Genome-editing (CRISPR-Cas9) yes Oar_rambouillet_v1.0 1 g.15235231_15235231delinsTTA p.(R151X) 2019 31289301
76 OMIA:001298-9615 dog American Cocker Spaniel (Dog) Australian Cattle Dog (Dog) Australian Shepherd (Dog) Australian Stumpy Tail Cattle Dog (Dog) Chesapeake Bay Retriever (Dog) Chinese Crested (Dog) English Cocker Spaniel (Dog) Entlebucher Mountain Dog (Dog) Finnish Lapphund (Dog) Golden Retriever (Dog) Karelian Bear Dog (Dog) Kuvasz (Dog) Labrador Retriever (Dog) Lapponian Herder (Dog) Norwegian Elkhound (Dog) Nova Scotia Duck Tolling Retriever (Dog) Poodle, Miniature (Dog) Poodle, Toy (Dog) Portuguese Podengo (Dog) Portuguese Water Dog (Dog) Spanish Water Dog (Dog) Swedish Lapphund (Dog) Swedish White Elkhound (Dog) Yorkshire Terrier (Dog) Progressive rod-cone degeneration PRCD missense Naturally occurring variant yes CanFam3.1 9 g.4188663C>T c.5G>A p.(C2Y) ENSCAFT00845030294.1; ENSCAFP00845023755.1; ROS_Cfam_1.0:g.4864649C>T; Portuguese Podengo and Swedish White Elkhound were reported in PMID: 37582787 rs852451717 2006 16938425 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1553 OMIA:002693-9940 sheep Cheviot (Sheep) Achondroplasia, PRICKLE1-related PRICKLE1 deletion, small (<=20) Naturally occurring variant yes 3 10 bp deletion in the open reading frame 2016 Reference not in PubMed; see OMIA 002693-9940 for reference details
175 OMIA:001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- missense Naturally occurring variant yes Sscrofa11.1 15 g.120863533C>T c.749G>A p.(R250Q) The paper by Milan et al. (2000) reported this variant as c.599G>A and p.R200Q rs1109104772 2000 10818001 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
176 OMIA:001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- missense Naturally occurring variant yes Sscrofa11.1 15 g.120863537C>T c.745G>A p.(I249V) rs1108399077 2001 11729159 he genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
283 OMIA:000220-9615 dog Jack Russell Terrier (Dog) Severe combined immunodeficiency disease, autosomal PRKDC nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 29 g.49588C>A c.10849G>T p.(E3617*) NM_001006651.2; NP_001006652.2 ; published as c.10879G>T; p.(E3627*); coordinates in the table have been updated to a recent reference genome and / or transcript 2002 11867233
511 OMIA:000220-9796 horse Arab (Horse) Severe combined immunodeficiency disease, autosomal PRKDC deletion, small (<=20) Naturally occurring variant yes EquCab3.0 9 g.36395752_36395759del c.9478_9482del p.(N3160fs*3) A 5bp deletion giving rise to a frameshift in PRKDC The following details (from which the coordinate fields were populated) were provided by Meredith O’Connell, Tanya German, Isabella Pisani and Karalie Andrews, under the supervision of Professor Ernie Bailey. 20 Feb 2019 NC_009152.3 g.36395752-36395976del; NM_001163858 c.9478_9482del; NP_001157330 p.N3160fs*3 1997 9103416
291 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 6 g.95896205G>A c.1573C>T p.(R525*) rs109639251 2009 19887637 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
352 OMIA:001485-9913 taurine cattle Angus (Cattle) Dwarfism, Angus PRKG2 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 6 g.95896205G>A c.2032C>T p.(R678*) ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter rs109639251 2009 19887637 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1373 OMIA:001485-9615 dog Dogo Argentino (Dog) Dwarfism, disproportionate PRKG2 splicing Naturally occurring variant yes CanFam3.1 32 g.5299068C>A c.1634+1G>T cDNA position based on XM_022413533.1 2021 34680883
719 OMIA:000380-9031 chicken Feathering, Z-linked PRLR duplication Naturally occurring variant no Z The tandem duplication of this region results in the partial duplication of two genes; the prolactin receptor and the gene encoding sperm flagellar protein 2. 2008 18713476
1447 OMIA:001372-9913 taurine cattle Slick hair PRLR SLICK4 nonsense (stop-gain) Naturally occurring variant no ARS-UCD1.2 20 g.39099113C>G c.1281C>G p.(Y427*) NM_001039726.2; NP_001034815.1 2021 33259090
544 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Slick hair PRLR SLICK1 deletion, small (<=20) Naturally occurring variant no ARS-UCD1.2 20 g.39099214del c.1382del p.(A461Vfs*2) NM_001039726.2; NP_001034815.1 rs517047387 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
974 OMIA:001372-9913 taurine cattle Limonero, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK3 nonsense (stop-gain) Naturally occurring variant no ARS-UCD1.2 20 g.39099226C>A c.1394C>A p.(S465*) NM_001039726.2; NP_001034815.1 2018 29527221
1448 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK5 nonsense (stop-gain) Naturally occurring variant no ARS-UCD1.2 20 g.39099228A>T c.1396A>T p.(K466*) NM_001039726.2; NP_001034815.1 2021 33259090
1449 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK6 nonsense (stop-gain) Naturally occurring variant no ARS-UCD1.2 20 g.39099267C>T c.1435C>T p.(Q479*) NM_001039726.2; NP_001034815.1 2021 33259090
975 OMIA:001372-9913 taurine cattle Carora, Venezuela (Bolivarian Republic of) (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Slick hair PRLR SLICK2 nonsense (stop-gain) Naturally occurring variant no ARS-UCD1.2 20 g.39099321C>T c.1489C>T p.(R497*) NM_001039726.2; NP_001034815.1 2018 29527221
1507 OMIA:000944-447135 Bank vole Susceptibility to atypical scrapie PRNP missense Naturally occurring variant yes p.(M109I) 2022 35731839
698 OMIA:001515-9615 dog Great Dane (Dog) Colorectal hamartomatous polyposis and ganglioneuromatosis PTEN insertion, gross (>20) Naturally occurring variant yes 26 "Duplication of PTEN" 2011 20952721
988 OMIA:002196-9615 dog Doberman Pinscher (Dog) Deafness, unilateral and vestibular dysfunction PTPRQ insertion, small (<=20) Naturally occurring variant yes CanFam3.1 15 g.22989897_22989898insA c.9230_9231insA p.(N3077Kfs*24) XM_022428131.1; XP_022283839.1; published as an A insertion at CFA15: 22 989 894 and p.(N2032Kfs*24) based on ENSCAFT00000009346.4 - renamed due to HGVS 3'rule and RefSeq IDs 2018 29460419
193 OMIA:001139-9913 taurine cattle Charolais (Cattle) Glycogen storage disease V PYGM missense Naturally occurring variant yes ARS-UCD1.2 29 g.42991370G>A c.1468C>T p.(R490W) 1996 8845714 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1688 OMIA:001139-9913 taurine cattle Red Angus (Cattle) Glycogen storage disease V PYGM nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.3 29 NC_037356.1:g.42989581G>A NM_175786.2 c.1948C>T NP_786980.1:p.(R650*) published as c.2257C>T in ARS-UCD1.2 2024 38678201
388 OMIA:001139-9940 sheep Glycogen storage disease V PYGM splicing Naturally occurring variant yes Oar_rambouillet_v1.0 21 g.44787090C>T c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1689 OMIA:002848-9913 taurine cattle Brown Swiss (Cattle) Spermatogenic failure, QRICH2-related QRICH2 deletion, small (<=20) Naturally occurring variant yes ARS-UCD1.3 19 NC_037346.1:g.55436710del XM_002696205.5:c.4929del XP_002696251.3:C1644Afs*52 Coordinates in this table consider 3' rule of HGVS recommendation 2022 35255804
88 OMIA:001913-9615 dog Gordon Setter (Dog) Old English Sheepdog (Dog) Ataxia, cerebellar, in Old English Sheepdogs and Gordon Setters RAB24 missense Naturally occurring variant yes CanFam3.1 4 g.36055678A>C c.113A>C p.(Q38P) XM_005619162.3; XP_005619219.1 2014 24516392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
730 OMIA:001970-9615 dog Alaskan Husky (Dog) Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 19 g.37903870_37903871insN[218] c.614_615insN[218] XM_851254.3; published as 218 bp SINE insertion in exon 7; sequence of the mutant allele was submitted to ENA (accession LN864704); transcript analysis identified a new internal splice acceptor site within the SINE insertion resulting in a novel “exon 7” 2015 26596647
546 OMIA:001970-9615 dog Black Russian Terrier (Dog) Rottweiler (Dog) Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 19 g.37908634del c.743del p.P248Lfs*4 XM_022406115.1; XP_022261823.1, published as c.743delC rs851283827 2016 26607784 Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn.
221 OMIA:002037-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RABGGTB RABGGTB missense Naturally occurring variant yes ARS-UCD1.2 3 g.69060748T>C c.584A>G p.(Y195C) ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys rs1118263722 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1123 OMIA:001547-9031 chicken Wingless-2 RAF1 nonsense (stop-gain) Naturally occurring variant yes GRCg6a 12 g.5374854G>A c.175C>T p.(R59*) NC_006099.5:g.5374854G>A ENSGALT00000033956.3:c.175C>T ENSGALP00000033314.3:p.Arg59Ter rs314452077 2019 31075853
284 OMIA:001574-9615 dog Frisian Water Dog (Dog) Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive RAG1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 18 g.31631772C>A c.2893G>T p.(E965*) 2011 21293384 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1621 OMIA:002763-9541 crab-eating macaque Severe combined immunodeficiency disease RAG1 nonsense (stop-gain) Base-editing yes Macaca_fascicularis_5.0 14 g.30840789G>T c.181C>T p.(Q61*) XM_005578172.2; XP_005578229.1 2023 37661226
1613 OMIA:002757-9615 dog Belgian Shepherd Dog (Dog) Ataxia, cerebellar, RALGAPA1-related RALGAPA1 deletion, gross (>20) Naturally occurring variant unknown UU_Cfam_GSD_1.0 8 g.14468376_14473136del c.6080-2893_6944+1003del p.(V2027Qfs*7) XM_038544497.1; XP_038400425.1; published as g.14,468,376_14,473,136del4761 2023 37628572
1369 OMIA:002458-9796 horse Thoroughbred (Horse) Hypoparathyroidism RAPGEF5 nonsense (stop-gain) Naturally occurring variant yes EquCab3.0 4 g.54108297G>T c.2624C>A p.(S875*) 2020 32986719
209 OMIA:002433-9913 taurine cattle Simmental (Cattle) Thrombopathia RASGRP2 missense Naturally occurring variant yes ARS-UCD1.2 29 g.42978791A>G c.701T>C p.(L234P) rs385444696 2007 18039909 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
585 OMIA:002433-9615 dog obsolete Eskimo Spitz (Dog) Thrombopathia RASGRP2 duplication Naturally occurring variant yes CanFam3.1 18 g.52417256dup c.452dup p.(D151Efs) XM_849829.5; XP_854922.1; published as c.452-453insA 2007 17656327
477 OMIA:002433-9615 dog Basset Hound (Dog) Thrombopathia RASGRP2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 18 g.52417313_52417315del c.509_511del p.(F170del) XM_849829.5; XP_854922.1 2007 17656327
285 OMIA:002433-9615 dog Landseer (Dog) Thrombopathia RASGRP2 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 18 g.52419245C>T c.982C>T p.(R328*) XM_849829.5; XP_854922.1 2007 17656327
1323 OMIA:002365-9615 dog Giant Schnauzer (Dog) Schnauzer, Standard (Dog) Cardiomyopathy, dilated RBM20 deletion, gross (>20) Naturally occurring variant yes 28 22 bp deletion and frame shift in exon 11 of RBM20 2014 Reference not in PubMed; see OMIA 002365-9615 for reference details
913 OMIA:000876-9031 chicken Riboflavinuria RBP splicing Naturally occurring variant yes 8 A "deletion in the rd ribBP cDNA correspond[ing] precisely to an exon. The splice site following this exon contains a G-->A mutation at position 1 of the downstream 5'-splice donor sequence. 1993 8226844
993 OMIA:002151-9615 dog Irish Soft Coated Wheaten Terrier (Dog) Microphthalmia, isolated, with coloboma RBP4 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 28 g.7830265_7830267del c.90_92del p.(K31del) XM_534969.6; XP_534969.3; published as c.282_284delGAA and p.(K30del); coordinates in the table have been updated to a recent reference genome and transcript, and are in accordance with the HGVS 3'-rule 2018 29847795
710 OMIA:001260-9615 dog Collie (Dog) Rod-cone dysplasia 2 RD3 insertion, gross (>20) Naturally occurring variant yes 7 "22 bp insertion changes the last 61 amino acids of the encoded protein" 2009 19130129
1377 OMIA:002469-9685 domestic cat Retinopathy RDH5 missense Naturally occurring variant yes Felis_catus_9.0 B4 g.84417264G>T c.542G>T p.(G181V) XM_019835050.1; XP_019690609.1 2021 34726233 Genomic position in Felis_catus_9.0 provided by Joshua Khamis.
1663 OMIA:001867-9940 sheep Lissencephaly and cerebellar hypoplasia RELN unpublished unknown Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. 2024 Reference not in PubMed; see OMIA 001867-9940 for reference details
673 OMIA:001867-9940 sheep Spanish Churro (Sheep) Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
1580 OMIA:001867-9615 dog White Swiss Shepherd Dog (Dog) Lissenecephaly and cerebellar hypoplasia RELN deletion, small (<=20) Naturally occurring variant yes UU_Cfam_GSD_1.0 18 g.16909944del c.2839del p.(V947*) XM_038562771.1; XP_038418699.1; reported as g.16909942TG>T - information in this table has been updated to reflect HGVS nomenclature. 2023 37334487
29 OMIA:001346-9615 dog English Mastiff (Dog) Autosomal dominant PRA RHO missense Naturally occurring variant yes CanFam3.1 20 g.5637394G>C c.11C>G p.(T4R) 2002 11972042 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1442 OMIA:002547-9913 taurine cattle Holstein-Friesian, Switzerland (Cattle) Haplotype HH25 deficiency RIOX1 deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 10 g.84938408_84938437del c.396_425del p.(A133_E142del) NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA 2022 35361830
676 OMIA:001901-9913 taurine cattle Nordic Red (Cattle) Abortion due to deletion of RNASEH2B RNASEH2B deletion, gross (>20) Naturally occurring variant yes UMD3.1 12 g.20100648_20763119del A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. 2014 24391517 Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 -
376 OMIA:001686-9913 taurine cattle Belgian Blue (Cattle) Dwarfism, proportionate, with inflammatory lesions RNF11 splicing Naturally occurring variant yes ARS-UCD1.2 3 g.95015373T>C c.124-2A>G NM_001077953.1 2012 22438830 Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
344 OMIA:002038-9913 taurine cattle Holstein Friesian (Cattle) Abortion (embryonic lethality), RNF20 RNF20 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 8 g.91297797A>T c.2077A>T p.(K693*) 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1297 OMIA:002317-9986 rabbit Sauteur d'Alfort Sauteur RORB s^am splicing Naturally occurring variant yes OryCun2.0 1 g.61103503G>A This variant corresponds to a change from GT to AT in the 5’ donor site of intron 9 (Carneiro et al., 2021) 2021 33764968
611 OMIA:002029-9913 taurine cattle Angus (Cattle) Belgian Blue (Cattle) Charolais (Cattle) Gelbvieh (Cattle) Holstein (black and white) (Cattle) Maine-Anjou (Cattle) Normande (Cattle) Red Angus (Cattle) Retinitis pigmentosa 1 RP1 insertion, small (<=20) Naturally occurring variant yes ARS-UCD1.2 14 g.22340665_22340666insA p.(R791Kfs*13) 2016 27510606
858 OMIA:002134-9913 taurine cattle Ayrshire (Cattle) Abortion due to haplotype AH2 RPAP2 splicing Naturally occurring variant yes 3 a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 2017 Reference not in PubMed; see OMIA 002134-9913 for reference details
468 OMIA:001222-9615 dog Briard (Dog) Leber congenital amaurosis (congenital stationary night blindness) RPE65 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 6 g.76893207_76893210del c.460_463del p.(K154Lfs*53) NM_001003176.1; NP_001003176.1; 4 bp AAGA deletion in RPE65 1998 9808841
688 OMIA:000831-9615 dog Weimaraner (Dog) Progressive retinal atrophy, X-linked, type 1 RPGR deletion, gross (>20) Naturally occurring variant yes X "a large deletion [maximum size 5,006 bp] comprising the first four exons of the X-linked retinitis pigmentosa GTPase regulator (RPGR) gene" 2016 27398221
481 OMIA:001518-9615 dog obsolete Mongrel (Dog) Progressive retinal atrophy, X-linked, type 2 RPGR deletion, small (<=20) Naturally occurring variant yes ROS_Cfam_1.0 X g.33126437_33126438del c.3472_3473del p.E1158Gfs*212 published as "a two-nucleotide deletion (delGA) in c.1084-1085" [GenBank accession no. AF385629] in the exon ORF15 of the canine RPGR gene; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] 2002 11978759
480 OMIA:000831-9615 dog Samoyed (Dog) Siberian Husky (Dog) Progressive retinal atrophy, X-linked, type 1 RPGR deletion, small (<=20) Naturally occurring variant yes ROS_Cfam_1.0 X g.33126490_33126494del c.3416_3420del p.(R1139Ifs*2) published as a "five-nucleotide deletion (delGAGAA) between 1028 and 1032" in exon ORF15 of the canine RPGR gene [GenBank accession no. AF385629]; updated c.DNA and protein positions kindly provided by Leonardo Murgiano [15/2/20022] 2002 11978759
699 OMIA:001432-9615 dog Dachshund, Miniature Long-Haired (Dog) Cone-rod dystrophy 4 RPGRIP1 insertion, gross (>20) Naturally occurring variant yes CanFam3.1 15 g.18332036_18332037ins[A[29];GGAAGCAACAGGATG] c.142_143ins[A[29];GGAAGCAACAGGATG] p.(I49Kfs*26) NM_001313773.1; NP_001300702.1; published as a 44-bp insertion in exon 2 of the RPGRIP1 gene; comprising a poly(A) stretch flanked by a perfect 15-bp duplication: g.8228_8229insA29GGAAGCAACAGGATG 2006 16806805
416 OMIA:002041-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), RPIA-related RPIA splicing Naturally occurring variant yes ARS-UCD1.2 11 g.47355110C>T c.826+1G>A 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
707 OMIA:001498-9615 dog Portuguese Water Dog (Dog) Improper coat RSPO2 insertion, gross (>20) Naturally occurring variant yes 13 "167 bp 3' UTR insertion in RSPO2" 2010 20562213
1269 OMIA:002297-9913 taurine cattle Holstein Friesian (Cattle) Tetradysmelia RSPO2 delins, gross (>20) Naturally occurring variant yes ARS-UCD1.2 14 g.56451029_56501201delinsTGACAA a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene 2020 33176673
54 OMIA:000621-9615 dog Collie (Dog) Doberman Pinscher (Dog) German Shepherd Dog (Dog) Labrador Retriever (Dog) Malignant hyperthermia RYR1 missense Naturally occurring variant yes CanFam3.1 1 g.114562165A>G c.1643T>C p.(V548A) XM_022425933.1 c.1643C>T; XP_022281641.1; published as c.1640T>C ; p.(V547A) "The nucleotide sequences of canine regions I and II have been submitted to GenBank (accession No. A302128 and AF302129, respectively)" (Roberts et al., 2001) 2001 11575546
159 OMIA:000621-9796 horse Quarter Horse (Horse) Malignant hyperthermia RYR1 missense Naturally occurring variant yes EquCab3.0 10 g.9678680C>G c.7363C>G p.(R2455G) XM_023649662.1; XP_023505430.1; published as c.7360C>G and p.(R2454G); coordinates in the table have been updated to a recent reference genome and / or transcript 2004 15318347 The genomic position in EquCab3.0 was provided by Hailey Anderson, working under the guidance of Professor Ernie Bailey in April 2022
174 OMIA:000621-9823 pig Malignant hyperthermia RYR1 missense Naturally occurring variant yes Sscrofa11.1 6 g.47357966T>C c.1843C>T p.(R615C) NM_001001534.1: c.1843C>T; p.(R615C) Interestingly, the reference allele in the Sscrofa11.1 assembly is T rather than C, meaning that the Duroc animal that is the basis of this reference genome assembly has the causal variant for malignant hyperthermia! rs344435545 1991 1862346 Effect was confirmed with Ensembl VEP in the following transcript: NM_001001534.1 by Stephanie Shields (27/05/2020)
1627 OMIA:002780-9615 dog Great Pyrenees (Dog) Ataxia, spastic, SACS-related SACS delins, small (<=20) Naturally occurring variant yes ENSCAFT00030020331.1 25 c.12731_12734del p.(V4244Afs*32) Published as ENSCAFT00030020331.1:c.12731_12734delTTAG - CanFam3.1 and CanFam4 are annotated incorrectly for this gene 2023 37758910
359 OMIA:001876-9615 dog Basenji (Dog) Progressive retinal atrophy, Basenji SAG extension (stop-lost) Naturally occurring variant yes CanFam3.1 25 g.44843440T>C c.1216T>C p.(*405Rext*25) 2013 24019744 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1233 OMIA:002284-9615 dog Miniature Schnauzer (Dog) Polyneuropathy, SBF2-related SBF2 splicing Naturally occurring variant yes CanFam3.1 21 g.33080022C>A c.2363+1G>T p.(G775Vfs*5) 2019 31772832
552 OMIA:002016-9615 dog Wire Fox Terrier (Dog) Van den Ende-Gupta syndrome SCARF2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 26 g.30237714_30237715del c.1873_1874del p.(S625Gfs*15) XM_022410347.1; XP_022266055.1; published as c.865_866delTC, p.(S289Gfs*15); coordinates in the table have been updated to a recent reference genome and / or transcript 2016 27187611
162 OMIA:000785-9796 horse Quarter Horse (Horse) HYPP SCN4A H missense Naturally occurring variant yes EquCab3.0 11 g.15474228C>G c.4248C>G p.(F1416L) NM_001081761.1; NP_001075230.1; ECA11 (NC_009154.3) g.15474228C>G; NM_001081761.1: c.4248C>G; NP_001075230.1: F1416L; Sift Score 0.01. The above information (from which the coordinate fields were populated) was provided by Tatyana German and Meredith O’Connell, working under the supervision of Professor Ernie Bailey. rs1148998534 1992 1338908
1077 OMIA:002194-9615 dog Alpine Dachsbracke (Dog) Ataxia, spinocerebellar, SCN8A-related SCN8A missense Naturally occurring variant yes CanFam3.1 27 g.3179029C>A c.4898G>T p.(G1633V) 2019 31083464
1526 OMIA:002616-9615 dog Mixed Breed (Dog) Congenital insensitivity to pain SCN9A missense Naturally occurring variant yes UU_Cfam_GSD_1.0 36 g.11652662G>A c.2761C>T p.(R921C) XM_038584713.1; XP_038440641.1 2023 36630088
990 OMIA:002149-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH6 SDE2 start-lost Naturally occurring variant yes ARS-UCD1.2 16 g.29020700A>G c.2T>C p.(M1?) ENSBTAT00000016992.6:c.2T>C ENSBTAP00000016992.5:p.Met1? "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" rs434666183 2018 29680649
1540 OMIA:002659-9615 dog Chihuahua (Dog) Ichthyosis, non-epidermolytic SDR9C7 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 10 g.1471341G>A c.454C>T p.(R152W) XM_038549505.1; XP_038405433.1 2023 36967672
1427 OMIA:002531-74940 Chinook salmon XY female sdY missense Naturally occurring variant yes p.(I183N) 2022 35100376
28 OMIA:001692-9615 dog Finnish Hound (Dog) Ataxia, cerebellar, progressive early-onset SEL1L missense Naturally occurring variant yes CanFam3.1 8 g.53778458A>G c.1972T>C p.(S658P) 2012 22719266 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1334 OMIA:002367-9615 dog Belgian Shepherd Dog (Dog) CNS atrophy with cerebellar ataxia SEPP1 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 4 g.66946539_66963863del c.-6582_*516del NM_001115118.1; ; 17325bp deletion includes the entire protein coding sequence of SELENOP (also called SEPP1) 2021 34339417
1581 OMIA:001468-9615 dog Kerry Blue Terrier (Dog) Multiple system degeneration SERAC1 nonsense (stop-gain) Naturally occurring variant yes 1 c.1536G>A p.(Trp512*) XM_038654522.1; published in conference proceedings, coordinates in this table as reported by Stee et al. 2023 (PMID:37341581) 2013 Reference not in PubMed; see OMIA 001468-9615 for reference details
1582 OMIA:001468-9615 dog Chinese Crested (Dog) Multiple system degeneration SERAC1 splicing Naturally occurring variant unknown 1 c.182+1_182+4del XM_038654522.1; published in conference proceedings, coordinates in this table as reported by Stee et al. 2023 (PMID:37341581) 2013 Reference not in PubMed; see OMIA 001468-9615 for reference details
965 OMIA:001897-9796 horse Connemara Pony (Horse) Hoof wall separation syndrome SERPINB11 insertion, small (<=20) Naturally occurring variant yes EquCab3.0 8 g.83600643_83600644insC c.504_505insC p.(T169Hfs*3) 2015 25875171 FN thanks Daniel J. Schmidt, working under the supervision of Professor Ernie Bailey, for updating the coordinates to EquCab3.0.
25 OMIA:001483-9615 dog Dachshund (Dog) Osteogenesis imperfecta_Dachshund SERPINH1 missense Naturally occurring variant yes CanFam3.1 21 g.23033735A>G c.977T>C p.(L326P) 2009 19629171 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1280 OMIA:002305-9615 dog Dachshund, Miniature (Dog) Muscular dystrophy, limb-girdle, type R3 SGCA nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 9 g.26166312G>A c.G224A p.(W75*) 2021 33407862
652 OMIA:002211-10036 golden hamster Cardiomyopathy, hypertrophic SGCD deletion, gross (>20) Naturally occurring variant yes a large deletion in the delta-SG gene 1997 9097966
651 OMIA:000162-10036 golden hamster Cardiomyopathy, dilated SGCD deletion, gross (>20) Naturally occurring variant yes genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted 1997 9391120
802 OMIA:002122-9615 dog Boston Terrier (Dog) Muscular dystrophy, limb-girdle, type 2F SGCD deletion, small (<=20) Naturally occurring variant yes CanFam3.1 4 g.53353932_53353933del c.534_535del p.(E178Dfs*3) XM_005619257.3; XP_005619314.1, published as c.534_535delGA 2017 28702169 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
928 OMIA:002122-9615 dog Boston Terrier (Dog) Muscular dystrophy, limb-girdle, type 2F SGCD delins, gross (>20) Naturally occurring variant yes CanFam3.1 4 g.[53262018_53262020delinsCC;53262030_53281432del] g.[53262018_53262020delinsCC;53262030_53281432del] 2017 28702169
1612 OMIA:002122-9615 dog Lagotto Romagnolo (Dog) Limb-girdle muscular dystrophy, recessive SGCD missense Naturally occurring variant yes UU_Cfam_GSD_1.0 4 g.54154870A>G c.725T>C p.(L242P) XM_038534930.1; XP_038390858.1, variant detected in a single dog 2023 37628692
1063 OMIA:001279-9615 dog Scottish Deerhound (Dog) Hypotrichosis, recessive SGK3 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 29 g.16351976_16351977insT c.137_138insT p.(E47Gfs*3) NM_001190428.1; NP_001177357.1 2019 30927068 Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn.
564 OMIA:001279-9615 dog American Hairless Terrier (Dog) Hypotrichosis, recessive SGK3 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 29 g.16366702_16366705del c.287_290delTTAG p.(V96Gfs*50) 2017 27994129
577 OMIA:001309-9615 dog Huntaway (Dog) Mucopolysaccharidosis IIIA SGSH insertion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.1544321_1544322insA c.685_686insA p.(Y229*) NM_001003114.1; NP_001003114.1; published as c.708-709insA (which are mRNA and not cDNA coordinates) 2002 11829484
954 OMIA:001309-9615 dog Dachshund (Dog) Mucopolysaccharidosis IIIA SGSH deletion, small (<=20) Naturally occurring variant yes CanFam3.1 9 g.1544376_1544378delCCA c.740_742delCCA p.(T247del) NM_001003114.1; NP_001003114.1; published as c.737_739delCCA; coordinates in the table have been updated in accordance with the HGVS 3' rule 2000 10950929 Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn.
1593 OMIA:002740-9615 dog Golden Retriever (Dog) Polyneuropathy, hypomyelinating, SH SH3TC2 nonsense (stop-gain) Naturally occurring variant yes UU_Cfam_GSD_1.0 4 g.60798310C>T c.1924C>T p.(R642*) XM_038535081.1; XP_038391009.1; reported in one affected dog with coordinates relating to a different transcript as XM_038568229.1:c.1479G>A 2023 37400349
1444 OMIA:000810-9615 dog Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Cocker Spaniel (Dog) Lundehund (Dog) Poodle, Standard (Dog) Rottweiler (Dog) Schnauzer, Standard (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Yorkshire Terrier (Dog) Dew claws SHH DC-2 regulatory Naturally occurring variant yes CanFam3.1 16 g.19380592C>T 2008 18689889 Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022]
1445 OMIA:000810-9615 dog Sapsari (Dog) Tosa (Dog) Dew claws SHH DC-1 regulatory Naturally occurring variant yes CanFam3.1 16 g.19380829C>T 2008 18689889 Thank you to Heidi Anderson for suggesting to add this variant [8/4/2022]
836 OMIA:000810-9031 chicken Polydactyly SHH regulatory Naturally occurring variant yes GRCg6a 2 g.8553470G>T published as "single SNP in a highly conserved cis-regulatory region of Sonic Hedgehog was significantly associated with polydactyly" rs80659072 2010 20064842
686 OMIA:002013-9796 horse Shetland Pony (Horse) Skeletal atavism SHOX Del-1 deletion, gross (>20) Naturally occurring variant yes PAR 160−180 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing the entire coding region of the short stature homeobox (SHOX) gene and parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX 2016 27207956
1455 OMIA:002013-9796 horse Shetland Pony (Horse) Skeletal atavism SHOX Del-2 deletion, gross (>20) Naturally occurring variant yes PAR 60−80 kb deletion in the pseudoautosomal region (PAR) of chromosome X/Y; removing parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX 2016 27207956
1098 OMIA:002208-9615 dog Golden Retriever (Dog) Eye malformation, congenital SIX6 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 8 g.35566504C>T c.487C>T p.(Q163*) XM_547840.6:c.487C>T; XP_547840.3:p.(Gln163*) 2019 31207931
222 OMIA:002444-9913 taurine cattle Japanese Black, Japan (Cattle) Hydrallantois SLC12A1 missense Naturally occurring variant yes ARS-UCD1.2 10 g.62157819G>A p.(P372L) 2016 27613513
1218 OMIA:002279-9615 dog Belgian Shepherd Dog, Malinois (Dog) Ataxia, spinocerebellar, SLC12A6-related SLC12A6 delins, small (<=20) Naturally occurring variant yes CanFam3.1 30 g.774122_774125delinsCATCTCACTCAT c.178_181delinsCATCTCACTCAT p.(M60Hfs*14) XM_014109414.2; XP_013964889.1; 12-bp insertion (CATCTCACTCAT) and a 4-bp deletion (ATGA) 2019 31160700
642 OMIA:001400-9615 dog Poodle, Miniature (Dog) Osteochondrodysplasia SLC13A1 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 14 g.60628774_60758561del c.99+3353_*56671del XM_005628770.1; a 129788bp deletion which "ablated all but the first exon of SLC13A1" 2012 23300579
506 OMIA:001400-9940 sheep Texel (Sheep) Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) Naturally occurring variant yes Oar_rambouillet_v1.0 4 g.95624809del c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
578 OMIA:001097-9615 dog Alaskan Husky (Dog) Necrotising encephalopathy, subacute, of Leigh SLC19A3 delins, small (<=20) Naturally occurring variant yes CanFam3.1 25 g.40417443delinsTTGCA c.624delinsTGCAA p.(Q208Hfs*13) XM_022409850.1; XP_022265558.1; published as c.624 insTTGC, c.625 C>A; coordinates in the table have been updated to reflect HGVS nomenclature 2013 23469184 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1250 OMIA:001097-9615 dog Yorkshire Terrier (Dog) Juvenile-onset necrotizing encephalopathy SLC19A3 delins, gross (>20) Naturally occurring variant yes CanFam3.1 25 g.40417857_40417862delinsN[35] c.205_210delinsN[35] p.(P69Ifs*45) XM_022409850.1; XP_022265558.1; "a 35 bp insertion replacing 6 bp and thereby disturbing the correct reading frame" (Drögemüller et al., 2020) 2020 33081289
1262 OMIA:002294-9615 dog Dutch Shepherd (Dog) Inflammatory myopathy, SLC25A12-related SLC25A12 missense Naturally occurring variant yes CanFam3.1 36 g.16219219A>G c.1046T>C p.(L349P) chr36:g.16,219,219A>G; c.1046T>C; p.L349P (Shelton et al., 2019) 2019 31594244
1471 OMIA:002294-9615 dog Nova Scotia Duck Tolling Retriever (Dog) Cerebellar Degeneration-Myositis Complex SLC25A12 missense Naturally occurring variant yes UU_Cfam_GSD_1.0 36 g.16504064G>A c.1337C>T p.(P446L) XM_038584842.1:c.1337C>T; XP_038440770.1:p.(P446L) 2022 35886006
992 OMIA:002150-9913 taurine cattle Rouge des prés, France (Cattle) Syndrome des veaux tourneurs (Turning calves syndrome) SLC25A46 missense Naturally occurring variant yes ARS-UCD1.2 7 g.109742796C>T c.376C>T p.(R126C) 2017 28376083
937 OMIA:001973-9615 dog Great Dane (Dog) Ichthyosis, SLC27A4-related SLC27A4 splicing Naturally occurring variant yes CanFam3.1 9 g.55168916C>T c.1250G>A XM_548438.6; XP_548438.3; cDNA sequencing confirmed that a "new acceptor site is created by the A-allele ... that results in a shorter RNA product. ... affected dogs show aberrantly spliced transcript with an in-frame loss of the first 54 bp of exon 8" (Metzger et al., 2015) 2015 26506231 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
626 OMIA:000366-9913 taurine cattle Brown Swiss (Cattle) Simmental (Cattle) Fanconi syndrome SLC2A2 delins, small (<=20) Naturally occurring variant yes ARS-UCD1.2 1 g.96472797_96472804delinsCATC c.771_778delinsCATC p.(L258fs16) rs379675307 2016 27169150 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC.
83 OMIA:001033-9615 dog Dalmatian (Dog) Majorca Mastiff (Dog) Urolithiasis SLC2A9 missense Naturally occurring variant yes CanFam3.1 3 g.69456869G>T c.563G>T p.(C188F) NM_001130835.2; NP_001124307.2; variant initially identified in Dalmatians and later reported in Majorca Mastiffs: PMID: 37582787 rs1152388406 2008 18989453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
187 OMIA:001340-9913 taurine cattle Holstein Friesian (Cattle) Complex vertebral malformation SLC35A3 missense Naturally occurring variant yes ARS-UCD1.2 3 g.43261945C>A c.538G>T p.(V180F) rs438228855 2006 16344554 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1181 OMIA:001340-9913 taurine cattle Montbéliarde (Cattle) de novo mutation in an AI sire SLC35A3 missense Naturally occurring variant yes ARS-UCD1.2 3 g.43268369G>T p.(R25S) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. 2017 28904385
263 OMIA:001828-9913 taurine cattle Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) Abortion due to haplotype MH2 SLC37A2 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 29 g.28510651C>T c.34C>T p.(R12*) 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1158 OMIA:002244-9615 dog Basset Hound (Dog) Craniomandibular osteopathy SLC37A2 splicing Naturally occurring variant yes CanFam3.1 5 g.9387071C>T c.1446+1G>A NC_006587.3:g.9387071C>T; XM_005619600.3:c.1446+1G>A (Letko et al., 2020) 2020 32033218
411 OMIA:002244-9615 dog Cairn Terrier (Dog) Scottish Terrier (Dog) West Highland White Terrier (Dog) Craniomandibular osteopathy SLC37A2 splicing Naturally occurring variant yes CanFam3.1 5 g.9387327G>A c.1332C>T XM_005619600.3:c.1332C>T (Letko et al., 2020) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
372 OMIA:000593-9913 taurine cattle Holstein (black and white) (Cattle) Acrodermatitis enteropathica SLC39A4 splicing Naturally occurring variant yes ARS-UCD1.2 14 g.537516G>A c.1645+1G>A "a single nucleotide mutation of the splice donor site in intron 10" 2006 16714095 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
1354 OMIA:000593-9685 domestic cat Turkish Van (Cat) Acrodermatitis enteropathica SLC39A4 missense Naturally occurring variant yes Felis_catus_9.0 F2 g.85320523C>G c.1057G>C p.(G353R) cDNA and protein position based on XM_004000173.3 and XP_004000222.2, respectively 2021 34573291
526 OMIA:000256-9615 dog Labrador Retriever (Dog) Cystinuria, type I - A SLC3A1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 10 g.46700948del c.350del p.(G117Afs*41) NM_001003109.1; NP_001003109.1; published as c.350delG 2013 24001348 Genomic coordinates in CanFam3.1 provided by Robert Kuhn
268 OMIA:000256-9615 dog Newfoundland (Dog) Cystinuria, type I - A SLC3A1 nonsense (stop-gain) Naturally occurring variant yes CanFam3.1 10 g.46706001C>T c.586C>T p.(R196*) 2000 11129328 Genomic coordinates obtained from EBI's Variant Effect Predictor
527 OMIA:001879-9615 dog Australian Cattle Dog (Dog) Cystinuria, type II - A SLC3A1 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 10 g.46725151_46725156del c.1098_1103del p.(T367_T368del) NM_001003109.1; NP_001003109.1; published as c.1095_1100delCACCAC; p.(T366_T367del); coordinates in the table have been updated to a recent reference genome and / or transcript 2013 24001348 Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste.
1542 OMIA:000256-9615 dog English Bulldog (Dog) French Bulldog (Dog) Cystinuria, type I - A SLC3A1 haplotype Naturally occurring variant yes CanFam3.1 10 g.[46705989A>G;46735617A>G] c.[574A>G;2092A>G] p.[(I192V);(S696G)] NM_001003109.1; NP_001003109.1 Several studies report an association between the two variants and cystinuria. 2006 16845473
141 OMIA:000256-9685 domestic cat Domestic Shorthair Cystinuria, type I - A SLC3A1 missense Naturally occurring variant yes Felis_catus_9.0 A3 g.66539609C>T c.1342C>T p.(R448W) XM_003983937.5:c.1342C>T; Felis_catus_6.2: g.66470414C>T 2015 25417848 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
746 OMIA:001821-8090 Japanese medaka Coat colour, albinism, oculocutaneous type IV slc45a2 complex rearrangement Naturally occurring variant yes an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp 2008 18245373
386 OMIA:000370-93934 Japanese quail Feather colour, albinism, sex-linked, imperfect SLC45A2 splicing Naturally occurring variant yes a splice-site mutation in the SLC45A2 gene: "a G → T transversion at the splice acceptor site just preceding exon 4" 2007 17151254
259 OMIA:000370-93934 Japanese quail Feather colour, cinnamon SLC45A2 missense Naturally occurring variant no c.287C>A p.(A72D) 2007 17151254
847 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 missense Naturally occurring variant yes ARS-UCD1.2 20 g.39790069G>A c.134G>A p.(R45Q) Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
848 OMIA:001821-9913 taurine cattle Brown Swiss (Cattle) Coat colour, albinism, oculocutaneous type IV SLC45A2 missense Naturally occurring variant yes ARS-UCD1.2 20 g.39824417C>T c.1331C>T p.(T444I) Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
795 OMIA:001821-9615 dog Bull Mastiff (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 4 g.73864860del c.1287del p.(M430Cfs*4) NM_001037947.1; NP_001033036.1; deletion C 2017 28737247
675 OMIA:001821-9615 dog Doberman Pinscher (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 4 g.73867275_73871357del c.1442_*3934del NM_001037947.1; "a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4[ratio]77,062,968-77,067,051)" (g.27141_31223del; CanFam2.0) 2014 24647637
92 OMIA:001821-9615 dog Lhasa Apso (Dog) Mixed Breed (Dog) Pekingese (Dog) Pomeranian (Dog) Coat colour, albinism, oculocutaneous type IV SLC45A2 missense Naturally occurring variant yes CanFam3.1 4 g.73867311G>A c.1478G>A p.(G493D) NM_001037947.1 2015 25790827 Genomic position in CanFam3.1 provided by Robert Kuhn
861 OMIA:001821-9593 western gorilla Coat colour, albinism, oculocutaneous type IV SLC45A2 missense Naturally occurring variant yes gorGor3.1 17 g.59753498G>C c.1552G>C p.(G518R) 2013 23721540 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
303 OMIA:001228-9913 taurine cattle Japanese Black, Japan (Cattle) Spherocytosis SLC4A1 nonsense (stop-gain) Naturally occurring variant yes ARS-UCD1.2 19 g.44069903G>A c.1990C>T p.(R664*) 1996 8621763 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446
647 OMIA:002443-9913 taurine cattle Angus (Cattle) Hereford (Cattle) Holstein (black and white) (Cattle) Simmental (Cattle) Osteopetrosis SLC4A2 deletion, gross (>20) Naturally occurring variant yes ARS-UCD1.2 4 g.113638011_113640784del "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" 2010 20507629 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
575 OMIA:001572-9615 dog Golden Retriever (Dog) Golden Retriever PRA 1 SLC4A3 insertion, small (<=20) Naturally occurring variant yes CanFam3.1 37 g.26145752_26145753insC c.2601_2602insC p.(E859Rfs*104) Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn rs1152388421 2011 21738669 NM_001289433.1; NP_001276362.1; one of 3 transcripts; second EVA ID for this variant rs852038699 is inconsistent with HGVS 3' rule
158 OMIA:001578-9796 horse Dales (Horse) Fell Pony (Horse) Foal immunodeficiency syndrome in the Fell and Dales Pony SLC5A3 missense Naturally occurring variant yes EquCab3.0 26 g.31894278C>T c.1352C>T p.(P451L) NM_001247992.1; NP_001234921.1; previously listed in OMIA as g.30660224G>T in EquCab2.0, c.1337G>T and published as p.(P446L); coordinates in the table have been updated to a recent reference genome and / or transcript 2011 21750681 Briana Moreno, working under the guidance of Professor Ernie Bailey, provided genomic coordinates in EquCab3.0 in April 2022
1037 OMIA:002174-9615 dog Shih Tzu (Dog) Congenital dyshormonogenic hypothyroidism with goiter SLC5A5 splicing Naturally occurring variant yes CanFam3.1 20 g.45024672C>T c.1172-1G>A XM_541946.4; published as g.45024672G>A, predicted to be a splice site mutation leading to loss of exon 10 and a frameshift 2018 29777899
904 OMIA:001451-9913 taurine cattle Belgian Blue (Cattle) Congenital muscular dystonia 2 SLC6A5 missense Naturally occurring variant yes ARS-UCD1.2 29 g.24366560A>G c.809T>C p.(L270P) 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
638 OMIA:001594-9615 dog Irish Wolfhound (Dog) Hyperekplexia (Startle disease) SLC6A5 deletion, gross (>20) Naturally occurring variant yes CanFam3.1 21 g.42583699_42587925del c.-52_562+504del XM_005633757.1; "a homozygous 4.2kb [4227bp] microdeletion encompassing exons 2 and 3" 2011 21420493
1080 OMIA:001594-9615 dog Spanish Greyhound (Dog) Hyperekplexia (Startle disease) SLC6A5 deletion, small (<=20) Naturally occurring variant yes CanFam3.1 21 g.42612546_42612547del c.1379_1380delCT p.(S460Ffs*47) XM_022407940.1; XP_022263648.1 2019 30847549 Genomic coordinates in CanFam3.1 provided by Robert Kuhn.
1534 OMIA:002645-9615 dog English Cocker Spaniel (Dog) English Springer Spaniel (Dog) Paradoxical pseudomyotonia SLC7A10 nonsense (stop-gain) Naturally occurring variant yes ROS_Cfam_1.0 1 g.119506784C>A c.126C>A p.(C42*) XM_038657580.1; XP_038513508.1 2023 36869603
85 OMIA:001880-9615 dog Miniature Pinscher (Dog) Cystinuria, type II - B SLC7A9 missense Naturally occurring variant yes CanFam3.1 1 g.119211938G>A c.964G>A p.(G322R) NM_001048109.1; NP_001041574.1 2013 24001348 Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt.
142 OMIA:002023-9685 domestic cat Cystinuria, type B SLC7A9 missense Naturally occurring variant yes Felis_catus_9.0 E2 g.20218196G>A c.706G>A p.(D236N) 2016 27404572 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant.
143 OMIA:002023-9685 domestic cat Maine Coon (Cat) Siamese (Cat) Sphynx (Cat) Cystinuria, type B SLC7A9 missense Naturally occurring variant yes Felis_catus_9.0 E2 g.20219555T>A c.881T>A p.(V294E) 2016 27404572 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Thank you to Heidi Anderson for feedback on a previous incorrect breed association for this variant.
144 OMIA:002023-9685 domestic cat Cystinuria, type B SLC7A9 missense Naturally occurring variant yes Felis_catus_9.0 E2 g.20228722C>T c.1175C>T p.(T392M) 2016 27404572 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
1608 OMIA:002755-9940 sheep South Down (Sheep) Congenital photosensitivity and hyperbilirubinaemia SLCO1B3 missense Naturally occurring variant yes Oar_v3.1 3 g.193691915C>T c.1318G>A p.(G440R) XM_012175224.1; XP_012030614.1 2018 29688779
211 OMIA:001824-9913 taurine cattle Holstein (black and white) (Cattle) Abortion due to haplotype HH3 SMC2 missense Naturally occurring variant yes ARS-UCD1.2 8 g.93753358T>C c.3404T>C p.(F1135S) XM_015472668.2; XP_015328154.1 rs456206907 2014 24667746 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (
1193 OMIA:001795-9685 domestic cat Niemann-Pick disease, type A SMPD1 nonsense (stop-gain) Naturally occurring variant yes Felis_catus_9.0 D1 g.65190416G>A c.1017G>A p.(W339*) XM_006937046.3; XP_006937108.1 2020 32347185 Genomic position in Felis_catus_9.0 provided by Joshua Khamis.
557 OMIA:002040-9913 taurine cattle Belgian Blue (Cattle) Abortion (embryonic lethality), SNAPC4-related SNAPC4 deletion, small (<=20) Naturally occurring variant yes 11 p.(L1227Afs*134) 2016 27646536
415 OMIA:002034-9615 dog Vizsla (Dog) Cerebellar cortical degeneration, Hungarian Vizsla SNX14 splicing Naturally occurring variant yes CanFam3.1 12 g.45530566C>T c.26531G>A 2016 27566131
1546 OMI