Search Results
Advanced search
Link to this search: https://omia.org/results/?search_type=advanced&result_type=variant&defect=yes&singlelocus=yes&characterised=yes
1221 variant records found |
[show instead phene records] |
By default, variants are sorted chronologically by year of publication, to provide a historical perspective.
Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending
order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column
headers.
WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.
Since October 2021, OMIA includes a semiautomated lift-over pipeline to facilitate updates of genomic positions to a recent reference genome position. These changes to genomic positions are not always reflected in the ‘acknowledgements’ or ‘verbal description’ fields in this table.
| OMIA Variant ID | OMIA Phene-Species ID(s) | Species Name | Breed(s) | Variant Phenotype | Gene | Allele | Type of Variant | Source of Genetic Variant | Deleterious? | Reference Sequence | Chr. | g. or m. | c. or n. | p. | Verbal Description | EVA ID | Year Published | PubMed ID(s) | Acknowledgements |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 2 | OMIA:000042-9031 | chicken | Wisconsin hypoalpha mutant (WHAM), United States of America (Chicken) | Analphalipoproteinaemia | ABCA1 | missense | Naturally occurring variant | yes | GRCg6a | Z | g.54877918C>T | c.265G>A | p.(E89K) | 2002 | 12364545 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 1126 | OMIA:002238-9913 | taurine cattle | Shorthorn (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 2 | g.103016791A>G | c.6776T>C | p.(L2259P) | NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) | rs5334475100 | 2019 | 31568573 | ||
| 1220 | OMIA:002238-9913 | taurine cattle | Polled Hereford (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 2 | g.103043495_103043496insG | c.5689_5690insC | p.(S1784Ifs*33) | BTA 2:103043495–103043496insG; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) | rs3423092881 | 2020 | 32567073 | ||
| 195 | OMIA:002238-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis, ABCA12-related | ABCA12 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.103030489T>C | NM_001191294.2:c.5804A>G | NP_001178223.2:p.(H1935R) | previously listed in OMIA as ARS-UCD1.2:g.103025585T>C, g. coordinates have been corrected after review of original paper and incorrectly assigned EVA rs ID has been removed [29/08/2024] | 2008 | 18344998 | |||
| 1379 | OMIA:002238-9823 | pig | Bama Xiang Zhu, China (Pig) | Ichthyosis | ABCA12 | splicing | Chemical mutagenesis (ENU) | unknown | Sscrofa11.1 | 15 | g.117250799T>C | Intronic mutation IVS49-727 A>G results in splicing alteration resulting in a 132-nt insertion and a premature stop codon (Wang et al., 2019) | 2019 | 30925591 | |||||
| 1050 | OMIA:002179-9615 | dog | Labrador Retriever (Dog) | Stargardt disease 1 | ABCA4 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 6 | g.55146556dup | c.4176dup | p.(F1393Lfs*3) | Mäkeläinen et al. (2019): "ENSCAFT00000005367 exon28 4170dupC* V1390fs" Importantly, the same authors also explain in Table S3 that "*The insertion is found in a cytosine mononucleotide-repeat region [55,146,550–55,146,556] and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4176insC, p.F1393Lfs*1395)." Variant information changed to reflect HGVS nomenclature | 2019 | 30889179 | |||
| 607 | OMIA:001402-9615 | dog | Border Collie (Dog) | Adverse reaction to certain drugs | ABCB1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 14 | CanFam3.1 | published as c.73insAAT - the allele is reflected by the reference sequence CanFam3.1 and NM_001003215.2 as reference: g.13737172_13737174; c.73_75, p.N25; causality of this variant should be reviewed | 2010 | 21113104 | |||||
| 469 | OMIA:001402-9615 | dog | Australian Shepherd (Dog) Border Collie (Dog) Collie (Dog) German Shepherd Dog (Dog) Long-Haired Whippet (Dog) Miniature Australian Shepherd Dog (Dog) Old English Sheepdog (Dog) Shetland Sheepdog (Dog) Silken Windhound (Dog) Waller (Dog) White Swiss Shepherd Dog (Dog) | Adverse reaction to certain drugs | ABCB1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 14 | NC_006596.3:g.13726596_13726599del | NM_001003215.2:c.228_231del | NM_001003215.2:p.(D77Afs*16) | 2001 | 11692082 | Variant information initially gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and later updated to reflect HGVS nomenclature. | |||
| 442 | OMIA:001402-9615 | dog | Border Collie (Dog) | Adverse reaction to certain drugs | ABCB1 | regulatory | Naturally occurring variant | no | CanFam3.1 | 14 | NC_006596.3:g.13742402A>C | published as Canfam2 chr14:16692274T>G, c.-6-180T>G, possible regulatory variant associated with resistance to phenobarbital treatment in epileptic Border Collies; an association between the variant and the phenotype was not supported in a different study: PMID: 31685133 | rs852787132 | 2011 | 21488961 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | |||
| 1322 | OMIA:001402-9685 | domestic cat | Balinese (Cat) Domestic Longhair Domestic medium-haired Domestic Shorthair Maine Coon (Cat) Maine Coon Polydactyl (Cat) Ragdoll (Cat) Russian Blue (Cat) Siamese (Cat) Turkish Angora (Cat) | Adverse reaction to certain drugs | ABCB1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | g.93144355_93144356del | c.1930_1931del | NM_001171064.2; published as ABCB1:1930_1931delTC; resuling in a frameshift generating a series of stop codons immediately downstream from the deletion. The protein product is predicted to be severely truncated (~50%) and non functional (Mealey and Burke, 2015). | 2015 | 25660379 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:34125616 and PMID:35709088 | |||
| 1574 | OMIA:002710-9615 | dog | Manchester Terrier (Dog) | Cardiomyopathy, dilated, ABCC9-related | ABCC9 | SCDY/DCM | missense | Naturally occurring variant | unknown | Dog10K_Boxer_Tasha | 27 | g.21042635C>T | c.3557G>A | p.(R1186Q) | XM_022410972.2; XP_022266680.2 | 2023 | 37239348 | ||
| 1477 | OMIA:002561-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Infertility | ABHD16B | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 13 | NC_037340.1:g.53957903G>A | NM_001038541.2:c.652C>T | NP_001033630.1:p.(Q218*) | ENSBTAT00000045249.4; ENSBTAP00000055253.1 | rs468948776 | 2020 | 31963602 | ||
| 1388 | OMIA:002368-9615 | dog | Golden Retriever (Dog) | Ichthyosis, ABHD5-related | ABHD5 | ICH2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 23 | g.2587000_2587013del | c.1006_1019del | p.(D336Sfs*6) | XM_542689.5; XP_542689.2 | 2022 | 34791225 | ||
| 1497 | OMIA:002585-9615 | dog | Cavalier King Charles Spaniel (Dog) | medium-chain acyl-CoA dehydrogenase | ACADM | delins, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 6 | g.71401388_71401389delinsCATAATTCTTAGACAATATTGAGAATTAAC | c.444_445delinsGTTAATTCTCAATATTGTCTAAGAATTATG | p.(T150Ifs*6) | XM_038541645.1; XP_038397573.1 | 2022 | 36292732 | |||
| 972 | OMIA:002140-9615 | dog | German Hunting Terrier (Dog) | Exercise induced metabolic myopathy | ACADVL | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.32193689C>A | c.1728C>A | p.(Y576*) | XM_546581.5; XP_546581.3 | 2018 | 29491033 | |||
| 429 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) | Bulldog calf | ACAN | BD2 | regulatory | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.20377856C>T | c.-198C>T | rs3423095877 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 590 | OMIA:001271-9913 | taurine cattle | Dexter (Cattle) Highland (Cattle) | Bulldog calf | ACAN | BD1 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.20422104_20422105insGGCA | c.2266_2267insGGCA | Variant initially identified in Dexter cattle and later reported in additional breeds: PMID:26885599 | 2007 | 17952705 | Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1060 | OMIA:001271-9915 | indicine cattle (zebu) | Miniature Zebu, United Kingdom of Great Britain and Northern Ireland (Cattle) | Bulldog calf | ACAN | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.20428539_20428540insC | c.5688_5689insC | p.(V1897fs*9) | cDNA position based on transcript NM_173981.2 | 2018 | 30305023 | |||
| 1001 | OMIA:001271-9796 | horse | Miniature Horse (Horse) | Dwarfism, ACAN-related | ACAN | D4 | deletion, gross (>20) | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.952574879_95257499del | XM_005602799.2:c.7633_7653del | XP_005602856.2:p.(F2545_C2551del) | Genomic positions were previosuly incorreclty listed in OMIA as g.95257458_95257500del (until 10/01/2022) and g.95257480_95257500del (until 13/06/2024). Coordinates presented now reflect the published rs1095048839. |
rs1095048839 | 2018 | 30058072 | |
| 788 | OMIA:001271-9796 | horse | Miniature Horse (Horse) Shetland Pony (Horse) | Dwarfism, ACAN-related | ACAN | D3* | missense | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.95282140C>G | XM_023650286.1:c.1513G>C | XP_023506054.1:p.(A505P) | ENSECAT00000040213.1:c.1513G>C ENSECAP00000032890.1:p.Ala505Pro This variant was named D3* by Eberth et al. (2018) | rs1095048823 | 2017 | 27942904 | Variant coordinates obtained from Eberth et al. (2018) and EVA_ID link |
| 1000 | OMIA:001271-9796 | horse | Miniature Horse (Horse) Quarter Horse (Horse) Warmblood (Horse) | Dwarfism, ACAN-related | ACAN | D2 | missense | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.95284530C>T | XP_023506054.1:c.1270C>T | XP_023506054.1:p.(V424M) | rs3091781465 | 2018 | 30058072 | Breed information updated based on PMID: 38600096 | |
| 999 | OMIA:001271-9796 | horse | Miniature Horse (Horse) | Dwarfism, ACAN-related | ACAN | D1 | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.95291271del | XM_023650281.1:c.245del | XP_023506054.1:p.(K82Rfs*54) | 220110: changed g.95291270del to g.95291271del based on HGVS 3'rule. ENSECAT00000040213.1:c.245del ENSECAP00000032890.1:p.Lys82ArgfsTer54 | rs1095048841 | 2018 | 30058072 | |
| 323 | OMIA:000702-9031 | chicken | Nanomelia | ACAN | nonsense (stop-gain) | Naturally occurring variant | yes | GRCg6a | 10 | g.13502829C>A | c.4537G>T | p.(E1513*) | 1994 | 7827752 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 1045 | OMIA:002177-9615 | dog | Akita (Dog) American Akita (Dog) | Amelogenesis imperfecta, ACP4-related | ACPT | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.106051997dupC | c.1189dupG | p.(A397Gfs) | XM_541473.2; XP_541473.2; ACPT is a synonym of ACP4 | 2019 | 30877375 | |||
| 1419 | OMIA:002226-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH34 | ACSL5 | BH34 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 26 | NC_037353.1:g.32940521C>G | NM_001075650.1:c.528C>G | NP_001069118.1:p.(N176K) | NM_001075650.1 | rs5357452907 | 2021 | 34915862 | |
| 1259 | OMIA:002226-9615 | dog | Australian Kelpie (Dog) | Intestinal lipid malabsorption | ACSL5 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 28 | g.23380074_23483377del | NC_006610.3CFA28:g.23380074_23483377del (O/Brien et al., 2020) | 2020 | 33106515 | |||||
| 1073 | OMIA:000388-9685 | domestic cat | Domestic Shorthair | Fibrodysplasia ossificans progressiva | ACVR1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | C1 | g.150014354C>T | c.617G>A | p.(R206H) | XM_023259334.1; XP_023115102.1 | 2019 | 31007133 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 633 | OMIA:001520-9615 | dog | Glen of Imaal Terrier (Dog) | Cone-rod dystrophy 3 | ADAM9 | deletion, gross (>20) | Naturally occurring variant | yes | 16 | "a deletion of exons 15 and 16 which alters the reading frame leading to a premature stop codon" in the ADAM9 gene | 2010 | 20691256 | |||||||
| 43 | OMIA:001870-9615 | dog | Beagle (Dog) | Glaucoma, primary open angle | ADAMTS10 | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.53096339C>T | c.1981G>A | p.(G661R) | XM_849227.3; XP_854320.1 | 2011 | 21379321 | |||
| 101 | OMIA:001870-9615 | dog | Norwegian Elkhound (Dog) | Glaucoma, primary open angle | ADAMTS10 | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.53101896C>T | c.1159G>A | p.(A387T) | XM_849227.3; XP_854320.1 | 2014 | 25372548 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 685 | OMIA:001976-9615 | dog | Basset Hound (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.40614853_40614872del | c.194_213del | p.(L68Gfs*) | XM_022416850.1; XP_022272558.1 | 2015 | 26474315 | |||
| 365 | OMIA:000588-9615 | dog | American Toy Terrier (Dog) Chinese Crested (Dog) German Hunting Terrier (Dog) Jack Russell Terrier (Dog) Lancashire Heeler (Dog) Miniature Bull Terrier (Dog) Parson Russell Terrier (Dog) Patterdale Terrier (Dog) Rat Terrier (Dog) Sealyham Terrier (Dog) Tenterfield Terrier (Dog) Tibetan Terrier (Dog) Toy Fox Terrier (Dog) Volpino Italiano (Dog) Welsh Terrier (Dog) Wire Fox Terrier (Dog) Yorkshire Terrier (Dog) | Lens luxation | ADAMTS17 | splicing | Naturally occurring variant | yes | CanFam3.1 | 3 | g.40782144G>A | c.1473+1G>A | XM_022416850.1; additional breeds reported by PMID:22050825 and PMID:37582787 | rs1152388408 | 2010 | 20375329 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 96 | OMIA:001976-9615 | dog | Basset Fauve de Bretagne (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | missense | Naturally occurring variant | yes | CanFam3.1 | 3 | g.40808345G>A | c.1552G>A | p.(G518S) | XM_022416851.1; XP_022272559.1 | 2015 | 26474315 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1086 | OMIA:001976-9615 | dog | Petit Basset Griffon Vendeen (Dog) | Glaucoma, primary open angle, ADAMTS17-related | ADAMTS17 | inversion | Naturally occurring variant | yes | CanFam3.1 | 3 | g.40812274_45768123inv | c.1721+2668_*4831255inv | XM_545825.4; Forman et al. (2015): "a 4.96 Mb inversion . . . with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123) [Canfam3.1]… Analysis of RNAseq data revealed novel exon expression for ADAMTS17 due to cryptic splicing occurring 3’ of the exons located immediately upstream of the inversion event." | 2015 | 26683476 | ||||
| 942 | OMIA:000588-9615 OMIA:001976-9615 | dog | Chinese Shar-Pei (Dog) | Primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both | ADAMTS17 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.40935387_40935392del | c.3069_3074del | p.(V1024_V1025del) | XM_014112382.2; XP_013967857.1; published as c.3070_3075delCGTGGT; p.(V1025_V1026del) | 2018 | 29287154 | |||
| 486 | OMIA:000328-9913 | taurine cattle | Belgian Blue (Cattle) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 7 | g.2017035_2017051delinsAGC | c.464_480delinsAGC | 1999 | 10417273 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||||
| 1513 | OMIA:000328-9615 | dog | Alapaha Blue Blood Bulldog (Dog) American Pit Bull Terrier (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 11 | g.2280117delC | c.10delC | p.(P4Rfs*175) | 2022 | 36421833 | ||||
| 1117 | OMIA:000328-9615 | dog | Doberman Pinscher (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 11 | g.2408978C>T | c.769C>T | p.(R257*) | 2019 | 31294848 | ||||
| 1514 | OMIA:000328-9615 | dog | Catahoula Leopard Dog (Dog) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | missense | Genome-editing (CRISPR-Cas9) | yes | CanFam3.1 | 11 | g.2491238G>A | c.2897G>A | p.(R966H) | 2022 | 36421833 | ||||
| 1589 | OMIA:000328-9685 | domestic cat | Domestic Shorthair | Ehlers-Danlos syndrome | ADAMTS2 | delins, small (<=20) | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | A1 | g.90995621dup | c.698dup | p.(Ser235fs*3) | XM_023254116.2; XP_023109884.2 | 2023 | 37462293 | |||
| 318 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 5 | g.1938399G>T | c.424G>T | p.(E142*) | XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) | 2012 | 22497338 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 857 | OMIA:000328-9940 | sheep | Dorper (Sheep) | Ehlers-Danlos syndrome, type VII (Dermatosparaxis) | ADAMTS2 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 5 | g.2088231G>A | c.805G>A | p.(V269M) | XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) | 2015 | 25354687 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 537 | OMIA:001140-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cleft lip with or without cleft palate | ADAMTS20 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 27 | g.10553479_10553480del | c.1358_1359del | p.(K453Ifs*4) | XM_022410988.1; XP_022266696.1; published as c.1360_1361delAA and p.(K453Ifs*3); coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature | 2015 | 25798845 | Genomic position in CanFam3.1 provided by Mateo Etcheveste and Robert Kuhn. | ||
| 1163 | OMIA:001562-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Pulmonary hypoplasia and anasarca syndrome | ADAMTS3 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.87462016G>A | NM_001192797.1:c.1222C>T | NP_001179726.1:p.(H408T) | NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) | rs5334475098 | 2020 | 32069517 | ||
| 60 | OMIA:001509-9615 | dog | Beagle (Dog) | Musladin-Lueke syndrome | ADAMTSL2 | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.49931561C>T | c.661C>T | p.(R221C) | 2010 | 20862248 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 935 | OMIA:001511-9913 | taurine cattle | Angus (Cattle) | Contractual arachnodactyly (Fawn calf syndrome) | ADAMTSL3 | deletion, gross (>20) | Naturally occurring variant | yes | 21 | "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" | 2014 | Reference not in PubMed; see OMIA 001511-9913 for reference details | |||||||
| 1435 | OMIA:002535-9913 | taurine cattle | Original Schweizer Braunvieh, Switzerland (Cattle) | Congenital cataract | ADAMTSL4 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 3 | NC_037330.1:g.20146737C>T | NM_001101061.1:c.2327G>A | NP_001094531.1:p.(R776H) | NM_001101061.1; NP_001094531.1 | rs5353205567 | 2022 | 35233794 | ||
| 466 | OMIA:001577-9615 | dog | Curly Coated Retriever (Dog) | Glycogen storage disease IIIa | AGL | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 6 | g.50050457del | c.4223del | p.(K1408Sfs*6) | NM_001048096.1; NP_001041561.1; published as c.4223delA; genomic position adjusted to HGVS 3' rule | 2007 | 17338148 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 934 | OMIA:002135-9913 | taurine cattle | Angus (Cattle) | Arthrogryposis multiplex congenita, AGRN-related | AGRN | deletion, gross (>20) | Naturally occurring variant | yes | 16 | A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) | 2011 | Reference not in PubMed; see OMIA 002135-9913 for reference details | |||||||
| 233 | OMIA:000662-9940 | sheep | Romney Marsh (Sheep) | Motor neuron disease, lower | AGTPBP1 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.35795594G>C | XM_015093043.2:c.2909G>C | XP_014948529.2:p.(R970P) | protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively | 2012 | 22588130 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 75 | OMIA:001672-9615 | dog | Coton de Tulear (Dog) | Primary hyperoxaluria type I (Oxalosis I) | AGXT | missense | Naturally occurring variant | yes | CanFam3.1 | 25 | g.50968854G>A | c.304G>A | p.(G102S) | XP_003639939.1:p.Gly102Ser | rs397510072 | 2012 | 22486513 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1252 | OMIA:001672-9940 | sheep | Zwartbles (Sheep) | Type 1 Primary Hyperoxaluria | AGXT | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.801189C>T | XM_027966918.1:c.584G>A | XP_027822719.1:p.(C195Y) | NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) | 2020 | 33003365 | |||
| 1214 | OMIA:001222-9685 | domestic cat | Persian (Cat) | Leber congenital amaurosis | AIPL1 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.940445C>T | c.577C>T | p.(R193*) | XM_023243858.1:c.577C>T | 2016 | 27030474 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770) | ||
| 1629 | OMIA:002788-9913 | taurine cattle | Holstein Friesian (Cattle) | Subfertility, AK9-related | AK9 | splicing | Naturally occurring variant | yes | ARS-UCD1.2 | 9 | g.40620329A>G | rs457222030 | 2021 | 34028060 | |||||
| 1094 | OMIA:002205-9615 | dog | Collie Rough (Dog) | Recurrent inflammatory pulmonary disease | AKNA | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 11 | g.68576241_68576244del | c.2717_2720delACAG | p.(D906Afs*173) | XM_014117950.2: c.2717_2720delACAG; XP_013973425.1:p.(Asp906Alafs*173) | 2019 | 31357536 | |||
| 1240 | OMIA:002250-9615 | dog | Saluki (Dog) | Succinic Semialdehyde Dehydrogenase Deficiency | ALDH5A1 | missense | Naturally occurring variant | yes | CanFam3.1 | 35 | g.22572768G>A | c.866G>A | p.(G288D) | XM_014110599.2: c.866G>A; XP_013966074.2: p.(Gly288Asp) (Vernau et al., 2020) | 2020 | 32887425 | |||
| 1292 | OMIA:002316-9685 | domestic cat | American Shorthair (Cat) Exotic Shorthair (Cat) Munchkin (Cat) Scottish Fold (Cat) Sphynx (Cat) | Cardiomyopathy, hypertrophic | ALMS1 | missense | Naturally occurring variant | unknown | Felis_catus_9.0 | A3 | g.92439157G>C | c.7384G>C | p.(G2462R) | cDNA and protein positions have been predicted using Ensemble VEP based on transcript ENSFCAT00000077013.1; variant initially reported in Sphynx cats and in a later study (Akiyama et al., 2023) identified in other breeds. Turba et al., 2023 report additional variants in the vicinity that can result in allele dropout in DNA tests and indicate "the need to verify the correspondence between the g.92439157 C variant frequency and the prevalence of HCM" due to high allele frequency of the variant in Sphynx cats in their study. Seo et al. (2024) also identified this variant frequently in Sphynx cats but reported that the variant "was not associated with the HCM diagnosis in the studied population." | rs5334475133 | 2021 | 33639992 | ||
| 1021 | OMIA:002162-9615 | dog | Karelian Bear Dog (Dog) | Hypophosphatasia | ALPL | missense | Naturally occurring variant | yes | CanFam3.1 | 2 | g.77561953A>C | c.1301T>G | p.(V434G) | XM_005617214.3; XP_005617271.1 | 2019 | 30700765 | |||
| 1486 | OMIA:002162-9940 | sheep | Hypophosphatasia | ALPL | missense | Genome-editing (CRISPR-Cas9) | yes | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.260716094G>C | XM_027965561.1:c.1077C>G | XP_027821362.1:p.(I359M) | XM_027965561.1; XP_027821362.1 | 2018 | 30446691 | ||||
| 550 | OMIA:002717-9685 | domestic cat | Burmese (Cat) | Brachycephaly | ALX1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.110088245_110088256del | c.497_508del | p.(A166_T169del) | XM_003989090.4; XP_003989139.1; published as c.496delCTCTCAGGACTG | 2016 | 26610632 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 764 | OMIA:001009-9913 | taurine cattle | Shorthorn (Cattle) | Tibial hemimelia | ALX4 | deletion, gross (>20) | Naturally occurring variant | yes | 15 | Deletion of 45,694 bp including exon 1 of ALX4 | 2012 | Reference not in PubMed; see OMIA 001009-9913 for reference details | |||||||
| 763 | OMIA:001009-9913 | taurine cattle | Galloway (Cattle) | Tibial hemimelia | ALX4 | ALX4dup-GAU / ALX4dup-LfL | duplication | Naturally occurring variant | yes | ARS-UCD1.2 | 15 | NC_037342.1:g.74384919_74384938dup | NM_001030304.1:c.713_732dup | NP_001025475.1:p.(Q245fs) | Initially reported as g.75154399_75154418dup in UMD3.1 and g.74384916_74384935dup in ARS-UCD1.2.. Updated to current coordinates after publication of a correction by the authors (PMID: 39298916) [23/09/2024]. The variant is now identical to a variant reported by Buitkamp et al. (2023, PMID:36585373), which was previously listed as omia.variant:1516. Both variants are now merged into one entry and omia.variant:1516 is redundant. | 2015 | 26076463 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. The same ARS-UCD1.2 location in the reverse order was included in the paper by Buitkamp et al. (2022). The allele name ALX4dup-GAU was also given by Buitkamp et al. (2022). | |
| 280 | OMIA:002775-9615 | dog | Miniature Schnauzer (Dog) | Persistent Mullerian duct syndrome | AMHR2 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 27 | g.1794738G>A | c.262C>T | p.(R88*) | XM_543632.6; XP_543632.4; published as c.241C>T; coordinates in the table have been updated to a recent reference genome and / or transcript | 2009 | 18723470 | |||
| 639 | OMIA:000565-9615 | dog | Giant Schnauzer (Dog) | Intestinal cobalamin malabsorption, AMN-related | AMN | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 8 | g.70807271_70807303del | c.1113_1145del | p.(G372_A382del) | NM_001002960.1; NP_001002960.1 | 2005 | 15845892 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 426 | OMIA:000565-9615 | dog | Australian Shepherd (Dog) | Intestinal cobalamin malabsorption, AMN-related | AMN | start-lost | Naturally occurring variant | yes | ROS_Cfam_1.0 | 8 | g.71077084G>A | c.3G>A | p.(M1?) | NM_001002960.1; NP_001002960.1 | 2005 | 15845892 | |||
| 1677 | OMIA:002838-9615 | dog | Cirneco dell'Etna (Dog) | Cirneco oculo-neurological syndrome | AMPD2 | CONS | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 6 | g.42698170del | c.2131del | p.(D711Mfs12*) | XM_038541065.1; XP_038396993.1; NC_049227.1 | 2024 | 38397227 | ||
| 353 | OMIA:002539-9615 | dog | Dalmatian (Dog) | Respiratory distress syndrome | ANLN | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 14 | g.47812143C>T | c.31C>T | p.(R11*) | 2017 | 28222102 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 422 | OMIA:001353-9615 | dog | German Shepherd Dog (Dog) | Platelet receptor for factor X, deficiency of | ANO6 | splicing | Naturally occurring variant | yes | CanFam3.1 | 27 | g.8912219C>T | c.1934+1G>A | XM_005636953.1 | 2015 | 26414452 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 927 | OMIA:002083-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Abortion (embryonic lethality), ANXA10-related | ANXA10 | repeat variation | Naturally occurring variant | yes | 8 | "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." | 2016 | 27881083 | |||||||
| 580 | OMIA:000248-9615 | dog | Collie (Dog) | Neutropenia, cyclic | AP3B1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.28663129_28663130insA | c.2407_2408insA | p.(T803Nfs*5) | NM_001002974.2; NP_001002974.1; a single base pair (A) insertion in exon 20 of the AP3 beta gene (AP3B1) | rs1152388405 | 2003 | 12897784 | ||
| 286 | OMIA:000001-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) | Abortion due to a nonsense mutation in APAF1 on haplotype HH1 | APAF1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | g.62810245C>T | XM_015471110.2:c.1735C>T | XP_015326596.1:p.(Q579*) | Variant initially reported in Holstein Friesian cattle and later reported in additional breeds: PMID:34779908. Previously listed in OMIA as: p.(Q581*), c.1741C>T, updated to recent transcript information [03/09/2024] | rs448942533 | 2016 | 27289157 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 1206 | OMIA:001916-9615 | dog | Jack Russell Terrier (Dog) | Familial Adenomatous Polyposis | APC | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.312131_312132delinsAA | c.[462_463delinsTT] | p.(K155X) | XM_014111995.2; XP_013967470.1 | 2020 | 32445578 | Reference assembly and genomic location kindly provided by Kyoko Yoshizaki, 17 Dec 2020 | ||
| 731 | OMIA:001965-9913 | taurine cattle | Holstein (black and white) (Cattle) | Holstein cholesterol deficiency | APOB | insertion, gross (>20) | Naturally occurring variant | yes | 11 | "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" | 2016 | 26763170 | |||||||
| 436 | OMIA:000991-9796 | horse | Quarter Horse (Horse) | Androgen insensitivity syndrome (AIS) | AR | regulatory | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.52728703A>G | NM_001163891.1:c.1A>G | mutation in start codon for NP_001157363.1; | 2012 | 22095250 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022 | |||
| 1143 | OMIA:000991-9796 | horse | Tennessee Walking Horse (Horse) | Androgen insensitivity syndrome (AIS) | AR | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.52728885del | NM_001163891.1:c.183del | NP_001157363.1:p.(R63Gfs) | published as c.183delT and p.(Ser61fs); c. and p. information in the table has been updated to HGVS nomenclature | 2020 | 31936796 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022 | ||
| 783 | OMIA:000991-9796 | horse | Warmblood (Horse) | Androgen insensitivity syndrome | AR | deletion, gross (>20) | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.52808634_52808658del | NM_001163891.1:c.1630_1654del | the deletion is predicted to create a frameshift: "resulting in altered amino acid composition from p.543Lys and a premature stop codon 44 amino acid residues downstream in exon 3 | 2017 | 28192783 | ||||
| 786 | OMIA:000991-9796 | horse | Thoroughbred (Horse) | Androgen insensitivity syndrome | AR | missense | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.52872393G>C | NM_001163891.1:c.2042G>C | NP_001157363.1:p.(W681S) | 2016 | 27073903 | The genomic position in EquCab3.0 was provided by Ceara Mulvey, working under the guidance of Professor Ernie Bailey in April 2022; p. coordinates obtained from Villagomez et al. (2019) | |||
| 1144 | OMIA:000991-9796 | horse | Thoroughbred (Horse) | Androgen insensitivity syndrome (AIS) | AR | missense | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.52878093C>T | NM_001163891.1:c.2132C>T | NP_001157363.1:p.(A711V) | 2020 | 31936796 | ||||
| 960 | OMIA:001917-9615 | dog | Leonberger (Dog) Saint Bernard (Dog) | Polyneuropathy, ARHGEF10-related | ARHGEF10 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 16 | g.54349199_54349208del | c.1955_1958+6del | XM_005630036.3; XP_005630093.1; published as c.1955_1958+6delCACGGTGAGC - eliminating the 3'-splice junction of exon 17 and creating an alternate splice site leading to a truncated protein | 2014 | 25275565 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | |||
| 780 | OMIA:001334-9913 | taurine cattle | Swedish Red (Cattle) | Sperm, short tail | ARMC3 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 13 | g.24024660del | c.1442del | p.(A451fs*26) | rs797454424 | 2016 | 26923438 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 56 | OMIA:000666-9615 | dog | Miniature Schnauzer (Dog) | Mucopolysaccharidosis VI | ARSB | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.27870127_27870182del | c.-24_32del | NM_001048133.1 | 2020 | 32985704 | g. coordinate kindly provided by Karthik Raj 29 Oct 2020 | |||
| 640 | OMIA:000666-9615 | dog | Poodle, Miniature (Dog) | Mucopolysaccharidosis VI | ARSB | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.27870253_27870274del | c.103_124del | p.(A35Gfs*108) | NM_001048133.1; NP_001041598.1 | 2012 | 22329490 | Variant information initially provided by Karthik Raj and Urs Giger | ||
| 859 | OMIA:000666-9615 | dog | Great Dane (Dog) | Mucopolysaccharidosis VI | ARSB | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.27870445C>T | c.295C>T | p.(Q99*) | NM_001048133.1; NP_001041598.1 | 2018 | 29157190 | Variant information initially provided by Karthik Raj and Urs Giger, and confirmed by Ensembl's VEP | ||
| 1258 | OMIA:000666-9615 | dog | Miniature Pinscher (Dog) | Mucopolysaccharidosis VI | ARSB | missense | Naturally occurring variant | yes | CanFam3.1 | 3 | g.27950471G>A | c.910G>A | p.(G304R) | NM_001048133.1; NP_001041598.1 | 2020 | 32985704 | g. coordinate kindly provided by Karthik Raj 29 Oct 2020 | ||
| 1320 | OMIA:000666-9685 | domestic cat | Siamese (Cat) | Mucopolysaccharidosis VI, mild, in L476P/D520N cats | ARSB | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.145138738C>T | c.1558G>A | p.(D520N) | NM_001142259.1; NP_001135731.1; D520N/D520N and L476P/D520N cats have normal growth and appearance. L476P/D520N cats have a very mild MPS VI phenotype (increased incidence of degenerative joint disease). | 1998 | 9421472 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 132 | OMIA:000666-9685 | domestic cat | Domestic Shorthair Siamese (Cat) | Mucopolysaccharidosis VI | ARSB | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.145138869A>G | c.1427T>C | p.(L476P) | NM_001142259.1; NP_001135731.1 | rs5334475159 | 1996 | 8910299 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 67 | OMIA:001503-9615 | dog | American Staffordshire Terrier (Dog) | Neuronal ceroid lipofuscinosis, 4A | ARSG | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.15071276G>A | c.296G>A | p.(R99H) | 2010 | 20679209 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1309 | OMIA:002325-9685 | domestic cat | Encephalopathy, spongy | ASPA | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.13585610C>G | c.859G>C | p.(A287P) | XM_006939957.4; XP_006940019.1 | 2021 | 33779415 | ||||
| 111 | OMIA:002099-9615 | dog | German Shepherd Dog (Dog) | Ichthyosis, ASPRV1-related | ASPRV1 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.68587027A>G | c.1052T>C | p.(L351P) | XM_014117456.1; XP_013972931.1 | 2017 | 28249031 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 1673 | OMIA:002099-9615 | dog | Pembroke Welsh Corgi (Dog) | Ichthyosis, non-epidermolytic | ASPRV1 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.69888722_69888723del | XM_038551592.1:c.594_595del | XP_038407520.1:p.(L199Rfs*342) | 2024 | 38549226 | ||||
| 289 | OMIA:000194-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brown Swiss (Cattle) Holstein Friesian (Cattle) | Citrullinaemia | ASS1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 11 | NC_037338.1:g.100781668C>T | NM_173892.4:c.256C>T | NP_776317.1:p.(R86*) | Variant initially identified in Holstein Friesian and later reported in additional breeds: PMID:30014197, PMID:34779908. | rs5334475062 | 1989 | 2813370 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 65 | OMIA:001471-9615 | dog | Poodle, Standard (Dog) | Neonatal encephalopathy with seizures | ATF2 | missense | Naturally occurring variant | yes | CanFam3.1 | 36 | g.19078954A>C | c.152T>G | p.(M51R) | 2008 | 18074159 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 94 | OMIA:001954-9615 | dog | Lagotto Romagnolo (Dog) | Neurodegenerative vacuolar storage disease | ATG4D | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.50618958C>T | c.1288G>A | p.(A430T) | 2015 | 25875846 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1067 | OMIA:001552-9615 | dog | Australian Cattle Dog (Dog) | Neuronal ceroid lipofuscinosis, 12 | ATP13A2 | missense | Naturally occurring variant | yes | CanFam3.1 | 2 | g.81208162C>T | c.1118C>T | p.(T373I) | XM_005617949.3; XP_005618006.1 | 2019 | 30956123 | |||
| 400 | OMIA:001552-9615 | dog | Tibetan Terrier (Dog) | Neuronal ceroid lipofuscinosis, 12 | ATP13A2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 2 | g.81210367del | c.1623del | XM_005617949.3; XP_005618006.1; variant was published as c.1623delG p.P541fs*597 by Farias et al. (2011); Wöhlke et al. (2011) provided an alternate transcript position c.1620delG and proposed that the variant causes exon 16 skipping in NCL-affected Tibetan terriers. The sequence information provided by Wöhlke et al. (2011) corresponds to XM_005617949.3:c.1623del | 2011 | 21362476 22022275 | ||||
| 734 | OMIA:002110-9615 | dog | Belgian Shepherd Dog (Dog) | Ataxia, cerebellar, ATP1B2-related | ATP1B2 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.32551064_32551065ins[LT796559.1:g.50_276] | c.130_131ins[LT796559.1:g.50_276] | XM_546597.5; "a 227 bp SINE insertion into exon 2 of the ATP1B2 gene" | 2017 | 28620085 | ||||
| 188 | OMIA:001450-9913 OMIA:001464-9913 | taurine cattle | Belgian Blue (Cattle) Maas-Rijn-Ijssel (Cattle) | Congenital muscular dystonia 1 | ATP2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 25 | NC_037352.1:g.25933247G>A | NM_001075767.1:c.1675C>T | NP_001069235.1:p.(R559C) | Variant is reported to cause congenital muscular dystonia 1 in Belgian Blue cattle (OMIA 001450-9913) and congenital pseudomyotonia in a Dutch improved red and white cross-bred calf (OMIA:001464_9913). | rs5334475104 | 2008 | 18344998 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). | |
| 219 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 25 | NC_037352.1:g.25939141C>A | NM_001075767.1:c.857G>T | NP_001069235.1:p.(G286V) | This variant was identified as part of a haplotype with the G211V variant in Romagnola cattle. Akyürek et al. (2022; PMID: 36293223) suggest that the G286V variant is likely to be benign and that the G211V is likely to be causal. | rs3423529256 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 218 | OMIA:001464-9913 | taurine cattle | Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 25 | NC_037352.1:g.25939366C>A | NM_001075767.1:c.632G>T | NP_001069235.1:p.(G211V) | rs5334474971 | 2012 | 23046865 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 205 | OMIA:001464-9913 | taurine cattle | Chianina (Cattle) Marchigiana (Cattle) Romagnola (Cattle) | Pseudomyotonia, congenital | ATP2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 25 | NC_037352.1:g.25940510C>T | NM_001075767.1:c.491G>A | NP_001069235.1:p.(R164H) | Variant initially identified in Chianina cattle and later reported in additional breeds: PMID: 35717834 | rs3423529241 | 2008 | 18786632 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |
| 1192 | OMIA:002265-9615 | dog | Irish Terrier (Dog) | Darier disease | ATP2A2 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 26 | g.8200944_8200945insN[(205)] | c.2098-3_2098-2insN[(205)] | p.(T700Vfs*6) | NM_001003214.1; NP_001003214.1; Linek et al. (2020): "a heterozygous SINE insertion [~205bp] into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15", giving rise to NP_001003214.1:p.(Thr700Valfs*6) | 2020 | 32354065 | |||
| 1533 | OMIA:002265-9615 | dog | Shih Tzu (Dog) | Darier disease | ATP2A2 | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 26 | g.8434781A>C | c.2425A>C | p.(N809H) | NM_001003214.1; NP_001003214.1 | 2023 | 36883421 | |||
| 1347 | OMIA:001071-9685 | domestic cat | Wilson disease | ATP7B | missense | Naturally occurring variant | yes | A1 | p.(P550L) | 2020 | 31687873 | ||||||||
| 106 | OMIA:001071-9615 | dog | Labrador Retriever (Dog) | Wilson disease | ATP7B | missense | Naturally occurring variant | yes | CanFam3.1 | 22 | g.225112G>A | c.4151G>A | p.(R1384Q) | XM_005633831.3; XP_005633888.1; variant published as c.4358G>A / p.(R1453Q) and the variant coordinates in this table have been changed to reflect recent transcript IDs; conflicting evidence in regard to causality of this variant are reported in the literature - see https://omia.org/OMIA001071/9615/ for details | rs851958524 | 2016 | 26747866 | 30 Dec 2020: correct genomic location provided by Angelica K Kallenberg | |
| 1590 | OMIA:001071-9685 | domestic cat | Domestic Longhair | Wilson disease | ATP7B | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.19609511T>A | c.3670T>A | p.(W1224R) | XM_023251165.1; XP_023106933.1; variant heterozygous in a single affected cat | 2023 | 37427085 | |||
| 1136 | OMIA:001071-9685 | domestic cat | Wilson disease | ATP7B | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.19611002C>G | c.3890C>G | p.(T1297R) | XM_023251176.1; XM_023251176.1 | 2019 | 30561139 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 1076 | OMIA:001645-10036 | golden hamster | Black tremor | Atrn | insertion, gross (>20) | Naturally occurring variant | yes | Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" | 2002 | 11773967 | |||||||||
| 348 | OMIA:000487-9796 | horse | Belgian Draft (Horse) Friesian (Horse) Warmblood (Horse) | Hydrocephalus | B3GALNT2 | nonsense (stop-gain) | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.76887901C>T | XM_001491545.6:c.1423C>T | XP_001491595.2:p.(Q475*) | XM_001491545; XP_001491595; Ducro et al. (2015): "The nomenclature for the mutation is c.1423C>T [GenBank:XM_001491545] corresponding to p.Gln475* [GenBank:XP_001491595]". As at 25 April 2019, Ensembl's Variant Effect Predictor (VEP) gives the EquCab3 c. and p. coordinates as having not changed from the EquCab2 coordinates reported by Ducro et al. (2015). The Ensembl ref is ENSECAT00000049072 | rs3429464524 | 2015 | 26452345 | c. and p. variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. EquCab3 g. coordinate provided by Meredith O’Connell, working under the supervision of Professor Ernie Bailey, 24 April 2019. Breed information updated based on PMID: 38600096 | |
| 421 | OMIA:002068-9796 | horse | Friesian (Horse) | Dwarfism, Friesian | B4GALT7 | splicing | Naturally occurring variant | yes | EquCab3.0 | 14 | NC_009157.3:g.3772591C>T | XM_023617086.1:c.50G>A | XP_023472854.1:p.(R17K) | rs3447120064 | 2016 | 27793082 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. FN thanks Elizabeth Huffman, who updated the g. coordinates to EquCab3, working under the supervision of Professor Ernie Bailey; 23 April 2020. | ||
| 1391 | OMIA:002484-9615 | dog | Shetland Sheepdog (Dog) | Bardet-Biedl syndrome 2 | BBS2 | missense | Naturally occurring variant | yes | CanFam3.1 | 2 | g.59693737G>C | c.1222G>C | p.(A408P) | ENSCAFT00000014523.5; ENSCAFP00000013435.4 | 2021 | 34828377 | |||
| 356 | OMIA:002045-9615 | dog | Puli (Dog) | Bardet-Biedl syndrome 4 | BBS4 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 30 | g.36063748A>T | c.58A>T | p.(K20*) | 2017 | 28533336 | ||||
| 1131 | OMIA:002216-9544 | Rhesus monkey | Bardet-Biedl syndrome 7 | BBS7 | deletion, small (<=20) | Naturally occurring variant | yes | Mmul_8.0.1 | c.160delG | p.(A54fs) | 2019 | 31589838 | |||||||
| 1049 | OMIA:002178-9823 | pig | Landrace (Pig) Large White (Pig) Yorkshire (Pig) | Abortion, BBS9 and BMPER-related | BBS9 | deletion, gross (>20) | Naturally occurring variant | yes | Sscrofa11.1 | 18 | g.39817373_40029300del | Derks et al. (2018): "a large deletion in complete LD with the SSC18 haplotype of approximately 212kb (position 39,817,373 to 40,029,300), spanning a part of the BBS9 gene ... [and reducing] expression of the downstream BMPER gene". Initially reported in Large White and later reported in other breeds (PMID:39327728). | 2018 | 30231021 | |||||
| 635 | OMIA:001592-9615 | dog | Cavalier King Charles Spaniel (Dog) | Episodic falling | BCAN | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.41325010_41340731delinsAAGGCC | c.-13991_466+85delinsGGCCTT | XM_005622698.1; a 15.7kb deletion in the BCAN gene removing the first 3 exons | 2012 | 21821125 | ||||
| 298 | OMIA:000627-9913 | taurine cattle | Polled Hereford (Cattle) | Maple syrup urine disease | BCKDHA | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 18 | g.50551011C>T | c.148C>T | p.(Q50*) | cDNA position based on ENSBTAT00000021342.6 | rs5334475064 | 1990 | 2303405 | ||
| 200 | OMIA:000627-9913 | taurine cattle | Shorthorn (Cattle) | Maple syrup urine disease | BCKDHA | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 18 | g.50560242C>T | c.1380C>T | p.(P372L) | rs3423447991 | 1999 | 10425233 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1333 | OMIA:001079-9940 | sheep | spælsau (Sheep) | yellow fat | BCO2 | insertion, gross (>20) | Naturally occurring variant | yes | 15 | "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) | 2021 | 34193038 | |||||||
| 320 | OMIA:001079-9940 | sheep | spælsau (Sheep) | Yellow fat | BCO2 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 15 | NC_040266.1:g.25024133C>T | XM_012095240.3:c.196C>T | XP_011950630.2:p.(Q66*) | Oar_v3.1 position is g.21947481C>T | rs1090867485 | 2010 | 20122251 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 737 | OMIA:001554-9615 | dog | Finnish Lapphund (Dog) Lapponian Herder (Dog) | Multifocal retinopathy 3 | BEST1 | cmr3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.54470590del | c.1388del | p.(P463Hfs) | NM_001097545.1; NP_001091014.1; published as c.1388delC; variant initially identified in Lapponian Herder and later reported in additional breeds: PMID:27525650 | rs397509969 | 2010 | 21197113 | Variant information and allele abbreviation gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005 and genomic position in CanFam3.1 and EVA ID provided by Mateo Etcheveste and Robert Kuhn. |
| 59 | OMIA:001553-9615 | dog | Coton de Tulear (Dog) | Multifocal retinopathy 2 | BEST1 | cmr2 | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.54476143C>T | c.482G>A | p.(G161D) | NM_001097545.1; NP_001091014.1 | 2007 | 17460247 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | |
| 275 | OMIA:001444-9615 | dog | Boerboel (Dog) Bull Mastiff (Dog) English Mastiff (Dog) Great Pyrenees (Dog) | Multifocal retinopathy 1 | BEST1 | cmr1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.54478586G>A | c.73C>T | p.(R25*) | NM_001097545.1; NP_001091014.1 | 2007 | 17460247 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 398 | OMIA:001660-9615 | dog | Great Dane (Dog) | Inherited myopathy of Great Danes | BIN1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 19 | g.23522400A>G | c.786-2A>G | p.(R262_K263insASASRPFPQ) | XM_014121413.2; XP_013976888.1; published as IVS10-2A>G, updated in this table to HGVS nomenclature | 2013 | 23754947 | |||
| 1281 | OMIA:002306-9823 | pig | German Landrace (Pig) | Infertility and increased litter size | BMP15 | nonsense (stop-gain) | Naturally occurring variant | yes | Sscrofa11.1 | X | g.44618787C>T | p.(R212*) | "NP_001005155.2:p.R212X" (Flossmann et al., 2021) | 2021 | 33413103 | ||||
| 1254 | OMIA:000576-9823 | pig | Yorkshire (Pig) | Knobbed acrosome defect | BOLL | deletion, gross (>20) | Naturally occurring variant | yes | Sscrofa11.1 | 15 | g.101549770_101604750del | 2020 | 32975846 | ||||||
| 851 | OMIA:002132-9615 | dog | German Shorthaired Pointer (Dog) | Abortion (embryonic lethality), BTBD17-related | BTBD17 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.6048201_6048202insG | c.85+206_85+207insG | ROS_Cfam_1.0:g.6720627_6720628insG ENSCAFT00845033049.1:c.85+206_85+207insG; the homozygous variant genotype is associated with embryonic lethality in German Shorthaired Pointer, but may not be causal as the variant was observed at a high frequency in both heterozygous and homozygous form across normal dogs from multiple breeds (PMID:37582787) | rs852549625 | 2017 | 29053721 | |||
| 981 | OMIA:001991-9913 | taurine cattle | Nordic Red (Cattle) | Stillbirth | BTBD9 | deletion, gross (>20) | Naturally occurring variant | yes | 23 | "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" | 2016 | 27091210 | |||||||
| 325 | OMIA:001622-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup C | BTN1A1 | nonsense (stop-gain) | Naturally occurring variant | no | GRCg6a | 28 | g.903289G>T | c.165C>A | p.(C55*) | rs735807319 | 2005 | 16051833 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 455 | OMIA:000155-9615 | dog | Brittany Spaniel (Dog) | C3 deficiency | C3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.53573746del | c.2136del | p.(F712Lfs*11) | XM_038428862.1; XP_038284790.1 "a deletion of a cytosine at position 2136 (codon 712), leading to a frameshift that generates a stop codon 11 amino acids downstream" | 1998 | 9510185 | |||
| 1737 | OMIA:002886-9823 | pig | Large White (Pig) | Timothy syndrome 1 | CACNA1C | missense | Genome-editing (CRISPR-Cas9) | unknown | Sscrofa11.1 | 5 | NC_010447.5:g.69316114G>A | XM_021092981.1:c.1216G>A | XP_020948640.1:p.(G406R) | 2023 | 38665938 | ||||
| 1660 | OMIA:002819-9913 | taurine cattle | Holstein Friesian (Cattle) | Muscle weakness | CACNA1S | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 16 | NC_037343.1:g.79613592C>T | XM_024976574.1:c.3853G>A | XP_024832342.1:p.G1285S | ENSBTAT00000065901.3; ENSBTAP00000054797.3 | rs3423414874 | 2024 | 38246543 | ||
| 1087 | OMIA:002201-9913 | taurine cattle | Normande (Cattle) | Abortion due to haplotype NH7 | CAD | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 11 | g.72409143T>C | p.(Y452C) | published as CAD g.72399397T>C; p.Tyr452Cys | rs5334475092 | 2019 | 31056337 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1490 | OMIA:002573-151761 | yellow-crowned parrot | Lewy body-like disease | CADPS2 | missense | Naturally occurring variant | yes | c.1675G>C | p.(V559L) | 2022 | 36086934 | ||||||||
| 105 | OMIA:001820-9615 | dog | Parson Russell Terrier (Dog) | Ataxia, spinocerebellar | CAPN1 | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.52009339C>T | c.344G>A | p.(C115Y) | XM_540866.5; XP_540866.2 | 2013 | 23741357 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1692 | OMIA:002854-9615 | dog | Miniature Schnauzer (Dog) | Immunodeficiency, susceptibility to Mycobacterium avium complex | CARD9 | deletion, small (<=20) | yes | CanFam3.1 | 9 | NC_006591.3:g.49115079_49115081del | XM_844178.5:c.493_495del | XP_849271.2: p.(K165del) | 2024 | 38710903 | |||||
| 1674 | OMIA:002835-9615 | dog | Cavalier King Charles Spaniel (Dog) | Immunodeficiency, CARMIL2-related | CARMIL2 | missense | Naturally occurring variant | yes | CanFam3.1 | 5 | g.81801920G>A | c.871C>T | p.(R291*) | NC_006587.3; XM_022419456.1; XP_022275164.1 | rs3330142729 | 2024 | 38535207 | ||
| 49 | OMIA:001138-9615 | dog | American Foxhound (Dog) Beagle (Dog) English Foxhound (Dog) Harrier (Dog) Poodle, Miniature (Dog) Treeing Walker Coonhound (Dog) | Hypocatalasia | CAT | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.33397548C>T | c.979G>A | p.(A327T) | Variant initially identified in Beagle and later reported in additional breeds: PMID:29708978, PMID27525650 | 2000 | 11137458 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1032 | OMIA:002167-9913 | taurine cattle | Nordic Red (Cattle) | Asthenospermia | CCDC189 | splicing | Naturally occurring variant | yes | ARS-UCD1.2 | 25 | g.26880841C>T | Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." | rs5334474909 | 2019 | 30975085 | ||||
| 266 | OMIA:001540-9615 | dog | Old English Sheepdog (Dog) | Ciliary dyskinesia, primary | CCDC39 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 34 | g.13952270G>A | c.286C>T | p.(R96*) | 2011 | 21131972 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1403 | OMIA:002342-9940 | sheep | Blanc Du Massif Central (Sheep) Lacaune (Sheep) | Ciliary dyskinesia, primary (respiratory failure) | CCDC65 | LDHH6 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.147207999C>A | XM_004006389.4:c.521G>T | XP_004006438.1:p.(E111*) | XM_004006389.4; XP_004006438.1; published as NC_040254.1:g.147,207,999C>A | rs1085624756 | 2021 | 35052387 | |
| 1274 | OMIA:001521-9615 | dog | Portuguese Water Dog (Dog) | Progressive retinal atrophy, early onset | CCDC66 | EOPRA | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.33717704_33717705insT | c.2262_c.2263insA | p.(V747Sfs*8) | 2020 | 33273526 | |||
| 574 | OMIA:001521-9615 | dog | Schapendoes (Dog) | Generalized PRA | CCDC66 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.33745452_33745453insT | c.521_522insA | p.(N174Kfs*2) | NM_001168012.1; NP_001161484.1; genomic coordinates in accordance with HGVS 3'-rule | 2010 | 19777273 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 538 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | Naturally occurring variant | no | 28 | c.502_511delCGCTCACCCC | 2015 | 25873518 | ||||||||
| 539 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | deletion, small (<=20) | Naturally occurring variant | no | 28 | c.502_516delCGCTCACCCCGCCCC | 2015 | 25873518 | ||||||||
| 395 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | splicing | Naturally occurring variant | no | 28 | c.506-515del10 | 2012 | 22171251 | ||||||||
| 396 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | splicing | Naturally occurring variant | no | 28 | c.507-511del5 | 2012 | 22171251 | ||||||||
| 603 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | tva^r2 | insertion, small (<=20) | Naturally occurring variant | no | GRCg6a | 28 | g.985659_985660insCTCG | c.48_49insCTCG | p.(P18Afs) | NM_001044645.1; NP_001038110.1 | 2004 | 15564460 | Genomic position in GRCg6a provided by Joshua Khamis. | ||
| 12 | OMIA:001299-9031 | chicken | Resistance to avian sarcoma and leukosis viruses, subgroup A | CD320 | tva^r | missense | Naturally occurring variant | no | GRCg6a | 28 | g.985980C>G | c.185C>G | p.(C62W) | NM_001044645.1; NP_001038110.1; published as c.120C>G and p.(C40W); coordinates in the table have been updated to a recent reference genome and / or transcript | 2004 | 15564460 | Genomic position in GRCg6a provided by Joshua Khamis. | ||
| 1528 | OMIA:002626-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Haplotype with homozygous deficiency JBH17, CDC45-related | CDC45 | splicing | Naturally occurring variant | yes | UMD_3.1.1 | 17 | g.74743512G>T | located in a splicing donor site at a distance of 5 bp, affecting pre-mRNA splicing | 2021 | 33758295 | |||||
| 1496 | OMIA:002584-9615 | dog | Beauceron (Dog) | Deafness, CDH23-related | CDH23 | missense | Naturally occurring variant | yes | CanFam3.1 | 4 | g:22340631C>T | c.700C>T | p.(P234S) | ON462053; XM_022417544.1; XP_022273252.1 | 2023 | 36308003 | The UU_Cfam_GSD_1.0 genomic variant coordinate is: g.Chr4:23074925C>T | ||
| 991 | OMIA:001830-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH7 | CENPU | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 27 | g.15123637_15123640del | Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." | 2020 | 31733857 | |||||
| 964 | OMIA:001502-9913 | taurine cattle | Montbéliarde (Cattle) | Caprine-like Generalized Hypoplasia Syndrome | CEP250 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 13 | g.64710424C>T | c.493C>T | p.(Q165*) | rs5334474991 | 2015 | 25902731 | Coordinates obtained from and/or confirmed by EBI's VEP | ||
| 384 | OMIA:001244-9685 | domestic cat | Abyssinian (Cat) American Curl (Cat) American Shorthair (Cat) American Wirehair (Cat) Balinese (Cat) Bengal (Cat) Colorpoint Shorthair (Cat) Cornish Rex (Cat) Devon Rex (Cat) Donskoy (Cat) European Shorthair (Cat) Havana (Cat) Highlander (Cat) Maine Coon (Cat) Manx (Cat) Munchkin (Cat) Ocicat (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Peterbald (Cat) Pixiebob Longhair (Cat) Ragdoll (Cat) Scottish Fold (Cat) Siamese (Cat) Singapura (Cat) Somali (Cat) Sphynx (Cat) Tennessee Rex (Cat) Tonkinese (Cat) | Retinal degeneration II | CEP290 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.112522818A>C | c.7584+9T>G | XM_023256243.1; published as IVS50 + 9T>G. The cat sequenced to generate the Felis_catus_9.0 reference genome is homozygous for the likely causal variant. The genomic and cDNA coordinates had therefore been previously listed in this table as g.112522818TC>A and c.7584+9G>T. The information has been updated based on feedback from 潘旭 to reflect that the likely causal variant is c.7584+9G and that the normal allele is c.7584+9T[6/4/2023]. | 2007 | 17507457 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770). Variant was initially identified in the Abyssinian and Somali breeds but identified to be present in several other breeds (Menotti-Raymond et al., 2020; Pubmed:19747862; PMID:35709088) | |||
| 177 | OMIA:000636-9823 | pig | Membranoproliferative glomerulonephritis type II | CFH | missense | Naturally occurring variant | yes | Sscrofa11.1 | 10 | c.3610T>G | p.(I1166R) | CFH is located on Chr10 in Sscrofa10.2 g.2553907T>G, but recorded as 'unplaced/NW_018085100.1' in Sscrofa11.1. | 2002 | 12466119 | The genomic location on Sscrofa11.1 was determined by Stephanie Shields (27/05/2020) | ||||
| 1479 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | nonsense (stop-gain) | Genome-editing (CRISPR-Cas9) | yes | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57192317C>A | NM_001009781.1:c.1621G>T | NP_001009781.1:p.(G541*) | NM_001009781.1; NP_001009781.1; published as p.(G542X), coordinates in this table are updated to recent reference sequence | 2021 | 34632318 | |||
| 1478 | OMIA:001794-9940 | sheep | Romney (Sheep) | Cystic fibrosis | CFTR | deletion, small (<=20) | Genome-editing (CRISPR-Cas9) | yes | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.57218683_57218685del | NM_001009781.1:c.1518_1520del | NP_001009781.1:p.(F507del) | NM_001009781.1; NP_001009781.1; published as p.(F508del), coordinates are updated in this table to recent reference sequence | 2021 | 34632318 | |||
| 61 | OMIA:002072-9615 | dog | Old Danish Pointing Dog (Dog) | Myasthenic syndrome, congenital | CHAT | missense | Naturally occurring variant | yes | CanFam3.1 | 28 | g.1484906G>A | c.85G>A | p.(V29M) | XM_005637485.3; XP_005637542.1 | 2007 | 17586598 | 20181218 Thanks to Maarten de Groot for advising FN of the genomic location of this variant. | ||
| 838 | OMIA:002125-9913 | taurine cattle | Montbéliarde (Cattle) | Neurocristopathy | CHD7 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 14 | g.26402250_26402254del | p.(K594Afs*29) | 2017 | 28904385 | |||||
| 554 | OMIA:002022-9913 | taurine cattle | Red Dane (Cattle) | Arthrogryposis multiplex congenita, CHRNB1-related | CHRNB1 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.27122027del | NM_174516.2:c.55del | NP_776941.1:p.(A19Pfs47*) | Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) | rs5334474854 | 2016 | 27364156 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 490 | OMIA:000685-9915 | indicine cattle (zebu) | Brahman (Cattle) | Myasthenic syndrome, congenital, CHRNE-related | CHRNE | 470del20 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.26485848_26485867del | c.470_489del | Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised | rs5334475050 | 2002 | 12481987 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 614 | OMIA:000685-9615 | dog | Jack Russell Terrier (Dog) | Myasthenic syndrome, congenital, due to CHRNE | CHRNE | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | NC_006587.3:g.31705136dup | XM_014113502.2:c.729dup | XP_013968977.2:p.(G244Rfs*274) | published as c.633_634insC, previously reported in OMIA as c.636_637insC; coordinates in the table updated to NCBI trancript IDs and in accordance to HGVS rules (3'-rule and reported as duplication) [27/08/2024] | 2015 | 26429099 | |||
| 804 | OMIA:000685-9615 | dog | Heideterrier (Dog) Smooth Fox Terrier (Dog) | Myasthenic syndrome, congenital, due to CHRNE | CHRNE | duplication | Naturally occurring variant | yes | CanFam3.1 | 5 | NC_006587.3:g.31707450dup | XM_014113502.2:c.1508dup | XP_013968977.2:p.(S503Rfs*14) | published as Chr5:31,707,450_31,707,451insG, XM_014113502.1:c.1436_1437insG, XP_013968977.1:p.Ser479ArgfsTer14; in Heideterrier; information in the table updated to new transcript and in accordance with HGVS recommendations [27/08/2024]; for additional breed inforamtion see Pubmed:38853290 |
2017 | 28508416 | |||
| 1729 | OMIA:000685-9615 | dog | English Springer Spaniel (Dog) | Myasthenic syndrome, congenital, CHRNE-related | CHRNE | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 5 | NC_049226.1:chr5:31915101C>A | XM_038536566.1:c.1509C>A | XP_038392494.1:p.(S503R) | reported in two affected dogs | 2024 | 38853290 | |||
| 1664 | OMIA:000698-9940 | sheep | Myotonia | CLCN1 | unpublished | unknown | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | Reference not in PubMed; see OMIA 000698-9940 for reference details | ||||||||||
| 224 | OMIA:000698-9925 | goat | Myotonia | CLCN1 | missense | Naturally occurring variant | yes | ARS1.2 | 4 | NC_030811.1:g.13857007C>G | XM_013963554.2:c.2656G>C | XP_013819008.1:p.(A886P) | Previously listed in OMIA based on ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000031898.1:c.2590G>C; p.(P864A); c. and p. updated based on NCBI transcript IDs [26/08/2024] | rs5334475115 | 1996 | 8855341 | |||
| 609 | OMIA:000698-9615 | dog | Australian Cattle Dog (Dog) Border Collie (Dog) | Myotonia | CLCN1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 16 | NC_006598.3:g.6344748_6344749insT | NM_001003124.2:c.2647_2648insA | NP_001003124.1:p.(R883Qfs*18) | published as c.2665insA; p.(R889fs); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17552451 | |||
| 1041 | OMIA:000698-9615 | dog | Labrador Retriever (Dog) | Myotonia | CLCN1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 16 | NC_006598.3:g.6348929T>A | NM_001003124.2:c.2275A>T | NP_001003124.1:p.(R759X) | published as "Chr16:6348929 T A CLCN1 ENSCAFG00000003619.3 stopgain" |
2018 | 29934119 | |||
| 62 | OMIA:000698-9615 | dog | Miniature Schnauzer (Dog) | Myotonia | CLCN1 | missense | Naturally occurring variant | yes | CanFam3.1 | 16 | NC_006598.3:g.6366383G>A | NM_001003124.2:c.803C>T | NP_001003124.1:p.(T268M) | 1999 | 10452529 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1364 | OMIA:000698-9615 | dog | American Bulldog (Dog) | Myotonia | CLCN1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 16 | NC_006598.3:g.6369245_6369246insAGAG | NM_001003124.2:c.436_437insCTCT | NP_001003124.1:p.(Y146Sfs*49) | 2020 | 33246886 | ||||
| 1570 | OMIA:000698-9615 | dog | Mixed Breed (Dog) | Myotonia | CLCN1 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 16 | NC_006598.3:g.[6367458_6367478del;6367482del;6367485A>C] | NM_001003124.2:c.[703T>G;706del;710_730del] | NP_001003124.1:p.[(F235V;V236fs)] | published as c.[705T>G; 708del; 712_732del], coordinates in the table have been updated to the CanFam3.1 reference genome and reflect correction in PMID:37212506. |
2023 | 37212506 | |||
| 161 | OMIA:000698-9796 | horse | New Forest Pony (Horse) | Myotonia | CLCN1 | missense | Naturally occurring variant | yes | EquCab3.0 | 4 | NC_009147.3:g.96518592A>C | XM_001915636.4:c.1775A>C | XP_001915671.3:p.(D592A) | c.1775A>C, Genbank acc. XM_001915636; p.D592A, Genbank acc. XP_001915671 (Wijnberg et al., 2014) | rs5334475185 | 2012 | 22197188 | (FN thanks Izabela De Assis Rocha, who provided genomic location in EquCab3.0 and the Genbank acc IDs, working under the supervision of Professor Ernie Bailey; 15 April 2020) Revised genomic location kindly provided by Cord Drögemüller; 21 May 2021 | |
| 1573 | OMIA:000698-9685 | domestic cat | Domestic Longhair | Myotonia | CLCN1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | NC_018724.3:g.158967085_158967092del | NM_001305027.1:c.428_433+1del | NP_001291956.1:p.(L143Qfs3*) | published as chrA2:15897085‐15897092, coordinates in this table have been verified in Felis_catus_9.0 | 2022 | 35815860 | |||
| 1623 | OMIA:000698-9685 | domestic cat | Myotonia | CLCN1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | NC_018724.3:g.158976314G>C | NM_001305027.1:c.991G>C | NP_001291956.1:p.(A331P) | 2023 | 37668104 | |||||
| 408 | OMIA:000698-9685 | domestic cat | Myotonia | CLCN1 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | NC_018724.3:g.158986498G>T | NM_001305027.1:c.1930+1G>T | 2014 | 25356766 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||||
| 245 | OMIA:000698-9940 | sheep | Rasa Aragonesa, Spain (Sheep) | Myotonia | CLCN1 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.115541101G>A | XM_004008136.4:c.277G>A | XP_004008185.4:p.(E93K) | Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. | rs401726021 | 2015 | 25744800 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1365 | OMIA:000698-9823 | pig | Myotonia | CLCN1 | deletion, gross (>20) | Naturally occurring variant | yes | Sscrofa11.1 | 18 | NC_010460.4:g.6912538_6916702del | 2019 | 31666547 | |||||||
| 399 | OMIA:000698-89462 | water buffalo | Murrah (Buffalo) | Myotonia | CLCN1 | splicing | Naturally occurring variant | yes | UOA_WB_1 | 8 | NC_037552.1:g.106762128C>T | NM_001290916.1:c.396C>T | abnormal splicing associated with synonymous SNP (Ser132, c.396C>T) | 2013 | 23339992 | ||||
| 1678 | OMIA:000698-9615 | dog | French Bulldog (Dog) | Myotonia | CLCN1 | duplication | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 16 | NC_049237.1:g.6074128_6074135dup | NM_001003124.2:c.2423_2430dup | NP_001003124.1:p.(F811Lfs*39) | 2024 | 38473107 | ||||
| 210 | OMIA:001887-9913 | taurine cattle | Belgian Blue (Cattle) | Osteopetrosis with gingival hamartomas | CLCN7 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 25 | g.[1139611G>T; 1139613A>G] | c.[2248T>C;2250C>A] | p.(Y750Q) | 2014 | 24159188 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 648 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 1 | deletion, gross (>20) | Naturally occurring variant | yes | 1 | 37kb deletion of exons 1-4 | 2000 | 10810088 | ||||||
| 781 | OMIA:001135-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Renal dysplasia | CLDN16 | Type 2 | deletion, gross (>20) | Naturally occurring variant | yes | 1 | "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised | 2002 | 12047224 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||||
| 1669 | OMIA:002432-9913 | taurine cattle | Hereford (Cattle) | Retinal degeneration, CLN3-realted | CLN3 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 25 | NC_037352.1:g.26043843del | NM_001075174.2:c.1106del | NP_001068642.2:p.(P369Rfs*8) | NM_001075174.2; NP_001068642.2 | rs5377951844 | 2024 | 38516801 | ||
| 593 | OMIA:001482-9913 | taurine cattle | Devon (Cattle) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 12 | g.52112732_52112733insG | c.662_663insG | p.(R221Gfs*6) | 2006 | 16935476 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG | |||
| 279 | OMIA:001482-9615 | dog | Australian Cattle Dog (Dog) Border Collie (Dog) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 22 | g.30574637C>T | c.619C>T | p.(Q207*) | rs1152388418 | 2005 | 16033706 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020: g. coordinate corrected, with thanks to Angelica K Kallenberg | ||
| 541 | OMIA:001482-9615 | dog | Golden Retriever (Dog) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 22 | g.30574953_30574954del | c.935_936del | p.(E312Vfs*6) | NM_001011556.1; NP_001011556.1,published as CLN5:c.934_935delAG; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 25934231 | Breed information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 389 | OMIA:001482-9940 | sheep | Borderdale, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis, 5 | CLN5 | splicing | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 10 | g.56313269G>A | c.571+1G>A | rs422165326 | 2008 | 17988881 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 68 | OMIA:001443-9615 | dog | Australian Shepherd (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | missense | Naturally occurring variant | yes | CanFam3.1 | 30 | NC_006612.3:g.32247875A>G | NM_001011888.1:c.829T>C | NP_001011888.1:p.(W277R) | alternative coordinates: ROS_Cfam_1.0:g.32443458A>G ENSCAFT00845033654.1:c.829T>C ENSCAFP00845026347.1:p.Trp277Arg | rs1152388420 | 2011 | 21234413 | ||
| 1703 | OMIA:001443-9615 | dog | Mixed Breed (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | splicing | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 30 | NC_006612.4:g.32185406C>T | 2024 | 38927597 | ||||||
| 1213 | OMIA:001443-9685 | domestic cat | Domestic medium-haired | Neuronal ceroid lipofuscinosis, 6 | CLN6 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | B3 | g.39334330G>A | c.668G>A | p.(W223*) | ENSFCAT00000025909:c.668G>A; XM_003987007.5:c.668G>A (Katz et al. (2020) | rs5334475122 | 2020 | 32518081 | ||
| 671 | OMIA:001443-9940 | sheep | South Hampshire, New Zealand (Sheep) | Neuronal ceroid lipofuscinosis | CLN6 | deletion, gross (>20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 7 | deletion of exon 1 | 2013 | 23338040 | ||||||
| 234 | OMIA:001443-9940 | sheep | Merino (Sheep) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.16039510G>A | NM_001040289.1:c.184C>T | NP_001035379.1:p.(R62C) | protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively | rs399747319 | 2006 | 17046213 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1702 | OMIA:001443-9615 | dog | Schapendoes (Dog) | Neuronal ceroid lipofuscinosis, 6 | CLN6 | missense | Naturally occurring variant | unknown | UU_Cfam_GSD_1.0 | 30 | NC_049251.1:g.32682554A>G | XM_038580811.1:c.386T>C | XP_038436739.1:p.(L129P) | 2024 | 38866396 | ||||
| 1030 | OMIA:001962-9542 | Japanese macaque | Neuronal ceroid lipofuscinosis, 7 | CLN7 | deletion, small (<=20) | Naturally occurring variant | yes | 4 | c.769delA | p.(I257Lfs*36) | 2018 | 30048804 | |||||||
| 690 | OMIA:001506-9615 | dog | Alpine Dachsbracke (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 37 | g.30852988_30902901del | c.-14679_*18669del | NM_001012343.1; a homozygous deletion encompassing the entire CLN8 gene | 2017 | 28024876 | g. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017 | |||
| 971 | OMIA:001506-9615 | dog | Saluki (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 37 | g.30874636dupT | c.349dupT | p.(E117*) | "an insertion of 1 bp (T) in the CLN8 gene (Fig. S2) in a short T repeat, thereby changing the stretch of 9 T's to a stretch consisting of 10 T's. The exact position of the inserted base could obviously not be verified, given that this was an insertion of a single base in a stretch of nine repeats of the same base (CFA37:g.30874628–30874636). According to the recommended nomenclature, the T insertion was noted as a T duplication in the T farthest in the 3′ direction (g.30874636dupT; c.349dupT)" | 2018 | 29446145 | |||
| 69 | OMIA:001506-9615 | dog | English Setter (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | missense | Naturally occurring variant | yes | CanFam3.1 | 37 | g.30874779T>C | c.491T>C | p.(L164P) | 2005 | 15629147 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 338 | OMIA:001506-9615 | dog | Australian Shepherd (Dog) German Shorthaired Pointer (Dog) | Neuronal ceroid lipofuscinosis, 8 | CLN8 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 37 | g.30883950G>A | c.585G>A | p.(W195*) | NM_001012343: c.585G>A (Guo et al., 2014) | 2014 | 24953404 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; confirmed by Guo et al. (2019, pages 3, 4, 5 and 6), assuming that the g. coordinate (g.30,895,648) in the abstract of Guo et al. (2019) is a typo. | ||
| 547 | OMIA:001977-9615 | dog | Shetland Sheepdog (Dog) | Progressive retinal atrophy, due to CNGA1 mutations | CNGA1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.43831897_43831900del | c.1752_1755del | p.(T585Sfs*7) | NM_001003222.1; published as c.1752_1755delAACT | 2015 | 26202106 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 548 | OMIA:001481-9615 | dog | Labrador Retriever (Dog) | Achromatopsia-2 | CNGA3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 10 | g.44234198_44234200del | c.1931_1933del | p.(V644del) | NM_001301112.1; published as c.1931_1933delTGG | rs852784090 | 2015 | 26407004 | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn | |
| 97 | OMIA:001481-9615 | dog | German Shepherd Dog (Dog) | Achromatopsia-2 | CNGA3 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.44234861C>T | c.1270C>T | p.(R424W) | NM_001301112.1; NP_001288041.1 | 2015 | 26407004 | Genomic position in CanFam3.1 provided by Mateo Etcheveste. | ||
| 1016 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.108958871C>T | XM_027965914.1:c.1618G>A | XP_027821715.1:p.(G540S) | 2017 | 28282490 | Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. | |||
| 317 | OMIA:001481-9940 | sheep | Awassi (Sheep) | Achromatopsia-2 (day blindness) | CNGA3 | nonsense (stop-gain) | Naturally occurring variant | yes | Oori1 scaffold00739 | 3 | g.263324C>T | c.706C>T | p.(R236*) | In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" | 2010 | 19874885 | |||
| 918 | OMIA:002723-9615 | dog | Papillon (Dog) Phalène (Dog) | Progressive retinal atrophy | CNGB1 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.58622673_58622675delinsCTAGCTAC | c.2387_2389delinsCTAGCTAC | p.(Y796Sfs*7) | NM_001284462.1; NP_001271391.1; published as c.2685delA2687_2688insTAGCTA and p.(Y889Sfs*5); coordinates in the table have been updated to a recent reference genome and / or transcript and updated to HGVS recommendations | rs1152388403 | 2013 | 24015210 | ||
| 631 | OMIA:001365-9615 | dog | Alaskan Malamute (Dog) Miniature Australian Shepherd Dog (Dog) | Achromatopsia (cone degeneration, hemeralopia), AMAL | CNGB3 | cd^AMAL | deletion, gross (>20) | Naturally occurring variant | yes | 29 | "deletion removing all exons of canine CNGB3" | 2002 | 12140185 | ||||||
| 1400 | OMIA:001365-9913 | taurine cattle | Brown Swiss (Cattle) | Achromatopsia | CNGB3 | OH1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 14 | NC_037341.1:g.76011964G>A | XM_015474554.2:c.751G>A | XP_015330040.2:p.(D251N) | XM_015474554.2: c.751G>A, XP_015330040.2: p.Asp251Asn ENSBTAT00000065296.2:c.751G>A ENSBTAP00000054173.2:p.Asp251Asn | rs716218235 | 2021 | 34830323 | |
| 27 | OMIA:001365-9615 | dog | German Shorthaired Pointer (Dog) | Achromatopsia (cone degeneration, hemeralopia), GSPT | CNGB3 | cd^GSPT | missense | Naturally occurring variant | yes | CanFam3.1 | 29 | g.32837065C>T | c.784G>A | p.(D262N) | 2002 | 12140185 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020 Chromosome corrected, thanks to Angelica K Kallenberg | ||
| 1502 | OMIA:002591-9615 | dog | Dalmatian (Dog) | Lysosomal storage disease, CNP-related | CNP | deletion, small (<=20) | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | g.20350240del | c.1107del | p.(K370Nfs*11) | ENSCAFT00000102206 | 2022 | 35447247 | |||
| 1680 | OMIA:002591-9615 | dog | Weimaraner (Dog) | Lysosomal storage disease, CNP-related | CNP | missense | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | g.20355460G>A | c.125C>T | p.(T42M) | XM_844467.6; XP_849560.2; NC_006591.4 | 2024 | 38397235 | |||
| 1273 | OMIA:002301-9615 | dog | Labrador Retriever (Dog) Leonberger (Dog) Pyrenean Shepherd (Dog) Saint Bernard (Dog) | Laryngeal paralysis and polyneuropathy | CNTNAP1 | LPPN3 | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.20298261C>T | c.2810G>A | p.(G937E) | XM_548083.6:c.2810G>A; XP_548083.3:p.Gly937Glu; variant initially identified in Labrador Retriever, Leonberger and Saint Bernard and later reported in a Pyrenean Shepherd (PMID: 37582787) | rs24587752 | 2020 | 33261176 | |
| 172 | OMIA:001718-9823 | pig | Dwarfism, Schmid metaphyseal chondrodysplasia | COL10A1 | missense | Naturally occurring variant | yes | Sscrofa11.1 | 1 | g.81767089C>T | c.1768G>A | p.(G590R) | rs5334475171 | 2000 | 11130976 | The genomic and CDS position was determined by Stephanie Shields and the effect was confirmed with Ensembl VEP (27/05/2020) | |||
| 1657 | OMIA:002811-9615 | dog | Old English Sheepdog (Dog) | Multiocular defect | COL11A1 | missense | Naturally occurring variant | yes | CanFam3.1 | 6 | g.47611886T>C | c.1775T>C | p.(F1592S) | 2023 | 38153936 | ||||
| 78 | OMIA:001772-9615 | dog | Labrador Retriever (Dog) | Skeletal dysplasia 2 (SD2) | COL11A2 | missense | Naturally occurring variant | yes | CanFam3.1 | 12 | g.2652874C>G | c.143G>C | p.(R48P) | ROS_Cfam_1.0:g.2983602C>G ENSCAFT00845034709.1:c.143G>C ENSCAFP00845027184.1:p.Arg48Pro | rs851399084 | 2013 | 23527306 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1634 | OMIA:002793-9685 | domestic cat | American Shorthair (Cat) | Epidermolysis bullosa, junctional, COL17A1-related | COL17A1 | splicing | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | D2 | g.62124169del | c.3019+1del | XM_006938156.5; variant reported in a single affected cat | 2023 | 37895184 | ||||
| 1635 | OMIA:002793-9685 | domestic cat | European Shorthair (Cat) | Epidermolysis bullosa, junctional, COL17A1-related | COL17A1 | splicing | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | D2 | g.62149308C>T | c.769+5G>A | p.([=,p.Val257Glyfs*82]) | XM_006938156.5; XP_006938218.3, variant described in a single affected cat | 2023 | 37895184 | |||
| 839 | OMIA:002127-9913 | taurine cattle | Simmental (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.36470764_36470767delinsT | c.3145_3148delinsT | p.(A1049_P1050delinsS) | UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 | rs876049195 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1031 | OMIA:002127-9913 | taurine cattle | Red Angus (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.36463798G>A | NM_001034039.2:c.1063G>A | NP_001029211.1:p.(G355S) | Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) | rs3423092630 | 2019 | 30788588 | ||
| 1289 | OMIA:002127-9913 | taurine cattle | Holstein (black and white) (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.36473359T>A | NM_001034039.2:c.3917T>A | NP_001029211.1:p.(V1306E) | NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) | rs5334474947 | 2021 | 33672767 | ||
| 1698 | OMIA:002127-9913 | taurine cattle | Normande (Cattle) | Osteogenesis imperfecta, type II, COL1A1-related | COL1A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.36473965G>A | NM_001034039.2:c.4234G>A | NP_001029211.1:p.(D1412N) | 2024 | 38773368 | ||||
| 959 | OMIA:002126-9615 | dog | Golden Retriever (Dog) | Osteogenesis imperfecta, type III, COL1A1-related | COL1A1 | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.26193593C>G | c.1145G>C | p.(G382A) | NM_001003090.1; NP_001003090.1; published as c.1276G>C, p.(G208A); coordinates in the table have been updated to a recent reference genome and / or transcript | rs1152388502 | 2000 | 11147834 | ||
| 762 | OMIA:002112-9615 | dog | Beagle (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 14 | g.(19918265_19918268delinsTGTCATTGG) | c.3656_3859delinsTGTCATTGG | p.(L1286Cfs*31) | NM_001003187.1; NP_001003187.1; "a mutation in which nucleotides 3991-3994 ("CTAG") were replaced with "TGTCATTGG." The first seven bases of the inserted sequence were identical to nucleotides 4002-4008 of the normal canine COL1A2 sequence. The resulting frameshift changed 30 amino acids and introduced a premature stop codon." The genomic information is presented in brackets as the variant was detected in cDNA and the genomic position is predicted. Coordinates in the table have been updated to a recent reference genome and or transcripts. | 2001 | 11393792 | |||
| 1114 | OMIA:002112-9615 | dog | Lagotto Romagnolo (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | duplication | Naturally occurring variant | yes | CanFam3.1 | 14 | g.19898279_19898281dup | c.877_879dup | p.(P293dup) | NM_001003187.1; NP_001003187.1 | 2019 | 31468557 | |||
| 852 | OMIA:002112-9615 | dog | Chow Chow (Dog) | Osteogenesis imperfecta, COL1A2-related | COL1A2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 14 | g.19898487G>A | c.936+1G>A | 2018 | 29036614 | |||||
| 1275 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | deletion, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | 5 | g.32301911_32308589del | "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) | 2021 | 33316082 | |||||
| 1241 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | delins, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | 5 | g.32303127_32306640delinsTCTGGGGAGC | 2020 | 32894162 | ||||||
| 840 | OMIA:001926-9913 | taurine cattle | Charolais (Cattle) Salers (Cattle) | Bulldog calf | COL2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32301746G>A | NM_001001135.3:c.1799G>A | NP_001001135.2:p.(G600D) | previously listed in OMIA as c.1791G>A, updated to reflect recent transcrupt inforamtion [03/09/2024] | rs5334474917 | 2017 | 28904385 | ||
| 842 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32303739G>A | NM_001001135.3:c.2158G>A | NP_001001135.2:p.(G720S) | rs455596159 | 2017 | 28904385 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 414 | OMIA:001926-9913 | taurine cattle | Danish Holstein (Cattle) | bulldog calf | COL2A1 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32305226G>A | NM_001001135.3:c.2463+1G>A | rs5334475095 | 2016 | 27296271 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 223 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32307658G>A | NM_001001135.3:c.2878G>A | NP_001001135.2:p.(G960R) | rs3423194986 | 2014 | 25017103 | |||
| 841 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32308008G>A | NM_001001135.3:c.2986G>A | NP_001001135.2:p.(G996S) | rs876243579 | 2017 | 28904385 | |||
| 1026 | OMIA:001926-9913 | taurine cattle | Holstein Friesian (Cattle) | Bulldog calf | COL2A1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.32308734G>A | NM_001001135.3:c.3166G>A | NP_001001135.2:p.(G1056S) | rs5334475093 | 2019 | 30378686 | |||
| 278 | OMIA:002618-9615 | dog | English Springer Spaniel (Dog) | Nephropathy | COL4A4 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 25 | g.39893376G>A | c.2713C>T | p.(Q905*) | NM_001031818.1; NP_001026988.1; published as c.2806C>T and p.(Q904*) | 2012 | 22369189 | |||
| 277 | OMIA:002618-9615 | dog | English Cocker Spaniel (Dog) | Nephropathy | COL4A4 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 25 | g.39953906T>A | c.115A>T | p.(K39*) | 2007 | 17552442 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 471 | OMIA:001112-9615 | dog | Navasota (mixed breed) (Dog) | Nephritis, X-linked | COL4A5 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.82134508_82134517del | c.513_522del | p.(N172Ifs) | XM_005640969.3; XP_005641026.1; a 10 base pair (TAATCCAGGA) deletion in exon 9 of COL4A5 | 2003 | 12879362 | |||
| 276 | OMIA:001112-9615 | dog | Samoyed (Dog) | Nephritis, X-linked | COL4A5 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | X | g.82196868G>T | c.3079G>T | p.(G1027*) | 1994 | 8171024 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1124 | OMIA:002165-9615 | dog | Labrador Retriever (Dog) | Ehlers-Danlos syndrome, classic type, 1 | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.50806169del | c.3038del | p.(G1013Vfs*260) | XM_022423936.1; XP_022279644.1; published as c.3038delG - "variant arose by a de novo mutation event during the development of the mother." (Bauer et al., 2019) | 2019 | 31546637 | |||
| 1125 | OMIA:002165-9615 | dog | Mixed Breed (Dog) | Ehlers-Danlos syndrome, classic type, 1 | COL5A1 | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.50832936G>A | c.4711G>A | p.(G1571R) | XM_022423936.1,c.4711G>A; XP_022279644.1,p.(Gly1571Arg) | 2019 | 31546637 | |||
| 1722 | OMIA:002165-9615 | dog | Golden Retriever (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | nonsense (stop-gain) | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50091843C>T | XM_038615652.1:c.2512C>T | XP_038471580.1:p.(R838*) | ENSCAFT00000031582.6:c.2500C>T, p.(Arg834Ter) | 2024 | 39175162 | |||
| 1719 | OMIA:002165-9615 | dog | Mixed Breed (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50109824del | XM_038615652.1:c.3371del | XP_038471580.1:p.(E1124Lfs*364) | ENSCAFT00000031582.6:c.3360del, p.(E1121Lfs*364) | 2024 | 39175162 | |||
| 1721 | OMIA:002165-9615 | dog | Dachshund, Miniature (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | duplication | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50111993dup | XM_038615652.1:c.3675dup | XP_038471580.1:p.(G1226Rfs*62) | Published as g.50111986insC, ENSCAFT00000031582.6:c.3663_3664insC, p.(Gly1222Argfs*62). Coordinates in this table have been adjusted in accordance with the HGVS recommendations. | 2024 | 39175162 | |||
| 1720 | OMIA:002165-9615 | dog | Scottish Terrier (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50114284del | XM_038615652.1:c.3908del | XP_038471580.1:(P1303Rfs*186) | Published as g.50114279delC; ENSCAFT00000031582.6:c.3891del; p.(P1299Rfs*186). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. | 2024 | 39175162 | |||
| 1724 | OMIA:002165-9615 | dog | German Shepherd Dog (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | missense | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50116228G>A | XM_038615652.1:c.4117G>A | XP_038471580.1:p.(G1373R) | ENSCAFT00000031582.6:c.4105G>A, p.(Gly1369Arg) | 2024 | 39175162 | |||
| 1723 | OMIA:002165-9615 | dog | Beagle (Dog) | Ehlers-Danlos syndrome, classic type 1 | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 9 | NC_006591.4:g.50131170_50131172del | XM_038615652.1:c.5320_5322del | XP_038471580.1:p.G1774del | Published as chr9:50131166delGAG, ENSCAFT00000031582.6:c.5296_5298del, p.(Glu1766del). Coordinates in this table have been adjusted in accordance with the HGVS 3'rule. |
2024 | 39175162 | |||
| 1696 | OMIA:002165-9685 | domestic cat | Maine Coon (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, gross (>20) | Naturally occurring variant | yes | F.catus_Fcat126_mat1.0 | D4 | NC_058380.1:g.93561989_93595728del | deletion of 33740 base pairs including the last two exons of COL5A1 | 2024 | 38745376 | |||||
| 1465 | OMIA:002165-9685 | domestic cat | Bombay (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.93209345T>A | c.3514A>T | p.(Lys1172*) | XM_023242950.1; XP_023098718.1 | 2022 | 35627182 | |||
| 1025 | OMIA:002165-9685 | domestic cat | Domestic Shorthair | classical Ehlers-Danlos syndrome | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.93210344del | c.3420del | p.(L1141Sfs*134) | XM_023242951.1; XP_023098719.1; published as c.3420delG | 2018 | 30246406 | |||
| 1466 | OMIA:002165-9685 | domestic cat | Domestic Shorthair | classical Ehlers-Danlos syndrome | COL5A1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.93215496del | c.3066del | p.(Gly1023Valfs*50) | XM_023242950.1; XP_023098718.1 | 2022 | 35627182 | |||
| 1609 | OMIA:002165-9685 | domestic cat | Domestic medium-haired | classical Ehlers-Danlos syndrome | COL5A1 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.93290016T>G | c.501-2A>C | XM_023242950.1 | 2023 | 37594181 | ||||
| 1464 | OMIA:002165-9685 | domestic cat | Bengal (Cat) | classical Ehlers-Danlos syndrome | COL5A1 | deletion, gross (>20) | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.93331577_93331598del | c.112_118+15del | r.spl? | XM_023242950.1 | 2022 | 35627182 | |||
| 1263 | OMIA:002295-9913 | taurine cattle | Holstein (black and white) (Cattle) | Ehlers-Danlos syndrome, classic type, 2 | COL5A2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.7331916G>T | XM_024979774.1:c.2366G>T | XP_024835542.1:p.(G789V) | XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) | rs5334475045 | 2020 | 33143196 | ||
| 1460 | OMIA:002295-9615 | dog | Chihuahua (Dog) | Ehlers-Danlos syndrome, classic type, 2 | COL5A2 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 36 | g.30548697_30548723del | c.3388_3414del | p.(Lys1130_Asp1138del) | XM_005640393.3; XP_005640450.1 | 2022 | 35627319 | |||
| 340 | OMIA:001967-9615 | dog | Landseer (Dog) | Muscular dystrophy, Ullrich type | COL6A1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 31 | g.39303964G>T | c.289G>T | p.(E97*) | XM_003434001.5; XP_003434049.2; previously incorrectly listed in this table as c.289C>T; p.(Q97*) - corrected 8/2/2022 | 2015 | 26438297 | |||
| 1184 | OMIA:002260-9913 | taurine cattle | Holstein Friesian (Cattle) | de novo mutation in an AI sire | COL6A3 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 3 | NC_037330.1:g.116826597G>A | XM_024990262.1:c.5675C>T | XP_024846030.1:p.(T1892M) | Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. p. coordinates have been updated to reflect recent NCBI transcript [29/08/2024]. | rs5334475059 | 2017 | 28904385 | ||
| 1625 | OMIA:002274-9615 | dog | American Staffordshire Terrier (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 25 | g.48005972del | c.6398del | p.(P2133Rfs*109) | NM_001103215.1; NP_001096685.1; published as g.48287602CG>C in CanFam4 | 2023 | 37706358 | |||
| 1208 | OMIA:002274-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | splicing | Naturally occurring variant | yes | CanFam3.1 | 25 | g.48007994C>T | c.6210+1G>A | NM_001103215.1; CanFam3.1 chr25:48,007,994C > T; NM_001103215.1 c.6210 + 1G > A (Bolduc et al., 2020) | 2020 | 32439203 | ||||
| 1207 | OMIA:002274-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, COL6A3-related | COL6A3 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 25 | g.48014962G>A | c.4726C>T | p.(R1576*) | NM_001103215.1; NP_001096685.1; CanFam3.1 chr25:48,014,962G > A; NM_001103215.1 c.4726C > T, p.R1576* (Bolduc et al., 2020) | 2020 | 32439203 | |||
| 292 | OMIA:000341-9913 | taurine cattle | Rotes Höhenvieh, Germany (Cattle) Vorderwälder, Germany (Cattle) | Epidermolysis bullosa, dystrophic | COL7A1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 22 | g.51301158C>T | c.4762C>T | p.(R1588*) | rs876174537 | 2012 | 22715415 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 357 | OMIA:000341-9615 | dog | Central Asian Shepherd Dog (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.40532043C>T | c.4579C>T | p.(R1527*) | 2017 | 28493971 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 38 | OMIA:000341-9615 | dog | Golden Retriever (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.40538034G>A | c.5716G>A | p.(G1906S) | rs1152388417 | 2003 | 12874109 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1276 | OMIA:000341-9615 | dog | Basset Hound (Dog) | Epidermolysis bullosa, dystrophic | COL7A1 | complex rearrangement | Naturally occurring variant | yes | CanFam3.1 | 20 | g.[40524302_40524308del;40524267_40524380dup] | c.[2028_2034del;1993_2050+56dup] | p.(V677Sfs*11) | NM_001002980.1; NP_001002980.1; complex duplication event spanning parts of exon 15 and intron 15 of the COL7A1 gene, starting at position 40,524,267 and ending at 40,524,380 on chromosome 20 (CanFam3.1 assembly) (Garcia et al., 2020). | 2020 | 33291836 | |||
| 641 | OMIA:001523-9615 | dog | Samoyed (Dog) | Oculoskeletal dysplasia 2 | COL9A2 | deletion, gross (>20) | Naturally occurring variant | yes | 15 | a 1,267 bp deletion that eliminates part of the 5’UTR, all of exon 1 and part of intron 1 | 2010 | 20686772 | |||||||
| 581 | OMIA:001522-9615 | dog | Labrador Retriever (Dog) | Oculoskeletal dysplasia 1 | COL9A3 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 24 | g.46653422_46653423insG | c.10_11insG | p.(A4Gfs*46) | NM_001197171.1; NP_001184100.1; published as "a 1-base insertion (guanine) in exon 1 that changes a string of four guanines (CFA24: 49,699,847–49,699,850; CanFam2) to a string of five guanines (c.7–10insG). ... (p.A4GX46)" Goldstein et al. (2010). Information in this table has been changed in accordance to HGVS 3'rule and updated to the current reference genome. | 2010 | 20686772 | |||
| 1092 | OMIA:001522-9615 | dog | Northern Inuit Dog (Dog) | Oculoskeletal dysplasia 1 | COL9A3 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 24 | g.46660067C>T | c.700C>T | p.(R234*) | 2019 | 31415586 | ||||
| 944 | OMIA:001621-9685 | domestic cat | Devon Rex (Cat) Sphynx (Cat) | Muscular dystrophy-dystroglycanopathy (limb-girdle) | COLQ | missense | Naturally occurring variant | yes | Felis_catus_9.0 | C2 | g.135068287C>T | c.1190G>A | p.(C397Y) | rs869320615 | 2015 | 26327126 26374066 | Genomic location obtained via Ensembl's VEP | ||
| 643 | OMIA:001988-9615 | dog | Bedlington Terrier (Dog) | Wilson disease, COMMD1 type | COMMD1 | deletion, gross (>20) | Naturally occurring variant | yes | 10 | deletion "breakpoints were positioned at 65.3091 and 65.3489 Mb of dog chromosome 10, in intron 1 and intron 2 of COMMD1 respectively, a deletion of 39.7 kb" | 2005 | 16293123 | |||||||
| 1506 | OMIA:001274-452646 | American mink | Coat colour, black crystal | COPA | missense | Naturally occurring variant | unknown | NNQGG.v01 | FNWR01000261.1 | g.4876673G>A | c.478C>T | p.(R160C) | 2022 | 35729186 | |||||
| 358 | OMIA:002111-9913 | taurine cattle | Holstein (red and white) (Cattle) | Cataract, recessive, CPAMD8-related | CPAMD8 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.6073556C>T | XM_015471929.2:c.220C>T | XP_015327415.2:p.(Q74*) | rs5334474964 | 2017 | 28683140 | |||
| 1418 | OMIA:002519-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH24 | CPT1C | BH24 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 18 | NC_037345.1:g.56098048G>A | XM_002695120.5:c.158G>A | XP_002695166.2:p.(G53D) | XM_002695120.5 | rs719328437 | 2021 | 34915862 | |
| 1428 | OMIA:002533-9685 | domestic cat | Domestic Shorthair | Osteogenesis imperfecta | CREB3L1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.100436508_100436509del | c.370_371del | p.(C124Lfs) | XM_003993204.4; XP_003993253.1; published as c.370_371delTG | 2022 | 35168412 | |||
| 916 | OMIA:000881-9685 | domestic cat | Abyssinian (Cat) | Rod-cone dysplasia | CRX | Rdy | deletion, small (<=20) | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | E2 | g.9492897del | c.546del | p.(P185Lfs*2) | XM_045045412.1; XP_044901347.1; published as CRX: n.546delC; in the Felis_catus_9.0 assembly the CRX gene is duplicated and genomic coordinates in this table are given for a more recent reference genome | 2010 | 20053974 | ||
| 1176 | OMIA:000168-10141 | domestic guinea pig | Cataract | Cryz | splicing | Naturally occurring variant | yes | "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) | 1992 | 1390943 | |||||||||
| 692 | OMIA:000852-9925 | goat | Casein, alpha-S1, reduced concentration | CSN1S1 | insertion, gross (>20) | Naturally occurring variant | no | 6 | "a 457-bp insertion within exon 19 (last untranslated exon). This insert is a truncated long interspersed repeated element (LINE) containing part of the ORF-2, the 3' UTR and the poly(A) tail of the original retroposon." | 1994 | 7926797 | ||||||||
| 907 | OMIA:001623-9925 | goat | Casein, alpha-S2, absence | CSN1S2 | nonsense (stop-gain) | Naturally occurring variant | no | ARS1.2 | 6 | NC_030813.1:g.86085134G>A | NM_001285585.1:c.374G>A | NP_001272514.1:p.W125* | published as as AJ131465 c.763G>A and p.(T110*), publication identifies that the codon changed is 'TGG' coding for tryptophan (W) - information in the table updated to recent transcript [04/10/2024] | rs268293093 | 2001 | 11419340 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | ||
| 1312 | OMIA:001424-9925 | goat | Absence of β‐casein | CSN2 | CSN2^0 | deletion, small (<=20) | Naturally occurring variant | no | ARS1.2 | 6 | NC_030813.1:g.86008404del | XM_013964699.2:c.295del | XP_013820153.1:p.I99Sfs*10 | Changed from g.86008401del to g.86008404del to adhere to the HGVS 3’rule [22/01/10]' previously listed as ENSCHIT00000032661.1:c.175del ENSCHIP00000024801.1:p.Ile59SerfsTer10; update to NCBI transcript information [04/10/24]; Persuy et al. (1999): "allele CSN2^O had a one-nucleotide deletion in the 5' end of exon 7, which introduces a premature stop codon. The open reading frame of allele CSN2^O encodes a shortened polypeptide of 72 amino acids, compared to 223 amino acids for caprine pre beta-casein A." | rs645737170 | 1999 | 10612234 | ||
| 1311 | OMIA:001424-9925 | goat | Absence of β‐casein | CSN2 | CSN2^01 | regulatory | Naturally occurring variant | no | ARS1.2 | 6 | NC_030813.1:g.86015651A>G | Cosenza et al. (2016): "nucleotide C .... negatively affects the promoter activity of the CSN2 gene" Synonyms: dbSNP ss1245869815 | rs654545998 | 2007 | 17931404 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||
| 1186 | OMIA:002262-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | CSNK1G2 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 7 | g.44265842G>C | p.(D164H) | Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475073 | 2017 | 28904385 | |||
| 66 | OMIA:001505-9615 | dog | American Bulldog (Dog) | Neuronal ceroid lipofuscinosis, 10 | CTSD | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.46013354C>T | c.597G>A | p.(M199I) | 2006 | 16386934 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 905 | OMIA:001505-9940 | sheep | Roslagsfår, Sweden (Sheep) | Neuronal ceroid lipofuscinosis, 10 | CTSD | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.51583020G>A | XM_027959254.1:c.883G>A | XP_027815055.1:p.(D295N) | published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively | 2000 | 10856224 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1517 | OMIA:002607-9685 | domestic cat | Domestic Longhair | Pyknodysostosis | CTSK | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | C1 | g.105945826G>A | c.724C>T | p.(R242*) | ENSFCAT00000003643; variant is reported in a single affected cat | 2022 | 36532681 | |||
| 529 | OMIA:001786-9615 | dog | Beagle (Dog) | Intestinal cobalamin malabsorption due to CUBN mutation | CUBN | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.19796293del | c.786del | p.(D262Efs*47) | NM_001003148.1; NP_001003148.1; deletion C | rs1152388404 | 2014 | 24164695 | ||
| 447 | OMIA:001786-9615 | dog | Border Collie (Dog) | Intestinal cobalamin malabsorption due to CUBN mutation | CUBN | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.19974334del | c.8392del | p.(Q2798Rfs*3) | NM_001003148.1; NP_001003148.1; deletion C | 2013 | 23613799 | |||
| 1036 | OMIA:001786-9615 | dog | Komondor (Dog) | Intestinal cobalamin malabsorption, CUBN-related | CUBN | splicing | Naturally occurring variant | yes | CanFam3.1 | 2 | g.19981457G>A | c.8746+1G>A | NM_001003148.1 | 2018 | 30591068 | ||||
| 287 | OMIA:001697-9913 | taurine cattle | Jersey (Cattle) | Abortion due to haplotype JH1 | CWC15 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 15 | NC_037342.1:g.15449431C>T | NM_001046399.2:c.163C>T | NP_001039864.1:p.(R55*) | UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 | rs1115118696 | 2013 | 23349982 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 850 | OMIA:002131-9615 | dog | Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.22832962G>A | c.227G>A | p.(G72S) | NM_001048084.1; NP_001041549.1; published as g.22832963G>A, c.214G>A - coordinates updated based on Table 1, Jaffey et al. (2020), reported in a single dog | 2017 | 28963729 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 967 | OMIA:002131-9615 | dog | Chihuahua (Dog) Mixed Breed (Dog) Pomeranian (Dog) Rat Terrier (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.22836951A>C | c.580A>C | p.(I194L) | NM_001048084.1; NP_001041549.1 | 2018 | 29356095 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1700 | OMIA:002131-9615 | dog | Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | NC_006592.3:22836975A>G | NM_001048084.1:c.604A>C | NP_001041549.1:p.(T202A) | reported in a single dog | 2020 | 33293645 | |||
| 1699 | OMIA:002131-9615 | dog | American Pit Bull Terrier (Dog) Mixed Breed (Dog) | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | NC_006592.3:22841895G>C | NM_001048084.1:c.656G>C | NP_001041549.1:p.(R219P) | 2020 | 33293645 | ||||
| 1548 | OMIA:002131-9685 | domestic cat | Domestic Shorthair | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | splicing | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | B4 | g.135605715C>T | c.226+5G>A | XM_045062469.1; two transcripts were observed in the cat with the splice variant resulting in two predicted protein variants: XP_044918404.1:p.(G76_Q77insERSPDPARVEPG) and XP_044918404.1:p.(V52Afs*58), | 2023 | 37048064 | ||||
| 1155 | OMIA:002131-9685 | domestic cat | Domestic Shorthair | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.137967506C>T | c.625G>A | p.(G209S) | Jaffey e al. (2019): "p.Gly209Ser amino acid change in transcript CYB5R3-202 (ENSFCAT00000056925) at position B4:137967506" | 2019 | 31650629 | |||
| 1156 | OMIA:002131-9685 | domestic cat | Domestic Shorthair | Methaemoglobinaemia, CYB5R3-related | CYB5R3 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.137970815C>G | c.232-1G>C | Jaffey et al. (2019): "a putative loss of function splice acceptor variant at c.232-1G>C in the CYB5R3-202 transcript (ENSFCAT00000056925) at position B4:137970815 that is in the acceptor site for exon 4, which likely affects downstream translation of the protein." | 2019 | 31650629 | ||||
| 629 | OMIA:000017-9986 | rabbit | Adrenal hyperplasia, congenital | CYP11A1 | deletion, gross (>20) | Naturally occurring variant | yes | "a large deletion mutation in the P450scc gene" | 1993 | 7682938 | |||||||||
| 117 | OMIA:001661-9685 | domestic cat | Adrenal hyperplasia, congenital, due to 11-beta hydroxylase deficiency | CYP11B1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | F2 | g.84247412G>A | c.1151G>A | p.(R384Q) | XM_004000154.3; XP_004000203.1 published as "a guanosine-to-adenosine mutation in exon 7 that results in an arginine to glutamine amino acid substitution; this latter mutation results in 11β-hydroxylase deficiency-associated CAH in people [Parajes et al. (2010) J Clin Endocrinol Metab 95:779–788]. | 2012 | 22827537 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 720 | OMIA:000452-9031 | chicken | Campine (Chicken) Sebright Bantams, United Kingdom of Great Britain and Northern Ireland (Chicken) | Henny feathering | CYP19A1 | insertion, gross (>20) | Naturally occurring variant | no | GRCg6a | 10 | g.9683879_9683880insN[7524] | The insertion is 7524bp and "contains an intact endogenous retrovirus that was not found in chickens representing 31 different breeds not showing henny feathering or in samples of the ancestral red junglefowl. The sequence shows over 99% sequence identity to the avian leukosis virus ev-1 and ev-21 strains, suggesting a recent integration. The ERV 3’LTR, containing a powerful transcriptional enhancer and core promoter with TATA box together with binding sites for EFIII and Ig/EBP inside the CYP19A1 5′ untranslated region" (Li et al., 2019) | 1991 | 1939054 | Genomic location and size of the insertion provided by Li et al. (2019) | ||||
| 1251 | OMIA:002288-9913 | taurine cattle | Hereford (Cattle) | Mandibulofacial dysostosis | CYP26C1 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 26 | g.14404993T>C | c.563T>G | p.(L188P) | ENSBTAT00000056396.3:c.563T>G; ENSBTAP00000050244.2:p.Leu188Arg | rs431913023 | 2020 | 33105751 | ||
| 656 | OMIA:000837-9823 | pig | Vitamin D-deficiency rickets, type I | CYP27B1 | deletion, gross (>20) | Naturally occurring variant | yes | 5 | the first of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) | 2003 | 12915218 | ||||||||
| 657 | OMIA:000837-9823 | pig | Vitamin D-deficiency rickets, type I | CYP27B1 | deletion, gross (>20) | Naturally occurring variant | yes | 5 | the second of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) | 2003 | 12915218 | ||||||||
| 502 | OMIA:000837-9685 | domestic cat | Vitamin D-deficiency rickets, type I | CYP27B1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.86180281del | c.731del | p.(R244Pfs*32) | XM_003988966.3; XP_003989015.1; published as c.731delG | 2009 | 19138382 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 315 | OMIA:000837-9685 | domestic cat | Siamese (Cat) | Vitamin D-deficiency rickets, type I | CYP27B1 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.86180375C>A | c.637G>T | p.(E213*) | XM_003988966.3; XP_003989015.1; | rs5334475145 | 2012 | 22553308 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1576 | OMIA:000837-9615 | dog | Pug (Dog) | Vitamin D-deficiency rickets, type IA | CYP27B1 | nonsense (stop-gain) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 10 | g.2182971G>T | c.261C>A | p.(Y87*) | XM_038549826.1; XP_038405754.1 | 2023 | 37293695 | |||
| 1411 | OMIA:002508-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH8 | CYP2B6 | SH8 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 18 | NC_037345.1:g.50296371A>T | NM_001075173.1:c.938T>A | NP_001068641.1:p.(I313N) | NM_001075173.1 | rs5352006042 | 2021 | 34944310 | |
| 1137 | OMIA:002221-9685 | domestic cat | Domestic Shorthair | Vitamin D-deficiency rickets, type Ib | CYP2R1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.72977336del | c.1386del | p.(F462Lfs*20) | XM_003993015.5; XP_003993064.1; genomic position in accordance with HGVS 3'-rule | 2019 | 30777056 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. | ||
| 52 | OMIA:002684-9615 | dog | Australian Cattle Dog (Dog) Shetland Sheepdog (Dog) | Leucodystrophy | CYTB | missense | Naturally occurring variant | yes | CanFam3.1 | M | m.14474G>A | c.14474G>A | p.(V98M) | 2006 | 16026996 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1743 | OMIA:002894-10036 | golden hamster | Dcaf17 deficiency | Dcaf17 | deletion, small (<=20) | Genome-editing (CRISPR-Cas9) | yes | BCM_Maur_2.0 | NW_024429189.1:g.39589667_39589671del | XM_040745545.1:c.71_75del | XP_040601479.1:p.(D24Gfs*24) | 2024 | 39239833 | ||||||
| 784 | OMIA:001986-9823 | pig | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation | DCLRE1C | splicing | Naturally occurring variant | yes | Sscrofa11.1 | 10 | g.46845535G>A | rs5334475180 | 2015 | 26320255 | ||||||
| 785 | OMIA:001986-9823 | pig | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation | DCLRE1C | nonsense (stop-gain) | Naturally occurring variant | yes | Sscrofa11.1 | 10 | g.46851262G>A | p.(Trp267*) | rs5334475181 | 2015 | 26320255 | |||||
| 167 | OMIA:000735-9796 | horse | Belgian Draft (Horse) Connemara Pony (Horse) Haflinger (Horse) Rocky Mountain, United States of America (Bighorn sheep) Welsh Pony (Horse) | Ocular squamous cell carcinoma | DDB2 | missense | Naturally occurring variant | yes | EquCab3.0 | 12 | NC_009155.3:g.11726667C>T | XM_023654000.1:c.1013C>T | XP_023509768.1:p.(T338M) | The EquCab2 coordinates, obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, are g.11608667, c.1013C>T and p.T338M | rs1139682898 | 2017 | 28425625 | The EquCab3 g. coordinates were provided by by Meredith O’Connell, working under the guidance of Professor Ernie Bailey, 5 March 2019. Breed information updated based on PMID: 38600096 | |
| 1624 | OMIA:002582-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Hepatic fibrinogen storage disease | DGKG | missense | Genome-editing (CRISPR-Cas9) | yes | ARS-UCD1.3 | 1 | NC_037328.1:g.81082187C>T | XM_002684869.5:c.2162C>T | XP_002684915.3:p.T721I | XM_002684869.5; XP_002684915.3 | 2023 | 37681469 | |||
| 565 | OMIA:002095-9615 | dog | Rhodesian Ridgeback (Dog) | Epilepsy, generalized myoclonic, with photosensitivity | DIRAS1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.56474668_56474671del | c.564_567del | p.(D189Afs*11) | XM_005633100.3; XP_005633157.1; published as DIRAS1:c.564_567delAGAC | 2017 | 28223533 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1412 | OMIA:002505-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH5 | DIS3 | SH5 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 12 | g.47511687_47511687insT | c.2032dup | p.(I678N*2) | NP_025000110.1, XM_025000110.1 | 2021 | 34944310 | ||
| 615 | OMIA:002109-9913 | taurine cattle | Brown Swiss (Cattle) | Tricho-dento-osseous-like syndrome | DLX3 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.36665831_36665832insGGAGCACA | c.584_585insGGAGCACAGG | p.(S198Rfs*99) | NM_001081622 position is g.37298375_37298376insGGAGCACA | rs5334475096 | 2017 | 28670783 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 728 | OMIA:001919-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cleft palate 1 | DLX6 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 14 | g.22068082_22068083insN[2056] | "2056 bp insertion [including LINE1] . . within a highly conserved region of DLX6 intron 2 at cfa14.25016716"[CanFam2.0] | 2014 | 24699068 | |||||
| 1395 | OMIA:001081-9823 | pig | Duchenne muscular dystrophy | DMD | DMD^ex52del | delins, gross (>20) | Transgenesis via somatic cell nuclear transfer (SCNT) | yes | X | gene targeting and somatic cell nuclear transfer was used to replace DMD exon 52 with a neomycin resistance cassette | 2013 | 23784375 | |||||||
| 680 | OMIA:001081-9615 | dog | German Shorthaired Pointer (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | yes | X | a "deletion encompassing the entire dystrophin [DMD] gene" | 1999 | 10407848 | |||||||
| 536 | OMIA:001081-9615 | dog | Cocker Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | Naturally occurring variant | yes | X | deletion of four nucleotides in exon 65, with a reading frame shift predicting a premature stop codon at the site of the deletion | 2012 | 22218699 | |||||||
| 681 | OMIA:001081-9615 | dog | Tibetan Terrier (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | yes | X | "a large deletion of exons 8-29" | 2012 | 22218699 | |||||||
| 729 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | insertion, gross (>20) | Naturally occurring variant | yes | X | "184 nucleotide [pseudoexon] insertion between exon 19 and exon 20, which results in a premature stop codon at the next codon downstream of the insertion" | 2012 | 22218699 Reference not in PubMed; see OMIA 001081-9615 for reference details | |||||||
| 957 | OMIA:001081-9615 | dog | Rottweiler (Dog) | Muscular dystrophy, Duchenne type | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | X | "nonsense mutation in exon 58" | 1994 | Reference not in PubMed; see OMIA 001081-9615 for reference details | |||||||
| 989 | OMIA:001081-9615 | dog | Poodle, Miniature (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | yes | X | "a >5 Mb deletion on the X chromosome, encompassing the entire DMD gene" | 2018 | 29474464 | |||||||
| 922 | OMIA:001081-9685 | domestic cat | Domestic Shorthair | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | yes | X | A deletion of the muscle promoter and first exon and the Purkinje neuronal first exon of the DMD gene | 1994 | 7881288 | |||||||
| 923 | OMIA:001081-9685 | domestic cat | Domestic Shorthair | Muscular dystrophy, Duchenne type | DMD | deletion, gross (>20) | Naturally occurring variant | yes | X | A large deletion that "involved regions of the dystrophin gene that are poorly characterized, including the cortical neuronal promoter and its first exon and the skeletal neuronal promoter and its first exon" | 2014 | 24446404 | |||||||
| 367 | OMIA:001081-9615 | dog | Cavalier King Charles Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | splicing | Naturally occurring variant | yes | CanFam3.1 | X | g.26956239G>A | c.7294+5G>T | NM_001003343.1; NP_001003343.1; experimentally confirmed splice defect; a single nucleotide variant in the 5'-splice site of intron 51 that results in skipping of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein | 2010 | 20072625 | ||||
| 562 | OMIA:001081-9615 | dog | Cavalier King Charles Spaniel (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.27442996_27443002del | c.6057_6063del | p.(N2021Pfs) | NM_001003343.1; NP_001003343.1; published as c.6051_6057delTCTCAAT based on different transcript | 2016 | 28028563 | |||
| 542 | OMIA:001081-9615 | dog | Norfolk Terrier (Dog) | Muscular dystrophy, Duchenne type | DMD | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.27606021del | c.3084delG | p.(G1029Nfs*30) | 2015 | 26401335 | ||||
| 1249 | OMIA:001081-9615 | dog | Jack Russell Terrier (Dog) | Duchenne-type muscular dystrophy | DMD | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | X | g.27615280_27982912del | c.94-10346_2807-6207del | XM_005641029.1 | 2020 | 33049940 | ||||
| 1236 | OMIA:001081-9615 | dog | Australian Labradoodle (Dog) | Australian Labradoodle dystrophinopathy | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | X | g.27621845G>A | c.2668C>T | p.(R890*) | NM_001003343.1; NP_001003343.1; "a C to T transition at base pair 43 in exon 21 of the dystrophin gene" (Shrader et al., 2018) | 2018 | 30286978 | |||
| 1234 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Labrador Retriever muscular dystrophy (LRMD) | DMD | inversion | Naturally occurring variant | yes | CanFam3.1 | X | g.27622834_29823788inv | c.-1490357_2626-947inv | XM_005641029.1 | 2020 | 32767978 | ||||
| 1235 | OMIA:001081-9615 | dog | Border Collie (Dog) | Muscular dystrophy, Duchenne | DMD | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.27626466del | c.2841delT | 2018 | 29843823 | |||||
| 750 | OMIA:001081-9615 | dog | Japanese Spitz (Dog) | Muscular dystrophy, Duchenne type | DMD | inversion | Naturally occurring variant | yes | CanFam3.1 | X | g.27631972_33069482inv | c.-4736051_2384-5339inv | XM_005641029.1; "an inversion of a 5.4-Mb fragment of the X chromosome, with one break point (BP1) in the DMD gene . . . and a second break point (BP2) in a gene farther toward the centromere, the RPGR gene". | 2015 | 25644216 | ||||
| 708 | OMIA:001081-9615 | dog | Pembroke Welsh Corgi (Dog) | Muscular dystrophy, Duchenne type | DMD | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | X | g.27721607_27721608insN[(4800)] | "a long interspersed repetitive element-1 (LINE-1) insertion in intron 13, which introduced a new exon containing an in-frame stop codon" | 2011 | 20714321 | |||||
| 1492 | OMIA:001081-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | duplication | Naturally occurring variant | yes | CanFam3.1 | X | g.27851768_28247504dup | Shelton et al. (2022): "chrX:27,851,768-27,852,122 bp position (Intron 7 . . .) and chrX:28,247,150-28,247,504 bp position (Intron 1 . . .)" | 2022 | 36041985 | |||||
| 366 | OMIA:001081-9615 | dog | Golden Retriever (Dog) | Muscular dystrophy, Duchenne type | DMD | splicing | Naturally occurring variant | yes | CanFam3.1 | X | g.27926946T>C | c.531-2A>G | NM_001003343.1; a point mutation in the consensus splice acceptor site in exon 6 , such that exon 7 is skipped | rs1152388423 | 1992 | 1577476 | |||
| 1656 | OMIA:001081-9685 | domestic cat | Domestic Shorthair | Muscular dystrophy, Duchenne type | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | X | g.27949145C>T | c.4849C>T | p.(Q1617*) | XM_023249210.1 | 2024 | 38180235 | |||
| 1510 | OMIA:001081-9685 | domestic cat | Maine Coon (Cat) | Muscular dystrophy, Duchenne type | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | X | g.28208148G>A | c.1180C>T | p.(R394*) | XM_045050794.1; XP_044906729.1 | 2022 | 36359052 | |||
| 1531 | OMIA:001888-9685 | domestic cat | Maine Coon (Cat) | Becker muscular dystrophy | DMD | missense | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.27988938G>A | XM_045050787.1:c.4186C>T | XP_044906722.1:p.(H1396Y) | 2023 | 36834603 | ||||
| 1684 | OMIA:001888-9685 | domestic cat | Kinkalow (Cat) | Muscular dystrophy, X-linked | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | X | NC_018741.3:g.27350268G>A | XM_023249210.1:c.8467C>T | XP_023104978.1:p.(Q2823*) | likely de novo mutation reported in a single cat | 2024 | 38613437 | |||
| 1667 | OMIA:001888-9685 | domestic cat | Domestic Shorthair | Muscular dystrophy, X-linked | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | X | NC_018741.3:g.27361452C>T | XM_023249210.1:c.8333G>A | XP_023104978.1:p.(W2778*) | F.catus_Fca126_mat1.0 coordinates are g.27110574G>A | 2024 | 38415938 | |||
| 1714 | OMIA:001081-9615 | dog | Border Collie (Dog) | Muscular dystrophy, X-linked | DMD | insertion, gross (>20) | Naturally occurring variant | unknown | ROS_Cfam_1.0 | X | NC_051843.1:g.26431863_26431864insN[162] | NM_001003343.1:c.9271_9272insN[162] | NP_001003343.1:p.(Ala3091fs*21) | likely de-novo variant present in a single affected dog | 2024 | 39152696 | |||
| 1457 | OMIA:001888-9823 | pig | Becker muscular dystrophy | DMD | insertion, gross (>20) | Naturally occurring variant | yes | Sscrofa11.1 | X | Aihara et al. (2022): "Analysis of dystrophin mRNA showed a 62 base pair insertion between exons 26 and 27. The insertion was derived from intron 26." | 2022 | 35220848 | |||||||
| 179 | OMIA:001685-9823 OMIA:001888-9823 | pig | Stress syndrome | DMD | missense | Naturally occurring variant | yes | Sscrofa11.1 | X | g.28309227G>A | c.5872C>T | p.(R1958W) | Ensembl VEP was used to identify cDNA position in transcript ENSSSCT00000089893.1, SIFT score 0.01 | rs196952080 | 2012 | 22691118 | |||
| 1615 | OMIA:001081-9615 | dog | Brittany Spaniel (Dog) | Muscular dystrophy, Duchenne | DMD | insertion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | RSPYR1 retrogene insertion in intron 20; reported in a single dog; reported in a single dog | 2023 | 37628610 | ||||||
| 1614 | OMIA:001081-9615 | dog | Brittany Spaniel (Dog) | Muscular dystrophy, Duchenne | DMD | nonsense (stop-gain) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | g.26939052G>A | c.8059C>T | p.(Q2687*) | NM_001003343.1; NP_001003343.1; reported in 2 related dogs | 2023 | 37628610 | |||
| 1616 | OMIA:001081-9615 | dog | French Bulldog (Dog) | Muscular dystrophy, Duchenne | DMD | insertion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | g.27774668_27774669insT | c.3371_3372insA | p.(F1125fs) | NM_001003343.1; NP_001003343.1; published as p.(F1125*), reported in a single dog | 2023 | 37628610 | |||
| 1744 | OMIA:001081-9615 | dog | Entlebucher Mountain Dog (Dog) | Muscular dystrophy, Duchenne type | DMD | duplication | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | NC_049260.1:g.27027497_27,036112dup8616 | NM_001003343.1:c.7528-4048_7645+4450dup | NP_001003343.1:p.(I2549Sfs*3) | 2024 | 39307576 | ||||
| 908 | OMIA:001542-9940 | sheep | Corriedale (Sheep) | Hypophosphatemic rickets, autosomal recessive, 1 | DMP1 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 6 | NC_040257.1:g.112910614C>T | XM_012180327.3:c.433C>T | XP_012035717.1:p.(R145*) | Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. | 2011 | 21747952 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1352 | OMIA:002442-9823 | pig | Large White (Pig) | Sperm flagella defect | DNAH17 | deletion, small (<=20) | Naturally occurring variant | yes | Sscrofa11.1 | 12 | g.3556402_3556414del | Nosková et al. (2021): "intronic 13-bp deletion ... causes exon skipping which results in the in-frame loss of 89 amino acids from DNAH17" | rs5334475172 | 2021 | 33724408 | ||||
| 1687 | OMIA:002847-9615 | dog | Portuguese Water Dog (Dog) | Microphthalmos with hematopoietic defects, congenital | DNAJC21 | insertion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 4 | NC_049225.1:g.74274883ins[T70]TGCTGCTTGGATT | 2024 | 38682429 | ||||||
| 39 | OMIA:001466-9615 | dog | Boykin Spaniel (Dog) Chesapeake Bay Retriever (Dog) Curly Coated Retriever (Dog) Labrador Retriever (Dog) Pembroke Welsh Corgi (Dog) | Exercise-induced collapse | DNM1 | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.55282762C>A | c.767G>T | p.(R256L) | ROS_Cfam_1.0:g.56204742C>A ENSCAFT00845051951.1:c.767G>T ENSCAFP00845040760.1:p.Arg256Leu | rs852832685 | 2008 | 18806795 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1434 | OMIA:002534-9615 | dog | Border Collie (Dog) | Centronuclear myopathy 1 | DNM2 | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.50423497G>A | c.1393C>T | p.(R465W) | XM_005632882.3; XP_005632939.1. | 2022 | 35244154 | |||
| 125 | OMIA:001776-9685 | domestic cat | Dihydropyrimidinase deficiency | DPYS | missense | Naturally occurring variant | yes | Felis_catus_9.0 | F2 | g.52064442C>T | c.1303G>A | p.(G435R) | XM_023248231.1; XP_023103999.1 | 2012 | 23430934 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 1194 | OMIA:002266-9615 | dog | Rottweiler (Dog) | Hyperkeratosis, palmoplantar, DSG1-related | DSG1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.58163636_58163640del | c.2541_2545del | p.(G848Wfs*2) | NM_001002939.1; NP_001002939.1; published as c.2541_2545delGGGCT | 2020 | 32344723 | |||
| 1392 | OMIA:002452-9685 | domestic cat | Domestic Shorthair | Hair shaft dysplasia | DSG4 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D3 | g.55315010del | c.76del | p.(I26Lfs*4) | XM_019815116.1; XP_019670675.1 | 2022 | 34878611 | |||
| 1393 | OMIA:002452-9685 | domestic cat | Domestic Shorthair | Hair shaft dysplasia | DSG4 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D3 | g.55336127del | c.1777del | p.(H593Tfs*23) | XM_019815116.1; XP_019670675.1 | 2022 | 34878611 | |||
| 1408 | OMIA:002243-9913 | taurine cattle | Highland (Cattle) | Ichthyosis, DSP-related | DSP | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 23 | NC_037350.1:g.47826600G>T | NM_001192368.2:c.6893C>A | NP_001179297.1:p.(A2298D) | NM_001192368.2; NP_001179297.1 | rs5385033307 | 2022 | 34996433 | ||
| 1710 | OMIA:002243-9615 | dog | Poodle, Miniature (Dog) | Ichthyosis, syndromic | DSP | deletion, small (<=20) | Naturally occurring variant | unknown | UU_Cfam_GSD_1.0 | 35 | NC_049256.1:g.8804542_8804544del | XM_038584124.1:c.1821_1823del | XP_038440052.1:p.(N608del) | de novo variant in one dog | 2024 | 39136317 | |||
| 1115 | OMIA:002210-9823 | pig | Bama Xiang Zhu, China (Pig) | Congenital hypothyroidosis | DUOX2 | missense | Naturally occurring variant | yes | Sscrofa11.1 | 1 | g.126625620A>G | c.1226A>G | p.(D409G) | ENU mutagenesis was used to create these pigs, the mutation is located within an exonic splicing enhancer motif and causes aberrant splicing of DUOX2 transcripts (Cao et al., 2019) | rs5334475175 | 2019 | 30651277 | ||
| 1056 | OMIA:002186-9615 | dog | Boston Terrier (Dog) Bulldog (Dog) French Bulldog (Dog) | Screw tail | DVL2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.32195051del | c.2051del | p.(P684Lfs*26) | XM_005619960.3; XP_005620017.1; published as g.32195043_32195044del; c.2044delC and changed to HGVS nomenclature in this table | 2018 | 30521570 | |||
| 711 | OMIA:000543-9913 | taurine cattle | Danish Holstein (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED6 | insertion, gross (>20) | Naturally occurring variant | yes | X | "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" | 2011 | 22034998 | Allele id was copied from Table 1 of Capuzzello et al. (2022) | |||||
| 645 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED1 | deletion, gross (>20) | Naturally occurring variant | yes | X | c.397_502del | p.(M133Vfs*111) | a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised | 2001 | 11591646 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) | |||
| 1120 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Generalized hypohidrotic ectodermal dysplasia | EDA | HED8 | inversion | Naturally occurring variant | yes | ARS-UCD1.2 | X | g.77174882_80737442inv | Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" | 2019 | 31533624 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | |||
| 1293 | OMIA:000543-9913 | taurine cattle | Red Angus-Simmental cross | Hypohidrotic ectodermal dysplasia | EDA | HED9 | deletion, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | X | g.80382423_80435202del | GCF_002263795.1 (O'Toole et al., 2021) | 2021 | 33801223 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | |||
| 1484 | OMIA:000543-9913 | taurine cattle | British Blue x Holstein-Friesian cross | Anhidrotic ectodermal dysplasia, EDA-related | EDA | HED10 | deletion, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | X | g.80516615_80538514del | c.397_502del | p.(M133Vfs*111) | NM_001081743.2; NP_001075212.1 | 2022 | 36068608 | Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 586 | OMIA:000543-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED7 | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | X | g.80802800_80802801insCCCT | c.280_281insAGGG | p.(G94Qfs*49) | rs5334475024 | 2012 | 22497423 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 1665 | OMIA:000543-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | missense | Naturally occurring variant | yes | ARS-UCD1.3 | X | g.80417567C>T | c.679G>A | p.(G227R) | NM_001081743.2; NP_001075212.1; published as g.85716041G>A in ARS-UCD2.0 | rs1114816375 | 2023 | 38275590 | ||
| 373 | OMIA:000543-9913 | taurine cattle | Deutsche Holstein Schwarzbunt, Germany (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED2 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.80411671A>C | NM_001081743.2:c.924+2T>G | c.DNA position is based on NM_001081743.2 | rs5334474632 | 2002 | 12021844 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Allele id was copied from Table 1 of Capuzzello et al. (2022) | |
| 1661 | OMIA:000543-9913 | taurine cattle | Limousin (Cattle) | Hypohidrotic ectodermal dysplasia, X-linked | EDA | HED11 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.80411716T>C | NM_001081743.2:c.881A>G | NP_001075212.1:p.(E294G) | NM_001081743.2; NP_001075212.1 | rs439722471 | 2024 | 38252617 | |
| 1295 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED5 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.80411795C>A | NM_001081743.2:c.802C>A | "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) | rs5334475058 | 2011 | 21740563 | Allele id and c. information were copied from Table 1 of Capuzzello et al. (2022) | |
| 1294 | OMIA:000543-9913 | taurine cattle | Red Angus-Charolais-Simmental cross | Anhidrotic ectodermal dysplasia | EDA | HED3 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.80415626G>A | NM_001081743.2:c.730C>T | NP_001075212.1:p.(R244*) | rs5334474792 | 2007 | 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details | The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021). Allele id was copied from Table 1 of Capuzzello et al. (2022). | |
| 482 | OMIA:000543-9913 | taurine cattle | Holstein Friesian (Cattle) | Anhidrotic ectodermal dysplasia | EDA | HED4 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.80803015_80803033del | NM_001081743.2:c.48_66del | NP_001075212.1:p.(A16S22fs*55) | "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." | rs5334474984 | 2011 | 21410470 | Allele id and p. information were copied from Table 1 of Capuzzello et al. (2022) |
| 1458 | OMIA:000543-9615 | dog | Mixed Breed (Dog) | X-linked hypohidrotic ectodermal dysplasia | EDA | splicing | Naturally occurring variant | yes | CanFam3.1 | X | r.385_487del | p.M129fs*112 | NM_001014770.2; NP_001014770.1; EDA transcript lacks 103 nucleotides encoded by exon 2, exon skipping is likely to be caused by an intronic splice variant | 2016 | 27449516 | ||||
| 1017 | OMIA:000543-9615 | dog | Dachshund (Dog) | X-linked hypohidrotic ectodermal dysplasia | EDA | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.54509504del | c.842delT | p.(L281Hfs*22) | 2018 | 30276836 | ||||
| 361 | OMIA:000543-9615 | dog | German Shepherd Dog (Dog) | Anhidrotic ectodermal dysplasia | EDA | splicing | Naturally occurring variant | yes | CanFam3.1 | X | g.54511433G>A | c.910-1G>A | NM_001014770.2 | rs1152388425 | 2005 | 16151697 | Genomic coordinates in CanFam3.1 und EVA Id provided by Zoe Shmidt and Robert Kuhn. | ||
| 1705 | OMIA:000543-9685 | domestic cat | Domestic Shorthair | Hypohidrotic ectodermal dysplasia | EDA | missense | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | X | NC_058386.1:g.57148944G>A | XM_011291781.3:c.1042G>A | XP_011290083.1:p.(A348T) | reported in a single cat | 2024 | 39062633 | |||
| 724 | OMIA:001695-8090 | Japanese medaka | Reduced scale-3 | edar | insertion, gross (>20) | Naturally occurring variant | yes | "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" | 2001 | 11516953 | |||||||||
| 843 | OMIA:002128-9913 | taurine cattle | Charolais (Cattle) | Anhidrotic ectodermal dysplasia, EDAR-related | EDAR | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 11 | g.44599876_44599877insC | p.(P161Rfs*97) | UMD3.1 position is g.44462236_44462237insC | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |||
| 1474 | OMIA:002560-9913 | taurine cattle | Lidia, Spain (Cattle) | Growth and respiratory lethal syndrome | EDN2 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 3 | g.104701617G>A | c.149G>A | p.(C50Y) | ENSBTAG00000021434; ENSBTAT00000028571.3 | 2022 | 35912509 | |||
| 160 | OMIA:000629-9796 | horse | American Paint (Horse) Miniature Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) | Megacolon | EDNRB | frame overo | delins, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 17 | NC_009160.3:g.50503041_50503042delinsCT | NM_001081837.2:c.353_354delinsAG | NP_001075306.2:p.(I118K) | NM_001081837.2; NP_001075306.2 | 1998 | 9530628 | ||
| 930 | OMIA:001765-9940 | sheep | West African Dwarf (Sheep) | Waardenburg syndrome, type 4A | EDNRB | deletion, gross (>20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 10 | "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" | 2012 | 23300849 | ||||||
| 1481 | OMIA:002564-9615 | dog | English Springer Spaniel (Dog) | Dyserythropoietic anemia and myopathy syndrome (DAMS) | EHBP1L1 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 18 | g.52123541delG | c.3120delC | p.(F1041Sfs*30) | XM_038563927.1; XP_038419855.1 | 2022 | 36140701 | |||
| 1483 | OMIA:002564-9615 | dog | Labrador Retriever (Dog) | Congenital dyserythropoietic anemia and polymyopathy | EHBP1L1 | nonsense (stop-gain) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 18 | g.52128140G>A | c.388C>T | p.(R130*) | XM_038563927.1; | 2022 | 36011338 | |||
| 1044 | OMIA:001805-9615 | dog | Parson Russell Terrier (Dog) | Amelogenesis imperfecta | ENAM | missense | Naturally occurring variant | yes | CanFam3.1 | 13 | g.59945218C>T | c.716C>T | p.(P239L) | XM_539305.4; XP_539305.3 | 2019 | 30877375 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt. | ||
| 452 | OMIA:001805-9615 | dog | Italian Greyhound (Dog) | Amelogenesis imperfecta | ENAM | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.59946493_59946497del | c.1991_1995delTTTCC | p.(F665Rfs*3) | XM_539305.4; XP_539305.3; published as c.1991_1995delTTTCC | 2013 | 23638899 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1454 | OMIA:002550-9615 | dog | Rhodesian Ridgeback (Dog) | Early onset adult deafness | EPS8L2 | deletion, small (<=20) | Naturally occurring variant | yes | UMICH_Zoey_3.1/canFam5 | 18 | g.25868739_25868750del | c.1033_1044del | p.(V345_L348del) | XM_038500406.1; XP_038356334.1; published as 12-bp inframe deletion in EPS8L2 (CFA18:25,868,739-25,868,751 in the UMICH_Zoey_3.1) corresponding to deletion of amino acids VHFL | 2022 | 35385474 | |||
| 1161 | OMIA:000483-9925 | goat | Polled intersex syndrome | ERG | PIS | complex rearrangement | Naturally occurring variant | yes | 1 | "a deletion with a total length of 10 159 bp and an inversely inserted approximately 480 kb-sized duplicated segment of a region located approximately 21 Mb further downstream on chromosome 1 containing two genes, KCNJ15 and ERG" (Simon et al., 2020) | 2020 | 32060960 | |||||||
| 1169 | OMIA:002543-9031 | chicken | Cleft primary palate | ESRP2 | deletion, small (<=20) | Naturally occurring variant | yes | GRCg6a | 11 | g.3284041del | rs3386590816 | 2020 | 32162363 | ||||||
| 1439 | OMIA:001457-9685 | domestic cat | Multiple acyl-CoA dehydrogenase deficiency | ETFDH | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.71374631A>C | c.692T>G | p.(F231C) | NM_001290236.1; NP_001277165.1 | 2014 | 24142280 | Thanks to Heidi Anderson for alerting OMIA to this paper; 31 March 2022 | |||
| 617 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 6 | g.103609778_103609779delinsG | c.2327_2328delinsG | p.(A776Gfs*22) | Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 | rs5334475076 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 375 | OMIA:002540-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Chondrodysplasia | EVC2 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.103594013C>T | NM_173927.1:c.1356C>T | Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. | rs5334475072 | 2002 | 12136126 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 534 | OMIA:002540-9913 | taurine cattle | Tiroler Grauvieh (Cattle) | Chondrodysplasia | EVC2 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.103651709_103651710del | NM_173927.1:c.2993_2994del | NP_776352.1:p.(D998Efs*13) | rs5334475061 | 2014 | 24733244 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry. | ||
| 346 | OMIA:002042-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), EXOSC4 | EXOSC4 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 14 | NC_037341.1:g.755826G>A | NM_001078086.2:c.190G>A | NP_001071554.1:p.(R64*) | rs3423357300 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1467 | OMIA:002554-9685 | domestic cat | Osteochondromatosis (feline leukemia virus-negative) | EXT1 | duplication | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | F2 | g.61870704dup | c.1468dup | p.(L490Pfs*31) | XM_023248762.2; | 2022 | 35719100 | ||||
| 980 | OMIA:001214-9615 | dog | American Staffordshire Terrier (Dog) | Osteochondromatosis | EXT2 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.45101754G>T | c.924C>A | p.(Y308*) | XM_014121199.2; XP_013976674.1; published as c.969C>A and p.(Y323*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2018 | 29485212 | |||
| 713 | OMIA:000363-9913 | taurine cattle | Holstein (black and white) (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | insertion, gross (>20) | Naturally occurring variant | yes | 27 | a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised | 2004 | 15566468 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||||||
| 591 | OMIA:000363-9913 | taurine cattle | Japanese Black, Japan (Cattle) Sahiwal (Cattle) | Factor XI deficiency | F11 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 27 | g.16305660delinsATATGTGCAGAATATA | c.870delinsATATGTGCAGAATATA | P.(F290delinsLYVQNI) | rs5334474726 | 2005 | 16104386 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 702 | OMIA:000363-9615 | dog | Kerry Blue Terrier (Dog) | Factor XI deficiency | F11 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 16 | g.44477343_44477344ins90 | c.819_820ins90 | NM_001135123.1 "an insertion of 90 bp (SINE) inside of coding exon 7" resulting in a "30 amino acids insertion in the A3 domain of FXI serine protease" (Tcherneva et al., 2007). | 2007 | Reference not in PubMed; see OMIA 000363-9615 for reference details | g. and c. coordinates kindly provided by Professor Urs Giger (27 August 2022) | |||
| 1472 | OMIA:000363-9685 | domestic cat | Maine Coon (Cat) | Factor XI deficiency | F11 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.17176154G>A | c.1546G>A | p.(V516M) | XM_003984601.5; XP_003984650.2 | 2022 | 35627175 | |||
| 533 | OMIA:000364-9685 | domestic cat | American Shorthair (Cat) Balinese (Cat) Bengal (Cat) Cymric (Cat) Highlander (Cat) Himalayan (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Manx (Cat) Minuet (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Ragdoll (Cat) Savannah (Cat) Siamese (Cat) Tennessee Rex (Cat) | Factor XII deficiency | F12 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.175381114del | c.1321del | p.(L441Cfs*119) | NM_001168212.2; NP_001161684.2; published as c.1321delC | 2015 | 24793828 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | ||
| 147 | OMIA:000364-9685 | domestic cat | Balinese (Cat) Bengal (Cat) Bengal Longhair (Cat) Bombay (Cat) British Shorthair (Cat) Devon Rex (Cat) Domestic Shorthair Donskoy (Cat) Elf (Cat) Exotic Shorthair (Cat) Highlander (Cat) Himalayan (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet (Cat) Minuet Longhair (Cat) Munchkin (Cat) Munchkin Longhair (Cat) Neva Masquerade (Cat) Oriental Longhair (Cat) Oriental Shorthair (Cat) Persian (Cat) Peterbald (Cat) Ragdoll (Cat) Savannah (Cat) Scottish Fold (Cat) Scottish Fold Longhair (Cat) Scottish Straight (Cat) Scottish Straight Longhair (Cat) Selkirk Rex (Cat) Selkirk Rex Longhair (Cat) Siamese (Cat) Siberian (Cat) Sphynx (Cat) Tennessee Rex (Cat) Turkish Angora (Cat) | Factor XII deficiency | F12 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.175382065G>C | c.1631G>C | p.(G544A) | NM_001168212.2; NP_001161684.2 | rs5334475144 | 2017 | 28392508 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | |
| 1532 | OMIA:001818-9913 | taurine cattle | Japanese Black, Japan (Cattle) Japanese Brown, Japan (Cattle) | Factor XIII deficiency | F13A1 | missense | Naturally occurring variant | yes | UMD_3.1.1 | 23 | g.48649432T>C | c.248T>C | p.(F83S) | NM_001167894.1; NP_001161366.1; reported in Japanese Brown in PMID: | 1996 | Reference not in PubMed; see OMIA 001818-9913 for reference details | Variant was first reported by Ogawa and Iga (1996). Variant information in this table is based on supplementary table 1 by Shibutani et al. (2023). | ||
| 148 | OMIA:000361-9783 | Asiatic elephant | Factor VII deficiency | F7 | missense | Naturally occurring variant | yes | c.202A>G | p.(R68G) | 2017 | 28118558 | ||||||||
| 40 | OMIA:000361-9615 | dog | Airedale Terrier (Dog) Alaskan Husky (Dog) Alaskan Klee Kai (Dog) American Foxhound (Dog) Basset Hound (Dog) Beagle (Dog) Catahoula Leopard Dog (Dog) Dachshund, Miniature Smooth-Haired (Dog) English Foxhound (Dog) Finnish Hound (Dog) German Shorthaired Pointer (Dog) German Wirehaired Pointer (Dog) Giant Schnauzer (Dog) Harrier (Dog) Irish Water Spaniel (Dog) Japanese Spitz (Dog) Miniature Schnauzer (Dog) Papillon (Dog) Phalène (Dog) Redbone Coonhound (Dog) Scottish Deerhound (Dog) Sealyham Terrier (Dog) Welsh Springer Spaniel (Dog) Whippet (Dog) | Factor VII deficiency | F7 | missense | Naturally occurring variant | yes | CanFam3.1 | 22 | g.60578895G>A | c.407G>A | p.(G136E) | 2006 | 16961583 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; variant initially identified in Beagle and later reported in additional breeds: PMID:17939552; PMID: 27525650; PMID:34544496; PMID:29708978 | |||
| 363 | OMIA:000437-9615 | dog | Irish Setter (Dog) Miniature Schnauzer (Dog) | Haemophilia A | F8 | splicing | Naturally occurring variant | yes | X | intronic inversion that results in "aberrant splicing and premature termination" | 2002 | 12008949 | |||||||
| 1038 | OMIA:000437-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Haemophilia A | F8 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.36017426A>T | NM_001145508.1:c.134A>T | NP_001138980.1:p.(H45L) | ENSBTAT00000036726.5:c.134A>T; ENSBTAP00000036581.4:p.His45Leu | rs1117392179 | 2018 | 29774585 | ||
| 194 | OMIA:000437-9913 | taurine cattle | Japanese Brown, Japan (Cattle) | Haemophilia A | F8 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.36145188T>A | NM_001145508.1:c.6458T>A | NP_001138980.1:p.(L2153H) | rs456129807 | 2009 | 19456318 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1655 | OMIA:000437-9615 | dog | Border Collie (Dog) | Haemophilia A | F8 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.122956942delA | c.3206delA | NM_001003212.1 | 2023 | 38104983 | ||||
| 350 | OMIA:000437-9615 | dog | Old English Sheepdog (Dog) | Haemophilia A | F8 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | X | g.122973422G>A | c.1786C>T | p.(R596*) | 2016 | 27780008 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 100 | OMIA:000437-9615 | dog | German Shepherd Dog (Dog) | Haemophilia A | F8 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.122975611C>T | c.1700G>A | p.(C567Y) | NM_001003212.1; NP_001003212.1; published as c.1643G>A & p.(C548Y); coordinates in the table have been updated to a recent reference genome and / or transcript. | 2014 | 25040606 | |||
| 99 | OMIA:000437-9615 | dog | Boxer (Dog) | Haemophilia A | F8 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.122981181G>C | c.1469C>G | p.(P490R) | NM_001003212.1; NP_001003212.1; published as c.1412C>G & p.(P471R); coordinates in the table have been updated to a recent reference genome and/ or transcript | 2014 | 25040606 | |||
| 272 | OMIA:000437-9615 | dog | German Shepherd Dog (Dog) | Haemophilia A | F8 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | X | g.123043081C>T | c.98G>A | p.(W33*) | 2011 | 21949058 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 621 | OMIA:000437-9940 | sheep | Weißes Alpenschaf, Switzerland (Sheep) | Haemophilia A | F8 | delins, small (<=20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | X | g.86301507_86301516delinsTAATTAATACC | c.3108_3117delinsGGTATTAATTA | The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon | 2010 | 19943872 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. 210906 After checking the cDNA sequence in Fig. 3 of the paper, FN concluded that the 10bp deletion starts at c.3108 and ends at c.3117 and that the 11bp inserted sequence is GGTATTAATTA. Thus the HGVS-consistent notation is c.3108_3117delinsGGTATTAATTA, instead of c.3107del10ins11. | |||
| 1284 | OMIA:000437-9615 | dog | Rhodesian Ridgeback (Dog) | Haemophilia A | F8 | insertion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | g.124073876_124073877insN[221] | c.4824_4825insN[221] | NM_001003212.1; published as c.4824_25ins221, genomic coordinates published as chrX: 1240738676_77. After review of the position in the reference genome on the 17/7/2023 the genomic coordinates have been updated to g.124073876_124073877insN[221] in this table. | 2021 | 33494213 | ||||
| 1588 | OMIA:000437-9615 | dog | Labrador Retriever (Dog) | Haemophilia A | F8 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | g.124075777_124075778del | c.2923_2924del | p.(E975Kfs*8) | NM_001003212.1; NP_001003212 | 2023 | 37438956 | |||
| 636 | OMIA:000438-9615 | dog | Labrador Retriever (Dog) | Haemophilia B | F9 | deletion, gross (>20) | Naturally occurring variant | yes | X | a deletion of the entire gene | 1997 | 9394892 | |||||||
| 637 | OMIA:000438-9615 | dog | American Pit Bull Terrier (Dog) | Haemophilia B | F9 | deletion, gross (>20) | Naturally occurring variant | yes | X | Gu et al. (1999): "A large deletion mutation was found in 1 breed variant, spanning the entire 5' region of the factor IX gene extending to exon 6". | 1999 | 10544912 | Following Table 3 from Kuder et al. (2021), the breed for this variant has been changed to Pit Bull Terrier. (18th October 2021) | ||||||
| 1039 | OMIA:000438-9615 | dog | Hovawart (Dog) | Haemophilia B | F9 | regulatory | Naturally occurring variant | yes | CanFam3.1 | X | g.109501492del | c.-73del | NM_001003323.2; Brenig et al. (2019): NC_006621.3:g.109501492delC; "The deletion is located 73 bp upstream of the F9 start codon in the conserved overlapping DNA binding sites of hepatocyte nuclear factor 4alpha and androgen receptor." | 2019 | 30846504 | ||||
| 705 | OMIA:000438-9615 | dog | German Wirehaired Pointer (Dog) | Haemophilia B | F9 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | X | g.109521130_109521131insN[(1500)] | NM_001003323.2; published as "insert consists of a 5' truncated canine Line-1 followed by an approximately 200-bp 3' poly (A) tract, flanked by a 15-bp direct repeat"; g. coordinate of insertion obtained from Brenig et al. (2019) | 2003 | 14722728 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | ||||
| 467 | OMIA:000438-9615 | dog | Lhasa Apso (Dog) | Haemophilia B | F9 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.109521356_109521361delinsT | c.548_553delinsT | p.(R183Lfs*3) | NM_001003323.2; NP_001003323.1; published as "a deletion including nucleotides 772-776 and a C-->T transition at nucleotide 777", coordinates in the table have been updated to a recent reference genome and / or transcript and to HGVS nomenclature | 1996 | 8896410 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | ||
| 47 | OMIA:000438-9615 | dog | Rhodesian Ridgeback (Dog) | Haemophilia B | F9 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.109530868G>A | c.731G>A | p.(G244E) | NM_001003323.2; NP_001003323.1; published as p.(G244E) by Mischke et al. (2011), g. and p. coordinates were copied on the 18th October 2021 from Table 3 of Kuder et al. (2021) (relating to NP_001003323.1 ) as g.109530847G>A and p.(G237E). These g. and p. positions were incorrect. After review of Figure 1 published by Mischke et al. (2011) it was confirmed that the published p. coordinates are consistent with NM_001003323.2:c.731G>A and NP_001003323.1:p.(G244E). The g. coordinates have been updated to a recent reference genome (5th April 2022) | 2011 | 20303304 | Thank you to Agustín Arasanz for identifying that the coordinates published by Kuder et al. (2021) were inconsistent with the originally published information by Mischke et al. (2011) (5th April 2022). | ||
| 1363 | OMIA:000438-9615 | dog | Newfoundland (Dog) | Haemophilia B | F9 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.109531586_109531587insA | c.821_822insA | p.(N274Kfs*23) | NM_001003323.2; NP_001003323.1 | 2021 | 34680886 | |||
| 704 | OMIA:000438-9615 | dog | Airedale Terrier (Dog) | Haemophilia B | F9 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | X | g.109532012_109532013insN[(5000)] | c.1247_1248insN[(5000)] | NM_001003323.2; Gu et al. (1999): "An approximately 5 kb insertion disrupted exon 8 ... associated with alternative splicing between a donor site 5' and acceptor site 3' to the normal exon 8 splice junction, with introduction of a new stop codon. The resultant transcript lacked most of the factor IX catalytic domain and 3' untranslated region." | 1999 | 10544912 | CanFam3.1 coordinates copied from Table 3 of Kuder et al. (2021) (18 Oct 2021) | |||
| 46 | OMIA:000438-9615 | dog | Cairn Terrier (Dog) | Haemophilia B | F9 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.109532018G>A | c.1253G>A | p.(G418E) | NM_001003323.2; NP_001003323.1, published as p.(G379E) by Evans et al. (1989), coordinates in the table have been updated to a recent reference genome and / or transcript | 1989 | 2481310 | c. and p. coordinates updated from Kuder et al. (2021) | ||
| 127 | OMIA:000438-9685 | domestic cat | Domestic Longhair | Haemophilia B | F9 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | X | g.117091961G>A | c.383G>A | p.(C128Y) | NM_001009377.3; NP_001009377.1; published as p.(C82Y); coordinates in the table have been updated to a recent reference genome and / or transcript | 2005 | 15822564 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 310 | OMIA:000438-9685 | domestic cat | Haemophilia B | F9 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | X | g.117111577C>T | c.1150C>T | p.(R384*) | NM_001009377.3; NP_001009377.1; published as p.(R338*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2005 | 15822564 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 1360 | OMIA:002450-9913 | taurine cattle | Chianina (Cattle) | Ichthyosis congenita | FA2H | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 18 | g.2205625_2205626insG | c.9dupC | p.(A4Rfs*142) | NM_001192455.1; NP_001179384.1 | 2021 | 34599683 | |||
| 752 | OMIA:002032-9615 | dog | Border Collie (Dog) Mixed Breed (Dog) | Neuropathy, sensory | FAM134B | inversion | Naturally occurring variant | yes | CanFam3.1 | 4 | g.80439639_86910352inv | "6.47 Mb inversion was identified with breakpoints in intron 3 of FAM134B (chr4:86,910,352) and in an upstream intergenic region (chr4:80,439,639) ... … Analysis of RNAseq data revealed FAM134B was majorly disrupted by the inversion, with novel exons occurring 3′ of the final normally transcribed exon before the inversion, due to cryptic splicing." | 2016 | 27527794 | |||||
| 1342 | OMIA:002032-9615 | dog | Mixed Breed (Dog) | Neuropathy, sensory | FAM134B | missense | Naturally occurring variant | yes | CanFam3.1 | 4 | g.86916562C>T | c.656C>T | p.(P219L) | NM_001314111.1; NP_001301040.1 | 2021 | 34387380 | |||
| 925 | OMIA:001918-9615 | dog | Tibetan Spaniel (Dog) Tibetan Terrier (Dog) | Retinal atrophy, progressive, type 3, FAM161A-related | FAM161A | PRA3 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 10 | g.61822372_61822373insN[(230)] | A ~230bp insertion containing a 132bp short interspersed nuclear element (SINE), near the splice acceptor site of exon 5 CanFam2.0 coordinate published as g.64974130 | 2014 | 24705771 | ||||
| 1706 | OMIA:001918-9615 | dog | English Shepherd (Dog) | Retinal atrophy, progressive, type 6, FAM161A-related | FAM161A | PRA6 | insertion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 10 | NC_049231.1:g.63116065_63116066ins[N[210];63116051_63116065] | XM_038551371.1:c.1728_1729ins[N[210];1714-1728] | XP_038407299.1:p.(Q576_M577ins*50)) | published as XP_005626197.1 c.17929_ins210 | 2024 | 39062732 | ||
| 1183 | OMIA:002259-9913 | taurine cattle | Montbéliarde (Cattle) | de novo mutation in an AI sire | FAM189A1 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.28112913T>C | p.(N192S) | Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. | rs5334475108 | 2017 | 28904385 | |||
| 102 | OMIA:002015-9615 | dog | Border Collie (Dog) | Dental hypomineralization | FAM20C | missense | Naturally occurring variant | yes | CanFam3.1 | 6 | g.16452327G>A | c.899C>T | p.(A300V) | 2016 | 27187611 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 89 | OMIA:001327-9615 | dog | Bedlington Terrier (Dog) Irish Terrier (Dog) Kromfohrlander (Dog) | Hyperkeratosis, palmoplantar | FAM83G | missense | Naturally occurring variant | yes | CanFam3.1 | 5 | g.41055619G>C | c.155G>C | p.(R52P) | 2014 | 24832243 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Additional breed informationbased on Makri et al. (2021) | |||
| 1511 | OMIA:002600-9986 | rabbit | New Zealand White (Rabbit) | Amelogenesis imperfecta | FAM83H | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | yes | large deletion of more then 900bp in exon 5 | 2022 | 36300761 | ||||||||
| 460 | OMIA:001683-9615 | dog | Cavalier King Charles Spaniel (Dog) | Congenital keratoconjunctivitis sicca and ichthyosiform dermatosis | FAM83H | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.37328057del | c.977del | p.(P326Hfs*258) | NM_001289427.1; NP_001276356.1; genomic position in accordance with HGVS 3'-rule | 2012 | 22253609 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 683 | OMIA:002683-9615 | dog | Basenji (Dog) | Fanconi syndrome | FAN1 | deletion, gross (>20) | Naturally occurring variant | yes | 3 | "317 bp of exon 14 were deleted starting at the second exon14 nucleotide and extending into the 3' untranslated region of FAN1" | 2011 | Reference not in PubMed; see OMIA 002683-9615 for reference details | |||||||
| 646 | OMIA:000151-9913 | taurine cattle | Holstein (black and white) (Cattle) | Brachyspina | FANCI | deletion, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.20773899_20777226del | p.(V877Lfs*27) | 2012 | 22952632 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||||
| 613 | OMIA:002064-9685 | domestic cat | British Shorthair (Cat) | Autoimmune lymphoproliferative syndrome | FASLG | duplication | Naturally occurring variant | yes | Felis_catus_9.0 | F1 | g.16871916dup | c.418dup | p.(R140Kfs*37) | NM_001009352.1; NP_001009352.1; published as c.413_414insA "insertion of an adenine at position 14,607,400 [Felis_Catus_6.2]" (Aberdein et al., 2017); changed in this table to a recent reference genome and HGVS nomenclature | 2017 | 27770190 | |||
| 377 | OMIA:000628-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Marfan syndrome | FBN1 | splicing | Naturally occurring variant | yes | ARS-UCD1.2 | 10 | g.61917867G>A | c.8227-1G>A | rs5334475078 | 2012 | 22221020 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |||
| 201 | OMIA:000628-9913 | taurine cattle | Limousin (Cattle) | Marfan syndrome | FBN1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 10 | NC_037337.1:g.61831200G>A | NM_174053.2:c.3598G>A | NP_776478.1:p.(E1200K) | rs5334475103 | 2005 | 15776436 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1402 | OMIA:000628-9823 | pig | Marfan syndrome | FBN1 | deletion, small (<=20) | Genome-editing (ZFN) | yes | Sscrofa11.1 | 1 | g.123246159del | p.(E433Nfs98*) | 2016 | 27074716 | ||||||
| 910 | OMIA:000836-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Limousin (Cattle) | Protoporphyria | FECH | extension (stop-lost) | Naturally occurring variant | yes | ARS-UCD1.3 | 24 | NC_037351.1:g.56787697C>A | NM_174054.2:c.1250G>T | NP_776479.1:p.(*417Lext*27) | rs5334474668 | 1998 | 9784594 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 576 | OMIA:001525-9615 | dog | German Shepherd Dog (Dog) | Leukocyte adhesion deficiency, type III | FERMT3 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.52835932_52835933insGGCAGCCGTCTT | c.1349_1350insAAGACGGCTGCC | p.(L450_A451insRRLP) | XM_038425194.1; XP_038281122.1; 12-base pair insertion | 2010 | 20126836 | |||
| 1336 | OMIA:002382-9615 | dog | Dachshund, Miniature Wire-Haired (Dog) | Afibrinogenaemia | FGA | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.52240694del | c.1665delT | p.(I555Mfs*33) | Transcript XM_532697.6 / ENSCAFT00000043702.3 | rs1152388481 | 2021 | 34356081 | ||
| 1529 | OMIA:002625-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Skeletal dysplasia, FGD3 related | FGD3 | delins, small (<=20) | Naturally occurring variant | yes | UMD_3.1.1 | 8 | g.85826989_85826990delinsTG | p.(H171C) | 2015 | 26306008 | |||||
| 1326 | OMIA:002374-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Charcot Marie Tooth disease | FGD4 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.77262490C>T | XM_024992559.1:c.1671+1G>A | Splice donor mutation based on XM_005206883.3 | rs5334475069 | 2021 | 34045765 | |||
| 941 | OMIA:001723-9940 | sheep | Romney Marsh (Sheep) | Familial episodic ataxia | FGF14 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 10 | g.88095843G>A | c.46C>T | p.(Q16*) | Oar_v3.1 position is g.77593415 | 2017 | 29253853 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 327 | OMIA:000889-9031 | chicken | Israeli experimental line, Israel (Chicken) Storrs Connecticut scaleless low line, United States of America (Chicken) UC Davis line, United States of America (Chicken) | Scaleless | FGF20 | nonsense (stop-gain) | Naturally occurring variant | yes | GRCg6a | 4 | g.63270401A>T | c.535A>T | p.(R179*) | 2012 | 22712610 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 929 | OMIA:000272-9615 | dog | Rhodesian Ridgeback (Dog) Thai Ridgeback (Dog) | Ridge & dermoid sinus | FGF3 | Ridge allele | duplication | Naturally occurring variant | yes | CanFam3.1 | 18 | g.48372578_48505893dup133316 | A large ~133,000 bp duplication on chromosome 18, encompassing three FGF genes (FGF3, FGF4, FGF19) and another gene ORAOV1. There is an additional single T inserted between the two copies of the duplication. This is not indicated in the genomic variant designation. | 2007 | 17906623 | ||||
| 855 | OMIA:000157-9615 | dog | American Cocker Spaniel (Dog) Basset Hound (Dog) Beagle (Dog) Cardigan Welsh Corgi (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Coton de Tulear (Dog) Dachshund (Dog) English Springer Spaniel (Dog) French Bulldog (Dog) Nova Scotia Duck Tolling Retriever (Dog) | Intervertebral disc disease, type I | FGF4 retrogene in CFA12 | FGF4L2 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 12 | " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until it can be standardised | 2017 | 29073074 | |||||
| 853 | OMIA:002133-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Skeletal dysplasia, FGF4-retrogene-related | FGF4 retrogene on CFA12 | FGF4L2 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 12 | " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until can be standardised | 2017 | 29073074 | |||||
| 559 | OMIA:000439-10036 | golden hamster | Hair, long | Fgf5 | deletion, small (<=20) | Naturally occurring variant | no | c.546delG | p.(R184GfsX6) | 2015 | 26481120 | ||||||||
| 787 | OMIA:002090-9913 | taurine cattle | Holstein (black and white) (Cattle) | Facial dysplasia syndrome | FGFR2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 26 | NC_037353.1:g.41489034C>A | NM_001205310.1:c.927G>T | NP_001192239.1:p.(W309C) | rs5334475009 | 2017 | 28768473 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1179 | OMIA:001703-9913 | taurine cattle | Holstein (black and white) (Cattle) | Chondrodysplasia, disproportionate | FGFR3 | extension (stop-lost) | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.116767863C>A | NM_174318.3:c.2408G>T | NP_776743.1:p.(*803Lext*93) | NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) | rs5334474953 | 2020 | 32239744 | ||
| 225 | OMIA:001703-9940 | sheep | Suffolk (Sheep) | Chondrodysplasia, Spider lamb | FGFR3 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 6 | g.128784747A>T | c.1719T>A | p.(V700E) | 2006 | 16441300 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 77 | OMIA:001335-9615 | dog | German Shepherd Dog (Dog) | Renal cystadenocarcinoma and nodular dermatofibrosis | FLCN | missense | Naturally occurring variant | yes | CanFam3.1 | 5 | g.42186445A>G | c.764A>G | p.(H255R) | rs1152388411 | 2003 | 14532326 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 860 | OMIA:001360-9031 | chicken | Beijing You, China (Chicken) Commercial strain- layer- ISA Brown (Chicken) Commercial strain- layer- Lohmann Brown (Chicken) Marans (Chicken) Rhode Island Red (Chicken) TETRA strain, United States of America (Chicken) Transylvanian Naked Neck (Chicken) | Trimethylaminuria (fishy taint) | FMO3 | missense | Naturally occurring variant | yes | 8 | c.1034A>T | p.(T329S) | 2005 | 15916878 | ||||||
| 304 | OMIA:001360-9913 | taurine cattle | Swedish Red and White (Cattle) | Trimethylaminuria (fishy taint) | FMO3 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 16 | NC_037343.1:g.38666821C>T | NM_174057.2:c.712C>T | NP_776482.1:p.(R238*) | rs797790546 | 2002 | 12466292 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | ||
| 531 | OMIA:000526-9615 | dog | Weimaraner (Dog) | Hypomyelination of the central nervous system | FNIP2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.55928287del | c.1078del | p.(I360Lfs*3) | XM_005629382.3; XP_005629439.1; published as CanFam2:58974928delA, XM_532705:c.880delA and p.(I294fs*296) - coordinates in the table have been updated to a recent reference genome and / or transcript and HGVS nomenclature | 2014 | 24272703 | |||
| 571 | OMIA:000323-9615 | dog | Chinese Crested (Dog) Peruvian Hairless Dog (Dog) Xoloitzcuintli (Dog) | Ectodermal dysplasia | FOXI3 | insertion, small (<=20) | Naturally occurring variant | yes | ROS_Cfam_1.0 | 17 | g.38764875_38764881dup | c.57_63dup | p.(A23Rfs*219) | NM_001135646.1; NP_001129118.1 | 2008 | 18787161 | |||
| 1319 | OMIA:001949-9685 | domestic cat | Birman (Cat) | Hypotrichosis, with short life expectancy | FOXN1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.18255880_18255883del | c.1030_1033del | p.L344Gfs | XM_019817475.2; XP_019673034.1; published as c.1030_1033delCTGT; predicted to cause a frameshift leading to a premature stop codon at position 547 | 2015 | 25781316 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 461 | OMIA:000396-9615 | dog | English Springer Spaniel (Dog) | Fucosidosis, alpha | FUCA1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.75665866_75665879del | c.379_392del | p.(A127Vfs*26) | NM_001003250.1; NP_001003250.1; a 14-bp deletion at the 3' end of exon 1 | 1996 | 8730282 | |||
| 178 | OMIA:000862-9823 | pig | Resistance to oedema disease (F18 receptor) | FUT1 | missense | Naturally occurring variant | no | Sscrofa11.1 | 6 | g.54079560T>C | c.304A>G | p.(T103A) | The variant was initially described as c.307G>A and p.A103T by Vögeli et al. 1997. VEP analysis identified the variant as c.304A>G p.T102A in transcript ENSSSCT00000051297.2 | rs335979375 | 2000 | 11132149 | |||
| 1436 | OMIA:002536-9615 | dog | Wirehaired Pointing Griffon (Dog) | Juvenile cataract | FYCO1 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 20 | g.42952995del | c.2024delG | p.(S675Tfs*5) | XM_038566669.1; XP_038422597.1 | 2022 | 35205377 | |||
| 1361 | OMIA:000418-9615 | dog | German Pinscher (Dog) | Glycogen storage disease Ia | G6PC | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.20134857_20134858insN[76] | c.634_635insN[76] | XM_038676372.1; insertion of 60 consecutive adenines and an additional 16 bp duplication of the integration site (Christen et al., 2021) | 2021 | 34610166 | ||||
| 44 | OMIA:000418-9615 | dog | Maltese (Dog) | Glycogen storage disease Ia | G6PC | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.20138777C>G | c.363G>C | p.(M121I) | NM_001002993.2; NP_001002993.2; published as c.450G>C; coordinates in the table have been updated to a recent reference genome and / or transcript | 1997 | 9259982 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 488 | OMIA:000419-9913 | taurine cattle | Shorthorn (Cattle) | Glycogen storage disease II | GAA | E18 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.52484973_52484974del | NM_173913.2:c.2454_2455del | NP_776338.1:p.(T819R) | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 294 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) | Glycogen storage disease II | GAA | E13 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.52488949G>A | c1783C>T | NP_776338.1:p.(R595*) | UMD3.1 position is g.53105979C>T; variant initially identified in Brahman cattle and later reported in additional breeds:PMID:34779908. | rs5334474904 | 2000 | 10723725 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. |
| 487 | OMIA:000419-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Brahman (Cattle) Droughtmaster (Cattle) | Glycogen storage disease II | GAA | E7 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.52492405_52492406del | NM_173913.2:c.1057_1058del | NP_776338.1:p.(Y353L) | UMD3.1 position is g.53109436_53109437del; variant initially identified in Brahman cattle and later reported in additional breeds: PMID:28444756, PMID:34779908. | 2000 | 10723725 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 270 | OMIA:000419-9615 | dog | Finnish Lapphund (Dog) Swedish Lapphund (Dog) | Glycogen storage disease II | GAA | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.1603730C>T | c.2237G>A | p.(W746*) | 2013 | 23457621 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1544 | OMIA:000419-9685 | domestic cat | Domestic Shorthair | Glycogen Storage Disease Type II (Pompe Disease) | GAA | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.60946737G>A | c.1799G>A | p.(R600H) | XM_006940651.4; XP_006940713.4 | 2023 | 37106898 | The OMIA curators thank Osamu Yamato for providing the variant information not included in Rakib et al. (2023); 17 April 2023. | ||
| 517 | OMIA:000578-9544 | Rhesus monkey | Krabbe disease | GALC | deletion, small (<=20) | Naturally occurring variant | yes | c.387delAC | 1997 | 9192853 | |||||||||
| 953 | OMIA:000578-9615 | dog | Irish Setter (Dog) | Krabbe disease | GALC | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 8 | g.59294611_59294612insN[78] | c.790_791insN[78] | NM_001003238.1; NP_001003238.1; the 78 bp insertion includes a 16-bp insertion site duplication and a 62 bp U4 snRNA-derived sequence; the downstream reading frame is preserved (for sequence details see McGraw et al., 2006) | 2006 | 16490723 | ||||
| 51 | OMIA:000578-9615 | dog | Cairn Terrier (Dog) West Highland White Terrier (Dog) | Krabbe disease | GALC | missense | Naturally occurring variant | yes | CanFam3.1 | 8 | g.59311801T>G | c.473A>C | p.(Y158S) | NM_001003238.1; NP_001003238.1 | 1996 | 8661004 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1607 | OMIA:000578-9615 | dog | Mixed Breed (Dog) | Krabbe disease | GALC | missense | Naturally occurring variant | yes | Dog10K_Boxer_Tasha | 8 | g.58893972G>A | c.149C>T | p.(A50V) | NM_001003238.1; NP_001003238.1; published as NC_006590.4:g.58893972G>A | 2023 | 37593836 | |||
| 1327 | OMIA:002375-9913 | taurine cattle | Holstein Friesian (Cattle) Jersey (Cattle) | Congenital disorder of glycosylation | GALNT2 | splicing | Naturally occurring variant | yes | ARS-UCD1.2 | 28 | g.2281801G>A | c.1561-1G>A | Splice acceptor mutation based on NM_001193103.1. | rs5334474933 | 2021 | 34045765 | |||
| 182 | OMIA:001826-9913 | taurine cattle | Holstein (black and white) (Cattle) | Abortion due to haplotype HH4 | GART | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 1 | NC_037328.1:g.1997582A>C | NM_001040473.2:c.869A>C | NP_001035563.1:p.(N290T) | rs465495560 | 2013 | 23762392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1501 | OMIA:002559-9913 | taurine cattle | Holstein Friesian (Cattle) | Persistent truncus arteriosus | GATA6 | nonsense (stop-gain) | Naturally occurring variant | unknown | ARS-UCD1.2 | 24 | g.34187181T>A | c.1249A>T | p.K417X | ENSBTAT00000007537.6 | 2022 | 36333145 | |||
| 231 | OMIA:002621-9940 | sheep | South Down (Sheep) | Gaucher disease, type | GBA | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.111561271C>T | XM_004002580.4:c.1142G>A | XP_004002629.2:p.(C381Y) | Oar_v3.1 position is g.103978212C>T | rs429928390 | 2017 | 29023809 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 322 | OMIA:000420-9796 | horse | American Paint (Horse) Quarter Horse (Horse) | Glycogen storage disease IV | GBE1 | nonsense (stop-gain) | Naturally occurring variant | yes | EquCab3.0 | 26 | NC_009169.3:g.8667651C>A | NM_001081940.2:c.102C>A | NP_001075409.1:p.(Y34*) | NM_001081940.2; NP_001075409.1 | rs3437568674 | 2004 | 15366377 | The genomic position in EquCab3.0 was provided by Elizabeth Clark, working under the guidance of Professor Ernie Bailey in April 2022 | |
| 742 | OMIA:000420-9685 | domestic cat | Norwegian Forest Cat (Cat) | Glycogen storage disease IV | GBE1 | delins, gross (>20) | Naturally occurring variant | yes | Felis_catus_9.0 | C2 | g.34744479_34781895delinsN[334] | published as "334 bp insertion at the site of a 6.2 kb deletion that extends from intron 11 to intron 12 (g. IVS11+1552_IVS12-1339 del6.2kb ins334 bp), removing exon 12" | 2007 | 17257876 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. | ||||
| 744 | OMIA:001245-9031 | chicken | Rhode Island Red (Chicken) | Retinal degeneration I | GC1 | complex rearrangement | Naturally occurring variant | yes | 26 | This allele is characterised by an 81bp insertion adjacent to a 642bp deletion | 1998 | 9448321 | |||||||
| 1494 | OMIA:002579-9913 | taurine cattle | Irish Moiled (Cattle) | Perinatal mortality syndrome, GCK-related | GCK | splicing | Naturally occurring variant | yes | ARS-UCD1.2 | 4 | g.77173487A>T | 2022 | 36105082 | ||||||
| 721 | OMIA:000701-9031 | chicken | Naked neck | GDF7 | insertion, gross (>20) | Naturally occurring variant | yes | 3 | a large insertion approximately 260kb downstream from the BMP12 gene (now known as GFD7), increasing the expression of this gene in embryonic skin | 2011 | 21423653 | ||||||||
| 1221 | OMIA:002366-9685 | domestic cat | Toyger (Cat) | Holoprosencephaly | GDF7 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A3 | g.127002233_127002239del | c.221_227del | p.(R74Pfs*17) | XM_023252074.1; XP_023107842.1; published as "a 7 bp deletion in the coding region of GDF7 (c.221_227delGCCGCGC [p.Arg74Profs*17]) at the position A3:127002233 (ENSFCAT00000063603)" (Yu et al., 2020) | rs5334475136 | 2020 | 32575532 | ||
| 444 | OMIA:001514-9615 | dog | English Pointer (Dog) English Springer Spaniel (Dog) French Spaniel (Dog) German Shorthaired Pointer (Dog) | Acral mutilation syndrome | GDNF | regulatory | Naturally occurring variant | yes | CanFam3.1 | 4 | g.70875561C>T | "This variant, located 90 kb upstream of the GDNF gene, a highly relevant neurotrophic factor candidate gene, lies in [the last exon of] a long intergenic non-coding RNAs (lincRNA), GDNF-AS." | 2016 | 28033318 | |||||
| 114 | OMIA:001208-9615 | dog | Labrador Retriever (Dog) | Alexander disease | GFAP | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.18572769G>A | c.719G>A | p.(R240H) | rs850986067 | 2016 | 26486469 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 293 | OMIA:001442-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Forelimb-girdle muscular anomaly | GFRA1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 26 | NC_037353.1:g.36627244G>A | NM_001105411.1:c.430C>T | NP_001098881.1:p.(Q144*) | rs5334475112 | 2013 | Reference not in PubMed; see OMIA 001442-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 190 | OMIA:001473-9915 | indicine cattle (zebu) | Brahman (Cattle) | Dwarfism, growth-hormone deficiency | GH1 | missense | Naturally occurring variant | yes | c.641C>T | p.(T200M) | Bos indicus cDNA position based on AF034386, protein position based on AAB92549 | 2009 | 19524387 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||||
| 1232 | OMIA:001473-9615 | dog | Chihuahua (Dog) | Dwarfism, growth-hormone deficiency | GH1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.11832438_11832443del | c.573_578del | p.(K191_D193delinsN) | NM_001003168.1; NP_001003168.1; variant initially identified in Chihuahuas and later reported in additional breeds: PMID: 37582787 | 2020 | 32646299 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 660 | OMIA:000309-9031 | chicken | Connecticut (CT) strain, United States of America (Chicken) S2 line, China (Chicken) | Dwarfism, sex-linked | GHR | deletion, gross (>20) | Naturally occurring variant | yes | Z | deletion of 1773 bp in the 3' end of the coding region of the growth hormone receptor gene | 1994 | 7964293 | |||||||
| 677 | OMIA:001920-27706 | largemouth bass | Abortion due to deletion in GHRH | GHRH | deletion, gross (>20) | Naturally occurring variant | yes | a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal | 2014 | 24697798 | |||||||||
| 794 | OMIA:002119-9615 | dog | Leonberger (Dog) | Polyneuropathy (LPN2) | GJA9 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.3863524_3863525del | c.1107_1108delAG | p.(A370Nfs*12) | 2017 | 28841859 | ||||
| 41 | OMIA:000402-9615 | dog | Portuguese Water Dog (Dog) | Gangliosidosis, GM1 | GLB1 | missense | Naturally occurring variant | yes | CanFam3.1 | 23 | g.3754313G>A | c.179G>A | p.(R60H) | NM_001037641.1; NP_001032730.1; published as c.200G>A; coordinates in the table have been updated to a recent reference genome and / or transcript | 2000 | 11032334 | |||
| 462 | OMIA:000402-9615 | dog | Shiba Inu (Dog) | Gangliosidosis, GM1 | GLB1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 23 | g.3796317delC | c.1649delC | p.(P550Rfs*50) | 2002 | 12555949 | The variant coordinates are those reported by Pervin et al. (2022) Animals 12(10), 1242. | |||
| 573 | OMIA:000402-9615 | dog | Alaskan Husky (Dog) | Gangliosidosis, GM1 | GLB1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 23 | g.3796356_3796374dup | c.1688_1706dup | p.(T570Pfs*22) | NM_001037641.1; NP_001032730.1; 19 base pair duplication in exon 15. Two different aberrant mRNA transcripts are produced from the mutant allele. The protein variant designation refers to one of these transcripts that includes the mutant exon 15. In the other aberrant transcript, the mutant exon 15 is skipped and a different truncated protein is encoded. | 2005 | 15944348 | |||
| 126 | OMIA:000402-9685 | domestic cat | Korat (Cat) Siamese (Cat) | Gangliosidosis, GM1 | GLB1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | C2 | g.158932167C>G | c.1448G>C | p.(R483P) | rs5334475143 | 2008 | 18353697 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 230 | OMIA:000402-9940 | sheep | Romney Marsh (Sheep) | Gangliosidosis, GM1 | GLB1 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 19 | g.8003247C>A | c.686G>T | p.(C299F) | cDNA position based on ENSOART00020038844.1 | 2012 | Reference not in PubMed; see OMIA 000402-9940 for reference details | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 302 | OMIA:000689-9913 | taurine cattle | Polled Hereford (Cattle) | Myoclonus | GLRA1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.63070074G>T | NM_174321.2:c.156C>A | NP_776746.1:p.(Y52*) | rs5334475027 | 2001 | 11178872 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1571 | OMIA:000689-9615 | dog | Miniature Australian Shepherd Dog (Dog) | Hyperekplexia | GLRA1 | deletion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 4 | g.58338954_58338989del | published as a 36-bp deletion encompassing part of the intron 1 and exon 2 (chr4:g.58,338,953); coordinates in the this table are in accordance with HGVS nomenclature | 2023 | 37222814 | |||||
| 496 | OMIA:001427-9685 | domestic cat | Gangliosidosis, GM2, GM2A deficiency | GM2A | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.198114664_198114667del | c.516_519del | p.(V173Sfs*17) | XM_003981379.5; XP_003981428.2; published as c.516_519delGGTC | 2005 | 16200419 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 515 | OMIA:001368-9031 | chicken | Retinopathy globe enlarged | GNB3 | deletion, small (<=20) | Naturally occurring variant | yes | 1 | c.D153del | 2006 | 17065478 | ||||||||
| 1035 | OMIA:001248-9685 | domestic cat | Domestic Shorthair | Mucolipidosis II | GNPTAB | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.124431151G>A | c.2644C>T | p.(Q882*) | XM_003989173.5; XP_003989222.2 | 2018 | 30591066 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 265 | OMIA:000665-9925 | goat | Anglo-Nubian (Goat) | Mucopolysaccharidosis IIID | GNS | nonsense (stop-gain) | Naturally occurring variant | yes | ARS1.2 | 5 | NC_030812.1:g.48406875C>T | NM_001285690.1:c.304C>T | NP_001272619.1:p.(R102*) | rs5334475114 | 1995 | 7623459 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. Published as c.322C>T. | ||
| 778 | OMIA:001985-9913 | taurine cattle | Simmental (Cattle) | Dwarfism, Fleckvieh | GON4L | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 3 | NC_037330.1:g.15024247del | NM_001192625.1:c.4287del | NP_001179554.1:p.(G1430Kfs*66) | Previously listed as ARS-UCD1.2: g.15024245del and c.4286del; g. and c. updated to reflect HGVS recommendations (3' rule) [29/08/2024] | rs723240647 | 2016 | 27036302 | Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909 | |
| 1097 | OMIA:002207-9615 | dog | Cocker Spaniel (Dog) | Bernard-Soulier syndrome, type C | GP9 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 20 | g.3025814_3028273del | c.127_*2052del | XM_846924.3; Gentilini et al. (2019): "The [2460bp] deletion truncates 104 (71%) of the 146 codons of the wildtype canine reading frame." | 2019 | 31484196 | ||||
| 383 | OMIA:000821-9685 | domestic cat | Primary hyperoxaluria type II (Oxalosis II) | GRHPR | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | D4 | g.60968927G>A | p.(N169Kfs*46) | "point mutation, G to A, . . . at the 3# splice acceptor site of intron 4" ; protein position based on XP_006939354.1 | rs5334475152 | 2009 | Reference not in PubMed; see OMIA 000821-9685 for reference details | ||||
| 693 | OMIA:000078-9615 | dog | Coton de Tulear (Dog) | Ataxia, cerebellar | GRM1 | insertion, gross (>20) | Naturally occurring variant | yes | 1 | "a 62-bp truncated retrotransposon insert in exon 8" | 2011 | 21281350 | |||||||
| 1552 | OMIA:002692-9796 | horse | American Saddle Horse (Horse) American Trotter (Horse) Miniature Horse (Horse) Missouri Fox Trotting Horse, United States of America (Horse) Morgan (Horse) Quarter Horse (Horse) Racking Horse (Horse) Rocky Mountain, United States of America (Horse) Spotted Saddle Horse (Horse) Tennessee Walking Horse (Horse) | Night blindness, congenital stationary, GRM6-related | GRM6 | missense | Naturally occurring variant | yes | EquCab3.0 | 14 | NC_009157.3:g.2655618C>T | XM_001916934.4:c.533C>T | XP_001916969.3:p.(T178M) | XM_001916934.4; XP_001916969.3; variant initially reported in Tennessee Walking horse and later reported in other breeds [PMID:37815029] | rs1138010744 | 2021 | 32654228 | ||
| 1536 | OMIA:002646-9615 | dog | German Spitz (Dog) | Progressive retinal atrophy | GUCY2D | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.32849537_32849538insT | c.1598_1599insT | p.(S534Efs*20) | NM_001003207.1; NP_001003207.1 | 2023 | 36872573 | |||
| 1195 | OMIA:002268-9823 | pig | Danish Landrace (Pig) | Vitamin C deficiency | GULO | od | deletion, gross (>20) | Naturally occurring variant | yes | 14 | "This deletion includes 77 bp of exon VIII, 398 bp of intron 7 and 3.7 kbp of intron 8, which leads to a frame shift. The mutant protein is truncated to 356 amino acids, but only the first 236 amino acids are identical to the wild-type GULO protein." (Hasan et al., 2004) | 2004 | 15112110 | ||||||
| 58 | OMIA:000667-9615 | dog | Brazilian Terrier (Dog) | Mucopolysaccharidosis VII | GUSB | missense | Naturally occurring variant | yes | CanFam3.1 | 6 | g.740428G>A | c.866C>T | p.(P289L) | 2012 | 22815736 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 57 | OMIA:000667-9615 | dog | German Shepherd Dog (Dog) | Mucopolysaccharidosis VII | GUSB | missense | Naturally occurring variant | yes | CanFam3.1 | 6 | g.741429C>T | c.497G>A | p.(R166H) | ROS_Cfam_1.0:g.546709C>T ENSCAFT00845023689.1:c.482G>A ENSCAFP00845018598.1:p.Arg161His | rs1152388412 | 1998 | 9521879 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 133 | OMIA:000667-9685 | domestic cat | Mucopolysaccharidosis VII | GUSB | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E3 | g.16120173G>A | c.1051G>A | p.(E351K) | NM_001009310.1; NP_001009310.1; published as "single G-to-A transition at nucleotide position 1074, predicting a glutamate-to-lysine substitution of amino acid residue 351 (E351K)" | rs5334475137 | 1999 | 10366443 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 139 | OMIA:000667-9685 | domestic cat | Mucopolysaccharidosis VII | GUSB | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E3 | g.[16123229T>G;16123232C>T] | c.[1423T>G;1426C>T] | p.(S475_R476delinsAW) | NM_001009310.1; NP_001009310.1; published as c.1421T>G and c.1424C>T; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 26118695 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 163 | OMIA:001158-9796 | horse | American Paint (Horse) Appaloosa (Horse) Belgian Draft (Horse) Quarter Horse (Horse) | Polysaccharide storage myopathy/Exertional rhabdomyolysis | GYS1 | missense | Naturally occurring variant | yes | EquCab3.0 | 10 | NC_009153.3:g.19203501C>T | NM_001126125.2:c.926G>A | NP_001119597.2:p.(R309H) | ENSECAT00000023453.3:c.926G>A ENSECAP00000019426.2:p.Arg309His | rs1150416011 | 2008 | 18358695 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Breed information updated based on PMID: 38600096 | |
| 924 | OMIA:001374-9615 | dog | Labrador Retriever (Dog) | Centronuclear myopathy, HACD1-related | HACD1 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.19371988_19371989ins[N[236];CACACAAAGGTTT] | c.203_204ins[N[236];CACACAAAGGTTT] | NM_001025269.1; published as insertion of a 236 bp antisense canine tRNA-like SINE (EMBL accession no. AJ876906), flanked on both sides by a 13 bp direct duplication of the insertion site; resulting in multiple splicing defects | 2005 | 15829503 | ||||
| 1421 | OMIA:002522-9615 | dog | Norwegian Elkhound (Dog) | Ataxia, HACE1-related | HACE1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 12 | g.62282767del | c.1001del | p.(G334Vfs*34) | ENSCAFT00000072236.1; ENSCAFP00000049888.1 | 2022 | 35061740 | |||
| 64 | OMIA:000703-9615 | dog | Dachshund (Dog) | Narcolepsy | HCRTR2 | missense | Naturally occurring variant | yes | CanFam3.1 | 12 | g.22517939G>A | c.160G>A | p.(E54K) | NM_001002933.1; NP_001002933.1 | 2001 | 11282968 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 419 | OMIA:000703-9615 | dog | Doberman Pinscher (Dog) | Narcolepsy | HCRTR2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 12 | g.22603767_22603768insN[226] | c.647-36_647-35insN[226] | NM_001002933.1; a 226 bp SINE insertion in intron 3 of the HCRTR2 gene leads to skipping of exon 4 | 1999 | 10458611 | ||||
| 368 | OMIA:000703-9615 | dog | Labrador Retriever (Dog) | Narcolepsy | HCRTR2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 12 | g.22620881G>A | c.1105+5G>A | NM_001002933.1; NP_001002933.1; experimentally confirmed splice defect; skipping of exon 6 in the HCRTR2 mRNA transcript due to a G to A transition at position +5 in the 5′-splice site of intron 6 | rs1152388413 | 1999 | 10458611 | |||
| 296 | OMIA:002230-9913 | taurine cattle | Belted Galloway (Cattle) Brown Swiss (Cattle) | Hypotrichosis | HEPHL1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 29 | NC_037356.1:g.721234T>A | NM_001192511.2:c.1684A>T | NP_001179440.1:p.(K562*) | NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021); Variant initially identified in Galloway cattle and later reported in additional breeds: PMID:30014197 | rs5334475051 | 2021 | 33926013 | ||
| 535 | OMIA:001944-9615 | dog | Miniature Schnauzer (Dog) | Spondylocostal dysostosis, autosomal recessive | HES7 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.32945846del | c.126delG | p.(T43Pfs*24) | 2015 | 25659135 | ||||
| 145 | OMIA:001987-9685 | domestic cat | Japanese domestic | Bobtail | HES7 | JBT | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.2918735A>G | c.5A>G | p.(V2A) | XM_003996191.4:c.5T>C; Felis_catus_6.2: g.2819475A>G | rs5334475119 | 2016 | 27030474 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770) |
| 1178 | OMIA:001461-9217 | American flamingo | Tay-Sachs disease | HEXA | missense | Naturally occurring variant | yes | c.1406C>T | p.(P469L) | 2008 | 18693054 | ||||||||
| 26 | OMIA:001461-9615 | dog | Japanese Chin (Dog) | Gangliosidosis, GM2, type I | HEXA | missense | Naturally occurring variant | yes | CanFam3.1 | 30 | g.35841247C>T | c.967G>A | p.(E323K) | 2013 | 23266199 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 387 | OMIA:001461-9940 | sheep | Jacob (Sheep) | Gangliosidosis, GM2, type I (B variant) | HEXA | splicing | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.20584348C>G | NM_001126343.1:c.1330G>C | The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. | 2010 | 20817517 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1318 | OMIA:001461-9823 | pig | Wild boar | Gangliosidosis, GM2, type I | HEXA | missense | Naturally occurring variant | yes | Sscrofa11.1 | 7 | g.60910365C>T | c.1495C>T | p.(R499C) | cDNA positions based on NM_001123221.1 | rs5334475169 | 2021 | 34119419 | ||
| 463 | OMIA:001462-9615 | dog | Poodle, Toy (Dog) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.57225684del | c.391del | p.(V131*) | XM_022414769.1; XP_022270477.1; published as c.283delG and p.(V59fs); coordinates in the table have been updated to a recent reference genome and / or transcript | 2012 | 22766310 | |||
| 798 | OMIA:001462-9615 | dog | Shiba Inu (Dog) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.57243656_57243658del | c.849_851del | p.(L284del) | XM_022414769.1; XP_022270477.1; published by Kolicheski et al. (2017) as p.Leu317del and reported by Wang et al. (2018) as p.(L207del) | 2017 | 28833537 | |||
| 497 | OMIA:001462-9685 | domestic cat | Korat (Cat) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.141540010del | c.39del | p.(L14Sfs*82) | NM_001009333.2; NP_001009333.2; published as c.39delC | 1994 | 8178934 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 309 | OMIA:001462-9685 | domestic cat | Japanese domestic | Gangliosidosis, GM2, type II (Sandoff or variant 0) | HEXB | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.141565348C>T | c.667C>T | p.(R223*) | NM_001009333.2; NP_001009333.2 | 2007 | 16872651 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 381 | OMIA:001462-9685 | domestic cat | Burmese (Cat) | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.141571030_141571044del | c.1244-8_1250del | NM_001009333.2 | 2009 | 19231264 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 741 | OMIA:001462-9685 | domestic cat | Domestic Shorthair | Gangliosidosis, GM2, type II (Sandhoff or variant 0) | HEXB | inversion | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.141571788_141571812inv | c.1467_1491inv | p.(F489Lfs*4) | NM_001009333.2; NP_001009333.2 | 2004 | 15081585 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 1584 | OMIA:001243-9601 | Sumatran orangutan | Alkaptonuria | HGD | missense | Naturally occurring variant | yes | Susiae_PABv2/ponAbe3 | 3 | g.17314095G>A | c.1081G>A | p.(G361R) | 2023 | 37354891 | |||||
| 1170 | OMIA:001311-9615 | dog | Miniature Schnauzer (Dog) | Progressive retinal atrophy, Miniature Schnauzer, type 1 | HIVEP3 | probably not causal, can be used as linked marker for genetic testing | not known | Naturally occurring variant | unknown | CanFam3.1 | 15 | g.1432293G>A | "intronic variant in HIVEP3/ENSCAFG00000035604" (Kaukonen et al., 2020). The genetic evidence is unable to distinguish between the HIVEP3 and PPT1 variants as potential causes of PRA. ... functional considerations favor causality of the coding PPT1 structural variant over the intronic HIVEP3 SNV" (Aguirre et al. 2020). | 2020 | 32150541 | ||||
| 596 | OMIA:001493-9685 | domestic cat | Siamese (Cat) | Porphyria, acute intermittent | HMBS | insertion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | 16541468dup | c.189dup | p.(L64Sfs*2) | NM_001177808.1; NP_001171279.1; published as c.189dupT | 2010 | 19934113 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 530 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.16540928_16540931del | c.107_110del | p.(D36Vfs*6) | NM_001177808.1; NP_001171279.1; published as c.107_110delACAG | 2013 | 24239138 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 135 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.16541614G>A | c.250G>A | p.(A84T) | NM_001177808.1; NP_001171279.1 | rs5334475139 | 2013 | 24239138 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 136 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.16542541C>T | c.445C>T | p.(R149W) | NM_001177808.1; NP_001171279.1 | rs5334475165 | 2013 | 24239138 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 402 | OMIA:001493-9685 | domestic cat | Porphyria, acute intermittent | HMBS | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.16544575G>A | c.826-1G>A | NM_001177808.1 | rs5334475129 | 2013 | 24239138 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 501 | OMIA:001493-9685 | domestic cat | Siamese (Cat) | Porphyria, acute intermittent | HMBS | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.16544592_16544594del | c.842_844del | p.(G281del) | NM_001177808.1; NP_001171279.1; published as c.842_844delGAG | 2013 | 24239138 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 689 | OMIA:000299-9986 | rabbit | Dwarf, long-haired Holland Lop (Rabbit) Netherland dwarf (Rabbit) | Dwarfism | HMGA2 | dw | deletion, gross (>20) | Naturally occurring variant | yes | 4 | "that the dwarf allele constitutes a ~12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene." | 2017 | 27986804 | ||||||
| 727 | OMIA:000317-9913 | taurine cattle | Highland (Cattle) | Ears, crop | HMX1 | insertion, gross (>20) | Naturally occurring variant | no | 6 | 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly | 2013 | 24194898 | |||||||
| 1153 | OMIA:001952-9940 | sheep | Altay Fat-Rumped, China (Sheep) Awassi (Sheep) Kazakh Fat-Rumped (Sheep) | Microtia | HMX1 | duplication | Naturally occurring variant | yes | Oar_v4.0 | 6 | g.114173249_114173324dup | He et al. (2020) identified a 76 bp duplication in an evolutionary conserved region downstream of HMX1 (duplication of 76bp segment 6:126893417-126893492) in Altay sheep, the variant was later identified in other breeds and validated (PMID:32481741; PMID:38395239). | 2020 | 31691317 | |||||
| 1728 | OMIA:002878-9823 | pig | Diabetes mellitus, HNF1A-related | HNF1A | insertion, gross (>20) | Transgenesis via somatic cell nuclear transfer (SCNT) | yes | integration of human HNF1⍺ gene with a P291fsinC mutation | 2009 | 19357985 | |||||||||
| 624 | OMIA:001952-9823 | pig | Microtia | HOXA1 | delins, small (<=20) | Naturally occurring variant | yes | Sscrofa11.1 | 18 | g.45478109delinsTC | c.451delinsTC | p.(L151fs) | 2015 | 26035869 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: XM_003134844.5 by Stephanie Shields (27/05/2020) | ||||
| 751 | OMIA:000668-9031 | chicken | Huiyang Bearded, China (Chicken) | Muffs and beard | HOXB8 | complex rearrangement | Naturally occurring variant | no | 27 | "The Mb allele differs from the wild-type mb allele by three duplications, one in tandem and two that are translocated to that of the tandem repeat around 1.70 Mb on GGA27 | 2016 | 27253709 | |||||||
| 691 | OMIA:000081-9796 | horse | Arab (Horse) | Atlanto occipital fusion | HOXD3 | deletion, gross (>20) | Naturally occurring variant | yes | 18 | "a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3." | 2017 | 28111759 | |||||||
| 789 | OMIA:002116-69293 | three-spined stickleback | Coat colour, albinism, oculocutaneous, HPS5-related | Hps5 | casper | insertion, small (<=20) | Naturally occurring variant | yes | "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" | 2017 | 28739598 | ||||||||
| 1423 | OMIA:002116-9685 | domestic cat | Donskoy (Cat) | Pink-eye | HPS5 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.76211236C>T | c.2571-1G>A | XM_006937131.3 | 2020 | 32558164 | ||||
| 1222 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^TN | duplication | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36040784_36040785dup | c.1255_1256dup | p.(Q420Sfs*100) | ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as c.1255_1256dupGT | 2020 | 32580512 | ||
| 1224 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^Fr | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36040933delinsCAG | c.1404+2delinsCAG | ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as c.1404+2delTinsCAG; changed to HGVS nomenclature in this table; "This variant should extend and change the reading frame, including an additional 24 amino acids in the aberrant protein before a stop codon is recognized. Alternatively, a cryptic splice site may be used from within intron 4." (Buckley et al., 2020) | 2020 | 32580512 | |||
| 1225 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^TX | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36045776G>A | c.2112G>A | ENSFCAT00000012982.5; ENSFCAP00000012037.2; "This variant likely disrupts the splice donor allowing read-through for an additional 12 amino acids until a stop codon is encountered .... Alternatively, a cryptic splice site may be used from within intron 8." (Buckley et al., 2020) | rs5334475128 | 2020 | 32580512 | ||
| 1226 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^NC | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36047047C>T | c.2243C>T | p.(R748*) | rs5334475155 | 2020 | 32580512 | ||
| 1227 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^Ca | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36047518C>T | c.2593C>T | p.(Q865*) | ENSFCAT00000012982.5; ENSFCAP00000012037.2 | rs5334475120 | 2020 | 32580512 | |
| 1223 | OMIA:002229-9685 | domestic cat | Lykoi (Cat) | Hypotrichia and Roaning | HR | hr^VA | insertion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.36051555_36051556insGACA | c.3389_3390insGACA | p.(S1130Rfs*29) | ENSFCAT00000012982.5; ENSFCAP00000012037.2; published as g.36051555insGACA and c.3389insGACA; changed to HGVS nomenclature in this table | 2020 | 32580512 | ||
| 331 | OMIA:001348-9544 | Rhesus monkey | Atrichia with papular lesions | HR | nonsense (stop-gain) | Naturally occurring variant | yes | MMUL_1 | 8 | g.22046679C>T | c.1831C>T | p.(R611*) | 2002 | 11831740 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 319 | OMIA:002229-9940 | sheep | Valle del Belice, Italy (Sheep) | Hypotrichosis | HR | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 2 | g.45703202C>T | c.1312C>T | p.(Q438*) | Oar_v3.1 position is g.43224867C>T | rs423413166 | 2003 | 12927087 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |
| 1095 | OMIA:002777-9615 | dog | Dachshund (Dog) | Disorder of sexual development, HSD17B3-related | HSD17B3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.70554301_70554302del | c.159_160del | p.(T54Wfs*13) | XM_003638870.2; XP_003638918.1; deletion CA | 2019 | 31476086 | |||
| 456 | OMIA:001758-9615 | dog | Australian Shepherd (Dog) | Cataract, early onset | HSF4 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.82198114del | c.971del | p.(P324Hfs*87) | NM_001048121.1; NP_001041586.1; published as g.85286582delC | 2006 | 16939467 | |||
| 568 | OMIA:001758-9615 | dog | Boston Terrier (Dog) Staffordshire Bull Terrier (Dog) | Cataract, early onset | HSF4 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.82198114_82198115insG | c.971_972insC | p.(L325Tfs*28) | NM_001048121.1; NP_001041586.1; published as g.85286582_85286583insC | 2006 | 16939467 | |||
| 919 | OMIA:001319-9913 | taurine cattle | Holstein Friesian (Cattle) | Myopathy of the diaphragmatic muscles | HSPA1A | deletion, gross (>20) | Naturally occurring variant | yes | 23 | Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex | 2003 | 12755819 | |||||||
| 204 | OMIA:001817-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Perinatal weak calf syndrome | IARS | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 8 | NC_037335.1:g.83909754C>G | NM_001101069.2:c.235G>C | NP_001094539.1:p.(V79L) | rs5334475110 | 2013 | 23700453 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1604 | OMIA:000706-9615 | dog | Nederlandse Kooikerhondje (Dog) | Necrotising myelopathy | IBA57 | missense | Naturally occurring variant | yes | CanFam3.1 | 14 | g.801179G>A | c.439C>T | p.(R147W) | XM_038686047.1; XP_038541975.1 | 2023 | 37588046 | |||
| 1237 | OMIA:000664-9615 | dog | Golden Retriever (Dog) | Mucopolysaccharidosis I | IDUA | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91523238_91523524del | c.1400-76_1521+89del | p.(G467_E507del) | NM_001313883.1; NP_001300812.1 | 2020 | 32785987 | |||
| 911 | OMIA:000664-9615 | dog | Plott Hound (Dog) | Mucopolysaccharidosis I | IDUA | splicing | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91534420C>T | c.155+1G>A | NM_001313883.1 | rs1152388407 | 1992 | 1339393 | |||
| 1190 | OMIA:000664-9615 | dog | Boston Terrier (Dog) | Mucopolysaccharidosis I | IDUA | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91534556_91534557insGGGGGCCG | c.19_20insCGGCCCCC | p.(R7Pfs) | NM_001313883.1; NP_001300812.1 | 2020 | 32300136 | |||
| 500 | OMIA:000664-9685 | domestic cat | Mucopolysaccharidosis I | IDUA | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.207800586_207800588del | c.1042_1044del | p.(D348del) | NM_001305032.1; NP_001291961.1; a 3 bp deletion in the IDUA gene; HGVS 3'-rule applied to variant coordinates in this table | 1999 | 10356309 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 1301 | OMIA:002320-9615 | dog | Lapponian Herder (Dog) | Progressive retinal atrophy | IFT122 | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.5648046C>T | c.3176G>A | p.(R1059H) | Protein and CDS positions based on XP_533734.2 and XM_533734.6 | 2021 | 33606121 | |||
| 1396 | OMIA:001823-9913 | taurine cattle | Holstein Friesian (Cattle) | Haplotype with homozygous deficiency-HH2 | IFT80 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 1 | NC_037328.1:g.107172616del | NM_001098959.1:c.1155del | NP_001092429.1:p.(L385Ffs*3) | published as g.107172616delT, ENSBTAT00000044761.4:c.1140del ENSBTAP00000042227.4:p.Leu381PhefsTer3, c. and p. coordinates updated to NCBI transcripts [29/08/2024] | rs523422030 | 2021 | 34873723 | ||
| 687 | OMIA:000006-9031 | chicken | Chinese Xingyi bantam, China (Chicken) | Achondroplasia, creeper | IHH | deletion, gross (>20) | Naturally occurring variant | yes | Gallus_gallus-4.0 | 7 | g.21798705_21810600del | "a 11,896bp large deletion region (chr7: 21,798,705-21,810,600) covering the entire Indian hedgehog (IHH) gene" | 2016 | 27439785 | |||||
| 337 | OMIA:001899-9796 | horse | Quarter Horse (Horse) Warmblood (Horse) | Incontinentia pigmenti | IKBKG | nonsense (stop-gain) | Naturally occurring variant | yes | EquCab3.0 | X | NC_009175.3:g.126898409C>T | NM_001284533.1:c.184C>T | NP_001271462.1:p.(R62*) | Previously listed as as c.202C>T and p.(R68*), updated in this table to reflect NM_001284533.1 transcript | rs3433281055 | 2013 | 24324710 | Breed information updated based on PMID: 38600096 | |
| 1202 | OMIA:002271-9913 | taurine cattle | Holstein Friesian (Cattle) | Immunodeficiency, IL17Ra-related | IL17RA | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.108813252del | XM_015460734.2:c.180del | XP_015316220.2:p.(C61Afs*62) | published as g.108813251delC, g. coordinates in this table updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | rs5334474974 | 2020 | 32448141 | ||
| 584 | OMIA:000899-9615 | dog | Cardigan Welsh Corgi (Dog) | Severe combined immunodeficiency disease, X-linked | IL2RG | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.55483461_55483462insG | c.583_584insC | p.(R195Pfs*5) | NM_001003201.1; NP_001003201.1; "a single nucleotide insertion causing a frameshift". The variant could also be described as a duplication of a cytosine (c.583dup). | 1995 | 8571541 | |||
| 476 | OMIA:000899-9615 | dog | Basset Hound (Dog) | Severe combined immunodeficiency disease, X-linked | IL2RG | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.55484657_55484660del | c.30_33del | p.(L11Yfs) | NM_001003201.1; NP_001003201.1; c.30_33delCCTC | 1994 | 7829104 | |||
| 1622 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | IL2RG | nonsense (stop-gain) | Base-editing | yes | Macaca_fascicularis_5.0 | X | g.68110639G>A | c.391C>T | p.(Q131*) | XM_005593892.2; XP_005593949.1 | 2023 | 37661226 | ||||
| 1253 | OMIA:002289-9615 | dog | Lhasa Apso (Dog) | Progressive retinal atrophy 4 (PRA4) | IMPG2 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 33 | " LINE-1 insertion was identified within the critical region in this PRA-affected LA, situated within 200 bp upstream of the interphotoreceptor matrix proteoglycan 2 (IMPG2) gene within the following coordinates: CANFA33: 7,785,475-7,785,491" (Hitti-Malin et al., 2020) | 2020 | 32894063 | ||||||
| 1034 | OMIA:002173-9615 | dog | Norwich Terrier (Dog) | Diffuse cystic renal dysplasia and hepatic fibrosis | INPP5E | splicing | Naturally occurring variant | yes | CanFam3.1 | 9 | g.49069064G>A | c.1572+5G>A | Dillard et al. (2018): "the identified variant introduces a novel splice site in INPP5E causing a frameshift and formation of a premature stop codon." | 2018 | 30235266 | ||||
| 962 | OMIA:001675-61379 | black-footed cat | Cone-rod dystrophy 2 | IQCB1 | deletion, small (<=20) | Naturally occurring variant | yes | c.1282delCT | p.(L428*) | 2017 | 28322220 | ||||||||
| 606 | OMIA:001675-9615 | dog | American Pit Bull Terrier (Dog) | Cone-rod dystrophy 2 | IQCB1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 33 | g.25078909_25078910insC | c.952_53insC | p.(S319Ifs*12) | 2013 | 24045995 | ||||
| 1711 | OMIA:000284-10036 | golden hamster | Diabetes mellitus, type 2 | Irs2 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | yes | 2653-bp deletion in exon 1 | 2024 | 39134590 | |||||||||
| 336 | OMIA:001886-9615 | dog | Chinook (Dog) Karelian Bear Dog (Dog) Norwegian Elkhound (Dog) | Chondrodysplasia, disproportionate short-limbed | ITGA10 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 17 | g.58703935G>A | c.2083C>T | p.(R695*) | XM_845262.4; XP_850355.1, additional breed inforamtion based on PMID:27525650 | 2013 | 24086591 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1569 | OMIA:001000-9615 | dog | Golden Retriever (Dog) | Thrombastenia | ITGA2B | deletion, small (<=20) | Naturally occurring variant | yes | 9 | Published in a conference proceeding as (1924delC) | 2017 | Reference not in PubMed; see OMIA 001000-9615 for reference details | |||||||
| 80 | OMIA:001000-9615 | dog | Otterhound (Dog) | Thrombasthenia | ITGA2B | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.19054488G>C | c.1192G>C | p.(D398H) | NM_001003163.2; NP_001003163.1; published as c.1193G>C / c.1100G>C; substitution of histidine for aspartic acid at position 398 (367). Coordinates in the table have been updated to a recent reference genome and or transcripts. | 2001 | 11703027 | Breed was incorrectly listed as Scottish Deerhound. Changed to Otterhound [19/5/2023] | ||
| 1568 | OMIA:001000-9615 | dog | Mixed Breed (Dog) | Thrombasthenia | ITGA2B | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.19057141C>T | 1357C>T | p.(R453*) | NM_001003163.2; NP_001003163.1; published as (C1264T) and (R422X), coordinates in this table have been updated to a recent reference genome | 2016 | 26764135 | |||
| 369 | OMIA:001000-9615 | dog | Great Pyrenees (Dog) | Thrombasthenia | ITGA2B | splicing | Naturally occurring variant | yes | CanFam3.1 | 9 | g.19057144_19057157dup | c.1360_1373dup | NM_001003163.2; NP_001003163.1; experimentally confirmed splice defect; a 14-base duplication in exon 13 and defective splicing of intron 13 | 2000 | 11105947 | ||||
| 164 | OMIA:001000-9796 | horse | Quarter Horse (Horse) Thoroughbred (Horse) | Thrombasthenia | ITGA2B | missense | Naturally occurring variant | yes | EquCab3.0 | 11 | NC_009154.3:g.19245752G>C | NM_001081793.1:c.215G>C | NP_001075262.1:p.(R72P) | NM_001081793.1; NP_001075262.1; originally published as p.(R41P) and listed by Leite et al. (2019) as c.122G>C; coordinates in this table have been updated to a recent reference genome and / or transcript | 2006 | 16407493 | |||
| 512 | OMIA:001000-9796 | horse | Peruvian Paso (Horse) Quarter Horse (Horse) | Thrombasthenia | ITGA2B | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 11 | NC_009154.3:g.19247983_19247992del | g.19247983_19247992delCAGGTGAGGA | 2007 | 17338169 | g. coordinates obtained from Dahlgren et al. (2020) | ||||
| 1245 | OMIA:001000-9685 | domestic cat | Domestic Shorthair | Glanzmann's thrombasthenia | ITGA2B | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.44416063del | c.1986delC | p.(P662fs) | ENSFCAT00000003056.6:c.1986delC; p.Pro662fs (Li et al., 2020) | rs5334475153 | 2020 | 32935881 | ||
| 1185 | OMIA:002261-9913 | taurine cattle | Holstein (black and white) (Cattle) | de novo mutation in an AI sire | ITGA3 | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.36586185G>A | p.(T252M) | Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. | rs5334475090 | 2017 | 28904385 | |||
| 1577 | OMIA:002718-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctional, ITGA6-related | ITGA6 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.24112740C>A | NM_001109981.1:c.2160+1G>T | NP_001103451.1:p.(I657Mfs) | NM_001109981.1 | 2023 | 37308849 | |||
| 197 | OMIA:000595-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Holstein Friesian (Cattle) Jersey (Cattle) Simmental (Cattle) | Leukocyte adhesion deficiency, type I | ITGB2 | BLAD | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 1 | NC_037328.1:g.144770078T>C | NM_175781.1:c.383A>G | NP_786975.1:p.(D128G) | Variant initially identified in Holstein Friesian cattle and later reported in additional breeds. | rs445709131 | 1992 | 1384046 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. |
| 53 | OMIA:000595-9615 | dog | Irish Red and White Setter (Dog) Irish Setter (Dog) | Leukocyte adhesion deficiency, type I | ITGB2 | missense | Naturally occurring variant | yes | CanFam3.1 | 31 | g.38537012C>G | c.107G>C | p.(C36S) | ROS_Cfam_1.0: g.38142116C>G ENSCAFT00845038113.1:c.107G>C ENSCAFP00845029856.1:p.Cys36Ser | rs1152388503 | 1999 | 10512685 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 775 | OMIA:000595-9685 | domestic cat | Leukocyte adhesion deficiency, type I | ITGB2 | ITGB-2 missing exon 2 | deletion, gross (>20) | Naturally occurring variant | yes | Felis_catus_9.0 | C2 | g.1772101_1772124del | c.46_58+11del | XM_011285804.3; Bauer et al. (2017) "24 bp deletion at the exon 2 to intron 2 boundary (c.46_58 + 11del), predicting premature translational termination due to abnormal splicing of exon 1 to exon 3 or 4." | 2017 | 28750142 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 684 | OMIA:001948-9913 | taurine cattle | Charolais (Cattle) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, gross (>20) | Naturally occurring variant | yes | 19 | "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene | 2015 | 25890340 | |||||||
| 1272 | OMIA:001948-9940 | sheep | Mouton vendéen, France (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 11 | g.7412626C>T | c.2653C>T | p.(R885*) | c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 | 2020 | 33225458 | |||
| 543 | OMIA:001948-9940 | sheep | Spanish Churro (Sheep) | Epidermolysis bullosa, junctionalis, ITGB4 | ITGB4 | deletion, small (<=20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 11 | NC_040262.1:g.7425460_7425463del | XM_027974087.1:c.4412_4415del | Oar_v3.1: g.54849767_54849770del | 2015 | 25955497 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1716 | OMIA:002872-9913 | taurine cattle | Holstein Friesian (Cattle) | Bovine lymphocyte intestinal retention defect | ITGB7 | BLIRD | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.26807079G>A | NP_001098835.1:904G>A | NP_001098835.1:p.(G302S) | Published as ENSBTAT00000025279.5:p.(G375S) | rs444441523 | 2023 | Reference not in PubMed; see OMIA 002872-9913 for reference details | |
| 754 | OMIA:002097-9615 | dog | Italian Spinone (Dog) | Ataxia, spinocerebellar | ITPR1 | complex rearrangement | Naturally occurring variant | yes | 20 | Forman et al. (2015) identified an expanded GAA-repeat in intron 35 of the ITPR1 gene in affected dogs. The wildtype sequence contains 8 GAA repeats. The expanded disease-associated alleles carry an estimated 318-651 GAA repeats. | 2015 | 25354648 | |||||||
| 739 | OMIA:000809-9615 | dog | Mixed Breed (Dog) | Polycythemia | JAK2 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.93416506_93416510delinsTTCCT | c.1849_1853delinsTTCCT | p.(V617_C618delinsFL) | XM_022421838.1; XP_022277546.1; published as a three-base change in codons 617 and 618 of JAK2 giving rise to V617F and C618L, SOMATIC MUTATION/MOSAICISM | 2011 | 21320566 | |||
| 1390 | OMIA:002483-9913 | taurine cattle | Neuromuscular channelopathy | KCNG1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 13 | NC_037340.1:g.78918850C>A | NM_001205719.1:c.1248G>T | NP_001192648.1:p.(W416C) | NM_001205719.1; NP_001192648.1 | rs3423356335 | 2021 | 34828398 | |||
| 1154 | OMIA:002240-9615 | dog | Norwegian Buhund (Dog) | Ataxia, cerebellar, KCNIP4-related | KCNIP4 | missense | Naturally occurring variant | yes | CanFam3.1 | 3 | g.88890674T>C | c.436T>C | p.(T146R) | XM_005618660.3; XP_005618717.1 | 2020 | 31999692 | |||
| 945 | OMIA:002089-9615 | dog | Dachshund (Dog) Jack Russell Terrier (Dog) Parson Russell Terrier (Dog) Smooth Fox Terrier (Dog) | Ataxia, cerebellar, KCNJ10-related | KCNJ10 | missense | Naturally occurring variant | yes | CanFam3.1 | 38 | g.22140300C>G | c.627C>G | p.(I209M) | XM_545752.6; XP_545752.3; reference for Dachshund is PMID:37905444 | rs1152388456 | 2014 | 24708069 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | |
| 947 | OMIA:002089-9615 | dog | Belgian Shepherd Dog, Malinois (Dog) | Spongy degeneration with cerebellar ataxia 1 (SDCA1) | KCNJ10 | missense | Naturally occurring variant | yes | CanFam3.1 | 38 | g.22140659T>C | c.986T>C | p.(L329P) | XM_545752.6; XP_545752.3 | 2017 | 27966545 28007838 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 612 | OMIA:002089-9615 | dog | Jack Russell Terrier (Dog) | Ataxia, cerebellar, KCNJ10-related | KCNJ10 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 38 | g.22141027insC | c.*214_*215insC | XM_005640901.1; Gast et al. (2016) "Bioinformatic analysis using RegRNA indicated the KCNJ10:g.22141027insC affecting regulation of gene expression via a regulatory RNA motif or miRNA target site." | rs1152388457 | 2016 | 27724896 | |||
| 1596 | OMIA:002332-9615 | dog | English Springer Spaniel (Dog) | Long QT syndrome | KCNQ1 | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.46604412C>A | c.770C>A | p.(T257K) | XM_022405121.1; XP_022260829.1; published as "Genbank KF439050, KCNQ1_T377K" - coordinates in this table are updated to a recent reference genome. | 2015 | 25779927 | |||
| 196 | OMIA:001722-9913 | taurine cattle | Marchigiana (Cattle) Romagnola (Cattle) | Lethal multi-organ developmental dysplasia | KDM2B | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 17 | NC_037344.1:g.53761149G>A | XM_005217983.4:c.2503G>A | XP_005218040.1:p.(D835N) | rs5334475109 | 2012 | 23029151 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 207 | OMIA:002390-9913 | taurine cattle | Brown Swiss (Cattle) | Spinal muscular atrophy | KDSR | missense | Naturally occurring variant | yes | ARS-UCD1.2 | 24 | g.61620302C>T | c.562G>A | p.(A188T) | rs5334475102 | 2007 | 17420465 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 604 | OMIA:000979-9031 | chicken | Talpid-3 | KIAA0586 | insertion, small (<=20) | Naturally occurring variant | yes | 5 | insT | 2006 | 16702409 | ||||||||
| 1005 | OMIA:000527-9913 | taurine cattle | Angus (Cattle) Charolais (Cattle) Uckermärker, Germany (Cattle) | Progressive ataxia | KIF1C | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.26407668C>T | NM_001205802.2:c.608G>A | NP_001192731.2:p.(R203Q); p.(R203_T204delinsQ*) | ENSBTAT00000081136.1:c.608G>A ENSBTAP00000062635.1:p.Arg203Gln Duchesne et al. (2018): "This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." The variant was initially reported in Charolais cattle and later reported in additional breeds (see PMIDs 38338009 and 32281115). | rs800926237 | 2018 | 30067756 | ||
| 1231 | OMIA:002283-9823 | pig | Large White (Pig) | Arthrogryposis multiplex congenita, KIF21A-related | KIF21A | insertion, gross (>20) | Naturally occurring variant | yes | Sscrofa11.1 | 5 | g.70964237_70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT | p.(V41_F42ins*) | (NC_010447.5:g70964237_ g70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT; p.Val41_Phe42insTer) (Fang et al., 2020) | rs5334475173 | 2020 | 32686171 | |||
| 1191 | OMIA:002267-9685 | domestic cat | Bengal (Cat) Highlander (Cat) Highlander Shorthair (Cat) Savannah (Cat) | Progressive retinal atrophy | KIF3B | missense | Naturally occurring variant | yes | Felis_catus_9.0 | A3 | g.26784019C>T | c.1000G>A | p.(A334T) | ENSFCAT00000022266; c.1000G>A (p.Ala334Thr) | rs5334475117 | 2020 | 32386558 | The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770). Additional breeds reported based on PMID:35709088. | |
| 1440 | OMIA:001836-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Abortion due to haplotype HH13 | KIR2DS1 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 18 | NC_037345.1:g.62758881G>A | NM_001097567.1:c.475C>T | NP_001091036.1:p.(Q159*) | NM_001097567.1; NP_001091036.1 | rs437566778 | 2022 | 35361830 | ||
| 748 | OMIA:000426-9913 | taurine cattle | Fjällnära boskap, Sweden (Cattle) Pohjoissuomenkarja, Finland (Cattle) | Gonadal hypoplasia | KIT | cs(29) | complex rearrangement | Naturally occurring variant | yes | 6 | "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" | 2013 | 24086604 | ||||||
| 464 | OMIA:001516-9615 | dog | Gastrointestinal stromal tumor | KIT | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.47178531_47178536del | c.1664_1669del | NM_001003181.1; deletion of AGTGGA; SOMATIC MUTATION | 2010 | 20950418 | |||||
| 465 | OMIA:001516-9615 | dog | Gastrointestinal stromal tumor | KIT | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.47178534_47178539del | c.1667_1672del | NM_001003181.1; deletion of GGAAGG; SOMATIC MUTATION | 2010 | 20950418 | |||||
| 1331 | OMIA:000209-9796 | horse | American Paint (Horse) American Trotter (Horse) Belgian Draft (Horse) Icelandic Horse (Horse) Quarter Horse (Horse) Thoroughbred (Horse) Welsh Pony (Horse) | White spotting | KIT | W32 | missense | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79538738C>T | NM_001163866.1:c.2878G>A | NP_001157338.1:p.(A960T) | cDNA position previously listed as c.3214G>A; p.(A1072T) based on transcript ENSECAT00000014037.3 [16/04/2024] | rs1141982296 | 2021 | 34223905 | Breed information updated based on PMID: 38600096 |
| 882 | OMIA:000209-9796 | horse | Süddeutsches Kaltblut, Germany (Horse) | Coat colour, dominant white | KIT | W11 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79540429C>T | NM_001163866.1:c.2684+1G>A | rs5334475183 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 939 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W26 | deletion, small (<=20) | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79540694del | NM_001163866.1:c.2536del | NP_001157338.1:p.(S846Vfs*15) | NM_001163866.1; NP_001157338.1; published as c.2536delA | rs3101685403 | 2018 | 29333746 | |
| 873 | OMIA:000209-9796 | horse | Oldenburg (Horse) | Coat colour, dominant white | KIT | W16 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79540741T>A | NM_001163866.1:c.2489A>T | NP_001157338.1:p.(K830I) | rs5334475213 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 883 | OMIA:000209-9796 | horse | Miniature Horse (Horse) Quarter Horse (Horse) Shetland Pony (Horse) | Coat colour, dominant white | KIT | W13 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79544066C>G | NM_001163866.1:c.2472+5G>C | NM_001163866.1 | rs3102773259 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 889 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W14 | deletion, gross (>20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79544098_79544151del | NM_001163866.1:c.2392_2445del | NP_001157338.1:p.(H798_N815del) | NM_001163866.1; NP_001157338.1 | 2011 | 21554354 | genomic coordinates updated from g.79544151_79544204del to g.79544098_79544151del in EquCab3.0 [17/09/2023] | |
| 891 | OMIA:000209-9796 | horse | Icelandic Horse (Horse) | White spotting | KIT | W21 | deletion, small (<=20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79544174del | NM_001163866.1:c.2369delC | NP_001157338.1:p.(A790Efs*20) | rs5334475210 | 2015 | 26059442 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 885 | OMIA:000209-9796 | horse | Appaloosa (Horse) Haflinger (Horse) Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) | Coat colour, dominant white | KIT | sabino 1 (SB1) | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79544206A>T | "SNP AX-103727726 (ECA3:77735520; SB1, SNP KI16+1037A)" (Druml et al., 2018) | rs5334475211 | 2005 | 16284805 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 893 | OMIA:000209-9796 | horse | Trottatore Italiano, Italy (Horse) | Coat colour, dominant white | KIT | W24 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79545245C>T | NM_001163866.1:c.2349+1G>A | rs3443588955 | 2017 | 28856698 | |||
| 1462 | OMIA:000209-9796 | horse | American Trotter (Horse) | Dominant white spotting | KIT | W33 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79545248T>A | NM_001163866.1:c.2347A>T | NP_001157338.1:p.(N783Y) | NC_009146.3; previously listed as ENSECAT00000014037.3: c.2783A>T / p.(N895Y) [16/04/2024] | 2022 | 35641888 | ||
| 881 | OMIA:000209-9796 | horse | Icelandic Horse (Horse) | Coat colour, dominant white | KIT | W8 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79545374C>T | NM_001163866.1:c.2222-1G>A | NM_001163866.1 | rs3434854925 | 2009 | 19456317 | ||
| 886 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W5 | deletion, small (<=20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79545900del | NM_001163866.1:c.2193delG | NP_001157338.1:p.(T732Qfs*9) | rs5334475194 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 878 | OMIA:000209-9796 | horse | Freiberger (Horse) | Coat colour, dominant white | KIT | W1 | nonsense (stop-gain) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79545942G>C | NM_001163866.1:c.2151C>G | NP_001157338.1:p.(Y717*) | rs5334475201 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 877 | OMIA:000209-9796 | horse | American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Belgian Draft (Horse) Clydesdale (Horse) Freiberger (Horse) German Riding Pony (Horse) Morgan (Horse) Noric (Horse) Oldenburg (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Tori hobune, Estonia (Horse) Traditional Gypsy Cob, United Kingdom of Great Britain and Northern Ireland (Horse) Warmblood (Horse) Welsh Pony (Horse) | Coat colour, dominant white | KIT | W20 | missense | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79548220T>C | NM_001163866.1:c.2045G>A | NP_001157338.1:p.(R682H) | ENSECAT00000014037.3:c.2381A>G ENSECAP00000011188.2:p.His794Arg; reference genome corresponds to g.79548220T and the transcript NM_001163866.1 represents g.79548220C | rs1143160924 | 2013 | 23659293 | Variant coordinates initially gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124. Breed information updated based on PMID: 38600096 |
| 875 | OMIA:000209-9796 | horse | Japanese Draft, Japan (Horse) | Coat colour, dominant white | KIT | W17b | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79548244A>G | NM_001163866.1:c.2021T>C | NP_001157338.1:p.(L674P) | rs5334475224 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 1261 | OMIA:000209-9796 | horse | Berber, Germany (Horse) | Extensive coat white patterning | KIT | W30 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79548244A>T | NM_001163866.1:c.2021T>A | NP_001157338.1:p.(L674H) | published as g.79548244, c.2020T>A; p.L674H (Martin et al., 2020) - changed to NM_001163866.1:c.2021T>A [16/042024] | rs5334475224 | 2020 | 33111383 | |
| 874 | OMIA:000209-9796 | horse | Japanese Draft, Japan (Horse) | Coat colour, dominant white | KIT | w17a | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79548265T>A | NM_001163866.1:c.2000A>T | NP_001157338.1:p.(E667D) | previously listed as c.2001A>T [16/04/2024] | rs5334475222 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 |
| 890 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | White spotting | KIT | W22 | deletion, gross (>20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79548925_79550822del | 1898bp deletion | 2017 | 28444912 | ||||
| 868 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W2 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79549540C>T | NM_001163866.1:c.1960G>A | NP_001157338.1:p.(G654R) | rs5334475198 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 869 | OMIA:000209-9796 | horse | Camarillo White Horse, United States of America (Horse) | Coat colour, dominant white | KIT | W4 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79549781G>A | NM_001163866.1:c.1805C>T | NP_001157338.1:p.(A602V) | Previously incorrectly listed as g.79549780G>A [16/04/2024] | 2007 | 17997609 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 871 | OMIA:000209-9796 | horse | Holsteiner (Horse) | Coat colour, dominant white | KIT | W9 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79549797C>T | NM_001163866.1:c.1789G>A | NP_001157338.1:p.(G597R) | rs5334475209 | 2009 | 19456317 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 872 | OMIA:000209-9796 | horse | Arab (Horse) | Coat colour, dominant white | KIT | W15 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79550351A>G | NM_001163866.1:c.1597T>C | NP_001157338.1:p.(C533R) | rs5334475202 | 2011 | 21554354 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 940 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W27 | missense | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79551937A>C | NM_001163866.1:c.1473T>G | NP_001157338.1:p.(C491W) | NM_001163866.1; NP_001157338.1 | rs3110307743 | 2018 | 29333746 | |
| 884 | OMIA:000209-9796 | horse | CH-Warmblut, Switzerland (Horse) | Coat colour, dominant white | KIT | W18 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79553751C>T | NM_001163866.1:c.1346+1G>A | rs5334475221 | 2013 | 23659293 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 876 | OMIA:000209-9796 | horse | Arab (Horse) | Coat colour, dominant white | KIT | W19 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79553776T>C | NM_001163866.1:c.1322A>G | NP_001157338.1:p.(Y441C) | rs5334475217 | 2013 | 23659293 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 1476 | OMIA:000209-9796 | horse | American Paint (Horse) American Trotter (Horse) Appaloosa (Horse) Arab (Horse) Mangalarga (Horse) Morgan (Horse) Mustang (Horse) Quarter Horse (Horse) Rocky Mountain, United States of America (Bighorn sheep) Warmblood (Horse) | Increased white spotting | KIT | W34 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79566881T>C | NM_001163866.1:c.1171A>G | NP_001157338.1:p.(T391A) | Previously listed as ENSECAT00000014037.3:c.1495A>G; ENSECAP00000011188.2:p.(T499A) [16/04/2024] | rs1140732842 | 2022 | 35953947 | Breed information updated based on PMID: 38600096 |
| 887 | OMIA:000209-9796 | horse | Quarter Horse (Horse) | Coat colour, dominant white | KIT | W10 | deletion, small (<=20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79566923_79566926del | NM_001163866.1:c.1126_1129del | NP_001157338.1:p.(E376Ffs*3) | NM_001163866.1; NP_001157338.1; published as c.1126_1129delGAAC | 2009 | 19456317 | Genomic coordinates updated in this table from g.79566926_79566929del in EquCab3.0 after feedback from Micaela Vierra identified that these coordinates were incorrect [27/09/2023]. | |
| 870 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W6 | missense | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79573754C>T | NM_001163866.1:c.856G>A | NP_001157338.1:p.(G286R) | rs5334475167 | 2009 | 19456317 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 892 | OMIA:000209-9796 | horse | Arab (Horse) | White spotting | KIT | W23 | splicing | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79578484C>G | NM_001163866.1:c.756+1G>C | rs1095048836 | 2017 | 28378922 | |||
| 879 | OMIA:000209-9796 | horse | Arab (Horse) | Coat colour, dominant white | KIT | W3 | nonsense (stop-gain) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79578535T>A | NM_001163866.1:c.706A>T | NP_001157338.1:p.(K236*) | rs5334475200 | 2007 | 17997609 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 938 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W25 | missense | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79578573A>G | NM_001163866.1:c.668T>C | NP_001157338.1:p.(L223P) | NM_001163866.1; NP_001157338.1 | rs3103992630 | 2018 | 29333746 | |
| 888 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W12 | deletion, small (<=20) | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79579774_79579778del | NM_001163866.1:c.559_563del | NP_001157338.1:p.(S187Rfs*10) | NM_001163866.1; NP_001157338.1; published as c.559_563delTCTGC | rs5334475188 | 2010 | Reference not in PubMed; see OMIA 000209-9796 for reference details | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 |
| 1091 | OMIA:000209-9796 | horse | German Riding Pony (Horse) | White spotting | KIT | W28 | deletion, gross (>20) | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79579925_79581197del | 2019 | 31463981 | |||||
| 880 | OMIA:000209-9796 | horse | Thoroughbred (Horse) | Coat colour, dominant white | KIT | W7 | splicing | Naturally occurring variant | no | EquCab3.0 | 3 | NC_009146.3:g.79580000C>G | NM_001163866.1:c.338-1G>C | rs5334475216 | 2009 | 19456317 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 1330 | OMIA:000209-9796 | horse | Quarter Horse (Horse) | White spotting | KIT | W31 | insertion, small (<=20) | Naturally occurring variant | unknown | EquCab3.0 | 3 | NC_009146.3:g.79618532_79618533insA | NM_001163866.1:c.30_31insT | NP_001157338.1:p.(L11Sfs*115) | 2021 | 34223905 | |||
| 1505 | OMIA:000449-452646 | American mink | Shadow coat colour | KIT | S^h | missense | Naturally occurring variant | unknown | NNQGG.v01 | NWR01000037.1 | g.6253028G>T | c.2374G>T | p.(D792Y) | 2022 | 35481560 | ||||
| 1248 | OMIA:002287-9823 | pig | Bama Xiang Zhu, China (Pig) | Hypopigmentation (piebald) and deafness | KIT | missense | Naturally occurring variant | yes | Sscrofa11.1 | 8 | g.41485957T>A | c.2418T>A | p.(D806E) | ENU mutagenesis was used to create these pigs, NM_001044525.1; c.2418T>A; NP_001037990.1; p.(D806E) (Xu et al., 2020) | 2020 | 33042408 | |||
| 74 | OMIA:000819-9615 | dog | Shih Tzu (Dog) | Prekallikrein deficiency | KLKB1 | missense | Naturally occurring variant | yes | CanFam3.1 | 16 | g.44501415A>T | c.988T>A | p.(F330I) | 2011 | 20736516 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1495 | OMIA:002425-9615 | dog | Chinese Shar-Pei (Dog) | Ichthyosis, KRT1-related | KRT1 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 27 | g.44229728_44229730del | c.567_569del | p.(N190del) | NM_001003392.1; NP_001003392.1 | 2022 | 36251712 | |||
| 364 | OMIA:001415-9615 | dog | Norfolk Terrier (Dog) | Hyperkeratosis, epidermolytic | KRT10 | splicing | Naturally occurring variant | yes | CanFam3.1 | 9 | g.21866234G>T | c.1125+1G>T | XM_038676544.1; XP_038532472.1; experimentally confirmed splice defect; a single base GT>TT change in the consensus 5'-splice site of intron 5 | 2005 | 16029326 | ||||
| 1579 | OMIA:001415-9615 | dog | Chihuahua (Dog) | Ichthyosis, epidermolytic | KRT10 | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 9 | g.21814695G>A | c.437G>A | p.(R146H) | XM_038547368.1; XP_038403296 | 2023 | 37332248 | |||
| 1229 | OMIA:002281-9685 | domestic cat | Domestic Shorthair | Epidermolysis bullosa, simplex, KRT14-related | KRT14 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | E1 | g.42361726G>A | c.979C>T | p.(Q327*) | XM_003996860.5; XP_003996909.2 | 2020 | 32657488 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. | ||
| 936 | OMIA:002088-9615 | dog | Dogue de Bordeaux (Dog) | Palmoplantar keratoderma, nonepidermolytic, focal 1 | KRT16 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.[21170012_21170013delinsCGGA;21170030del] | c.[1147_1148delinsCGGA;1165del] | p.(V383Rfs) | XM_548101.4; XP_548101.2; published as p.(E392*) - protein coordinates updated to HGVS nomenclature | 2015 | 25521457 | |||
| 1265 | OMIA:002081-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, simplex, KRT5-related` | KRT5 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.27367611_27367613del | NM_001008663.1:c.534_536del | NP_001008663.1:p.(N178del) | Publised as '27367604delCAA' coordinates in the table have been updated to reflect HGVS nomenclature (3' rule) [03/09/2024] | 2020 | 33135329 | |||
| 192 | OMIA:002081-9913 | taurine cattle | Friesian cross (Cattle) Jersey cross | Epidermolysis bullosa | KRT5 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.27371128G>A | NM_001008663.1:c.1432G>A | NP_001008663.1:p.(E478K) | rs5334474982 | 2005 | 15955091 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1480 | OMIA:002081-9615 | dog | Cardigan Welsh Corgi (Dog) | Epidermolysis bullosa, simplex, KRT5-related | KRT5 | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 27 | g.44080887C>T | c.1426G>A | p.(E476K) | NM_001346035.1; NP_001332964.1 | 2022 | 36004757 | |||
| 1697 | OMIA:002081-9615 | dog | German Shepherd Dog (Dog) | Epidermolysis bullosa simplex, localized, KRT5-related | KRT5 | delins, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 27 | NC_049248.1:g.44081942_44091959del | NM_001346035.1:c.988_1005del | NP_001332964.1:p.(N330_D335del) | 2024 | 38742646 | ||||
| 662 | OMIA:000394-9031 | chicken | Frizzle | KRT6A | deletion, gross (>20) | Naturally occurring variant | no | GRCg6a | 33 | g.5251413_5251496del | p.(V311_K333del) | NM_001001313.2; NP_001001313.2; published as a 84bp deletion that covers positions −24 of exon 5 to +59 of intron 5 of KRT6A (called KRT75 in an earlier genome assembly); the deletion activates a cryptic splice site resulting in a 69 bp in-frame deletion in mRNA after splicing and a deletion of 23-amino acids (position 311–333) | 2012 | 22829773 | |||||
| 1337 | OMIA:002114-9913 | taurine cattle | Hereford (Cattle) | Hypotrichosis, KRT71-related | KRT71 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.27331221_27331228del | NM_001075970.1:c.281_288del | NP_001069438.1:p.(M94Nfs*14) | cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively | 2021 | 34356054 | 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del. | ||
| 382 | OMIA:001583-9685 | domestic cat | Sphynx (Cat) | Sphynx hairless | KRT71 | Re^HR | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.81048680C>T | c.816+1G>A | rs5334475135 | 2010 | 20953787 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 735 | OMIA:001371-9615 | dog | Staffordshire Bull Terrier (Dog) | L-2-hydroxyglutaricacidemia | L2HGDH | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 8 | g.26723470_26723472delinsAAG | c.1298_1300delinsCTT | p.(L433_H434delinsPY) | XM_858437.5; XP_863530.2; published as ENSCAFG00000014237; CanFam1.0: (c[1297T→C; 1299c→t]; p[Leu433Pro; His434Tyr]; coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17475916 | |||
| 427 | OMIA:001371-9615 | dog | Yorkshire Terrier (Dog) | L-2-hydroxyglutaricacidemia | L2HGDH | missense | Naturally occurring variant | yes | CanFam3.1 | 8 | g.26760351T>C | c.1A>G | p.(M1?) | XM_858437.5; published as p.(Met1?) | 2012 | 22843824 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1535 | OMIA:001371-9685 | domestic cat | Domestic Shorthair | L-2-hydroxyglutaricacidemia | L2HGDH | nonsense (stop-gain) | Naturally occurring variant | yes | F.catus_Fca126_mat1.0 | B3 | g.97881395G>A | c.397C>T | p.(Q133*) | XM_023255678.2; XP_023111446.2 | 2023 | 36880414 | |||
| 1317 | OMIA:001371-9685 | domestic cat | Domestic Longhair | L-2-hydroxyglutaric aciduria | L2HGDH | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B3 | g.100207200T>C | c.1301A>G | p.(H434R) | XM_023255678.1; XP_023111446.1 | rs5334475154 | 2021 | 34062805 | ||
| 1399 | OMIA:002459-9615 | dog | Staffordshire Bull Terrier (Dog) | Congenital muscular dystrophy | LAMA2 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.67734331_67736575del | c.610-1412_789+653del | XM_003432522.2; | 2022 | 34854126 | ||||
| 1389 | OMIA:002459-9615 | dog | Italian Greyhound (Dog) | Congenital muscular dystrophy | LAMA2 | CMD | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.67883271G>A | c.3285G>A | p.(W1095*) | XM_022419950.1; XP_022275658.1 | 2021 | 34828429 | ||
| 701 | OMIA:001677-9615 | dog | German Pointer (Dog) | Epidermolysis bullosa, junctionalis, LAMA3 | LAMA3 | insertion, gross (>20) | Naturally occurring variant | yes | 7 | "insertion (4818+207ins6.5 kb) of repetitive satellite DNA within intron 35 of the gene (LAMA3)" | 2005 | 15737193 | |||||||
| 909 | OMIA:001677-9913 | taurine cattle | Belgian Blue (Cattle) | Epidermolysis bullosa, junctionalis, LAMA3-related | LAMA3 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 24 | g.32749369G>A | c.7549C>T | p.(R2517*) | rs5334475046 | 2015 | 26370913 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1324 | OMIA:001677-9615 | dog | Australian Cattle Dog X | Epidermolysis bullosa, junctionalis, LAMA3 | LAMA3 | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.64427161T>A | c.8615T>A | p.(D2867V) | cDNA and protein positions based on XM_537297.6 and XP_537297.2, respectively | 2021 | 34250689 | |||
| 658 | OMIA:001677-9796 | horse | American Saddle Horse (Horse) | Epidermolysis bullosa, junctionalis, LAMA3-related | LAMA3 | deletion, gross (>20) | Naturally occurring variant | yes | EquCab3.0 | 8 | NC_009151.3:g.48678342_48684920del | "6589-bp deletion spanning exons 24-27 . . . in the LAMA3 gene in American Saddlebred foals" | 2009 | 19016681 | Coordinates in EquCab3.0 kindly provided by Haley Rutstein, working under the guidance of Professor Ernie Bailey. | ||||
| 1387 | OMIA:002479-9913 | taurine cattle | Romagnola (Cattle) | Hemifacial microsomia | LAMB1 | HFM | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 4 | NC_037331.1:g.49019693G>A | NM_001206519.1:c.2002C>T | NP_001193448.1:p.(R668C) | NM_001206519.1; NP_001193448.1; | 2022 | 34796979 | ||
| 1239 | OMIA:002269-9615 | dog | Australian Shepherd (Dog) | Epidermolysis bullosa, junctionalis, LAMB3-related | LAMB3 | JEB | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.8286613A>G | c.1174T>C | p.(C392R) | NC_006589.3:g.8286613A>G; XM_014115071.2:c.1174T>C; XP_013970546.1:p.Cys392Arg | 2020 | 32906717 | ||
| 682 | OMIA:001678-9913 | taurine cattle | Hereford (Cattle) | Epidermolysis bullosa, junctionalis, LAMC2 | LAMC2 | deletion, gross (>20) | Naturally occurring variant | yes | 16 | "2.4 kb deletion encompassing the first exon of the LAMC2 gene" | 2015 | 25888738 | |||||||
| 599 | OMIA:001678-9796 | horse | Belgian Draft (Horse) Breton, France (Horse) Cavallo Agricolo Italiano da Tiro Pesante Rapido, Italy (Horse) Comtois (Horse) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | insertion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 5 | NC_009148.3:g.17498175dup | NM_001081768.1:c.1372dup | NP_001075237.1:p.(R458Pfs) | NM_001081768.1; NP_001075237.1; published as c.1368insC; coordinates in the table have been updated to HGVS nomenclature (3'-rule) and recent reference genome and / or transcript inforamtion 1,372 Protein position: 458 | 2002 | 12230513 | The genomic position in EquCab3.0 was provided by Margaret Higgins, working under the guidance of Professor Ernie Bailey [April 2022] | ||
| 507 | OMIA:001678-9940 | sheep | German Blackheaded Mutton (Sheep) | Epidermolysis bullosa, junctionalis, LAMC2-related | LAMC2 | deletion, small (<=20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 12 | NC_040263.1:g.68856318_68856319del | NM_001142358.1:c.2746_2747del | NP_001135830.1:p.(A928*) | FM872310 c.2746delCA | 2011 | 21573221 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1168 | OMIA:002251-9615 | dog | Airedale Terrier (Dog) | Surfactant metabolism dysfunction, pulmonary | LAMP3 | missense | Naturally occurring variant | yes | CanFam3.1 | 34 | g.16092728C>T | c.1159G>A | p.(E387K) | 2020 | 32150563 | ||||
| 1371 | OMIA:002460-9615 | dog | Labrador Retriever (Dog) | Muscular dystrophy-dystroglycanopathy | LARGE | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 10 | g.30357716C>T | c.1363C>T | p.(R455*) | 2021 | 34654610 | ||||
| 449 | OMIA:001160-9986 | rabbit | Hyperlipidaemia | LDLR | deletion, small (<=20) | Naturally occurring variant | yes | "an in-frame deletion of 12 nucleotides that eliminates four amino acids from the cysteine-rich ligand binding domain of the LDL receptor" | 1986 | 3010466 | |||||||||
| 1556 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | nonsense (stop-gain) | Naturally occurring variant | yes | 19 | p.(W284*) | G>A in exon 6 in position 914 of the human cDNA resulting in p.(W284*) | 1990 | 2326270 | |||||||
| 1557 | OMIA:000499-9544 | Rhesus monkey | Hypercholesterolaemia | LDLR | missense | Naturally occurring variant | yes | 19 | c.245G>A | p.(C82Y) | 2023 | 37186395 | |||||||
| 987 | OMIA:000499-9823 | pig | Hypercholesterolaemia | LDLR | missense | Naturally occurring variant | yes | Sscrofa11.1 | 2 | g.69841413C>T | c.250C>T | p.(R84C) | rs701604154 | 1998 | 9556295 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcripts: XM_021080444.1, XM_021080449.1, XM_021080452.1, XM_021080457.1 by Stephanie Shields (27/05/2020) | |||
| 269 | OMIA:001596-9615 | dog | Lagotto Romagnolo (Dog) | Epilepsy, benign familial juvenile | LGI2 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.85210442A>T | c.1558A>T | p.(K520*) | XM_022416405.1; XP_022272113.1; published as c.1552A>T & p.(K518*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2011 | 21829378 | |||
| 362 | OMIA:002314-9615 | dog | Czechoslovakian Wolfdog (Dog) German Shepherd Dog (Dog) Saarloos Wolfhond (Dog) Tibetan Terrier (Dog) | Pituitary dwarfism | LHX3 | splicing | Naturally occurring variant | yes | 9 | "a deletion of one of six 7 bp [GTGTTTT] repeats in intron 5 of LHX3" | 2011 | 22132174 | |||||||
| 608 | OMIA:002314-9615 | dog | German Shepherd Dog (Dog) | Pituitary dwarfism | LHX3 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 9 | NC_006591.3:g.49252491_49252493dup | NM_001197187.1:c.545_547dup | NP_001184116.1:p.(N182dup) | published as c.545_547dupACA | 2011 | 22132174 | Genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1415 | OMIA:002516-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency OH4 | LIG3 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.15080336_15080341del | NM_001038107.2:c.2483_2484+4delAGGTG | NP_001033196.1:p.K828fs | NM_001038107.2 | rs5381613636 | 2021 | 34915862 | ||
| 649 | OMIA:002389-9685 | domestic cat | Highlander (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) | Spinal muscular atrophy | LIX1 | deletion, gross (>20) | Naturally occurring variant | yes | Felis_catus_9.0 | A1 | g.161036890_161176706del | published as "a ~140 kb deletion removing exons 4-6 of LIX1 and all except exon 1 of LNPEP" | 2006 | 16899656 | Genomic position in Felis_catus_9.0 is based on information provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | ||||
| 663 | OMIA:001612-9031 | chicken | Silkie (Chicken) | Oligozeugodactyly | LMBR1 | deletion, gross (>20) | Naturally occurring variant | yes | 2 | "a large deletion in LMBR1-intron 5, eliminating most of the limb-specific enhancer conserved sequence." | 2011 | 21509895 | |||||||
| 434 | OMIA:000810-9685 | domestic cat | Polydactyly | LMBR1 | Pd^UK2 | regulatory | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | g.169532842T>A | regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACACAG[A/T]AATGAG | 2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. | ||||
| 432 | OMIA:000810-9685 | domestic cat | Maine Coon (Cat) | Polydactyly | LMBR1 | Pd^Hw | regulatory | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | g.169532844T>C | regulatory variant in the ZPA regulatory sequence (ZRS); published as AGACAC[A/G]GAAATGAG | 2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. | |||
| 433 | OMIA:000810-9685 | domestic cat | Polydactyly | LMBR1 | Pd^UK1 | regulatory | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | g.169533066C>G | regulatory variant in the ZPA regulatory sequence (ZRS); published as CC[G/C]GTG | 2008 | 18156157 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis, Leslie Lyons and Reuben Buckley. | ||||
| 1521 | OMIA:001213-9986 | rabbit | Emery-Dreifuss muscular dystrophy | LMNA | missense | Base-editing | yes | p.(L530P) | 2022 | 35282412 | |||||||||
| 1672 | OMIA:002796-9541 | crab-eating macaque | Cardiomyopathy, dilated, LMNA-related | LMNA | splicing | Base-editing | yes | MFA1912RKSv2 | 1 | NC_052255.1:g.93546791T>C | XM_045371898.1:c.357-2A>G | 2024 | 38559624 | ||||||
| 1401 | OMIA:001213-9823 | pig | Yucatan Miniature, United States of America (Pig) | Hutchinson-Gilford progeria syndrome | LMNA | splicing | Genome-editing (CRISPR-Cas9) | yes | Sscrofa11.1 | 4 | g.93900345G>A | c.1824C>T | 2019 | 30911407 | |||||
| 1638 | OMIA:002796-9615 | dog | Nova Scotia Duck Tolling Retriever (Dog) | Cardiomyopathy, dilated, LMNA-related | LMNA | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 7 | g.41688530del | c.1726del | p.(D576Tfs*124) | NM_001287151.1; NP_001274080 | 2023 | 37925523 | |||
| 393 | OMIA:000344-9031 | chicken | Fayoumi (Chicken) | Epilepsy | LOC430486 | splicing | Naturally occurring variant | yes | 25 | c581-4CC>TG | 2011 | 22046416 | |||||||
| 108 | OMIA:002071-9615 | dog | Labrador Retriever (Dog) | Macular corneal dystrophy | LOC489707 | missense | Naturally occurring variant | yes | CanFam3.1 | 5 | g.75279699C>A | c.814C>A | p.(R272S) | 2016 | 26585178 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1151 | OMIA:001928-9615 | dog | Golden Retriever (Dog) | Myasthenic syndrome, congenital, COLQ-related | LOC608697 | missense | Naturally occurring variant | yes | CanFam3.1 | 23 | g.27175559G>A | c.880G>A | p.(G294R) | 2020 | 31769119 | ||||
| 900 | OMIA:001928-9615 | dog | Labrador Retriever (Dog) | Myasthenic syndrome, congenital | LOC608697 | missense | Naturally occurring variant | yes | CanFam3.1 | 23 | g.27176737T>C | c.1010T>C | p.(I337T) | XM_858278.5; XP_863371.1 | 2014 | 25166616 | Genomic position in CanFam3.1 provided by Robert Kuhn | ||
| 1314 | OMIA:002336-9615 | dog | Rottweiler (Dog) | Nonsyndromic hearing loss | LOXHD1 | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.44806821G>C | c.5747G>C | p.(G1914A) | XM_022421426.1, c.5747G>C; J9PAE4, p.(G1914A) (Hytönen et al., 2021) | 2021 | 33983508 | |||
| 131 | OMIA:001210-9685 | domestic cat | Hyperlipoproteinaemia | LPL | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.38078551C>T | c.1315G>A | p.(G439R) | NM_001042567.1; NP_001036032.1; published as c.1234G>A and p.(G412R); coordinates in the table have been updated to a recent reference genome and / or transcript | 1996 | 8636438 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |||
| 1260 | OMIA:001486-9615 | dog | Beagle (Dog) | Night blindness, congenital stationary, LRIT3-related | LRIT3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 32 | g.30038863del | c.763del | p.(K245Nfs*5) | c.763delG | 2019 | 31578364 | |||
| 627 | OMIA:000963-9913 | taurine cattle | Holstein Friesian (Cattle) | Syndactyly (mule foot) | LRP4 | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 15 | g.76800972_76800973delinsAT | c.4863_4864delinsAT | p.(N1621_G1622delinsKC) | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | 2006 | 16859890 | |||
| 378 | OMIA:000963-9913 | taurine cattle | Angus (Cattle) | Syndactyly (mule foot) | LRP4 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 15 | NC_037342.1:g.76792588C>T | NM_001077843.1:c.5385+1G>A | "a G to A transition at the first nucleotide in the splice donor site of intron 37" | rs5334475003 | 2006 | 16963222 | Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 769 | OMIA:000963-9913 | taurine cattle | Simmental (Cattle) | Syndactyly (mule foot) | LRP4 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 15 | NC_037342.1:g.76807508C>T | NM_001077843.1:c.3595G>A | NP_001071311.1:p.(G1199S) | rs3423411024 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 768 | OMIA:000963-9913 | taurine cattle | Simmental Charolais Cross | Syndactyly (mule foot) | LRP4 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 15 | NC_037342.1:g.76812187C>T | NM_001077843.1:c.2719G>A | NP_001071311.1:p.(G907R) | rs5334474664 | 2007 | 17319939 | Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4 | ||
| 610 | OMIA:002017-9685 | domestic cat | Siamese (Cat) | Glaucoma 3, primary congenita | LTBP2 | duplication | Naturally occurring variant | yes | Felis_catus_9.0 | B3 | g.121929604_121929607dup | c.1449_1452dup | p.(A485Gfs) | ENSFCAT00000064963.2; ENSFCAP00000046761.2; published as "a 4-bp insertion in exon 8 located at chrB3: 120995236"[felCat5] | 2016 | 27149523 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 1394 | OMIA:002485-9685 | domestic cat | British Shorthair (Cat) | Skeletal dysplasia, LTBP3-related | LTBP3 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.110690432del | c.158del | p.(G53Afs*16) | XM_023240055.1; XP_023095823.1 | 2021 | 34946872 | |||
| 518 | OMIA:000185-452646 | American mink | Chediak-Higashi syndrome | LYST | deletion, small (<=20) | Naturally occurring variant | yes | c.9468delC | 2013 | 22762706 | |||||||||
| 183 | OMIA:000185-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Chediak-Higashi syndrome | LYST | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 28 | NC_037355.1:g.8464077T>C | NM_174020.2:c.6044A>G | NP_776445.1:p.(H2015R) | rs481318527 | 1999 | 10594238 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1147 | OMIA:000185-9685 | domestic cat | Persian (Cat) | Chediak-Higashi disease | LYST | repeat variation | Naturally occurring variant | yes | Felis_catus_9.0 | D2 | g.13289500_13308861dup | c.8347-2422_9548+1749dup | Buckley et al. (2020): "a tandem segmental duplication encompassing exons 30 through to 38 (NM_001290242.1:c.8347-2422_9548 + 1749dup) (NC_018733.3:g.13289500_13308861dup)" | 2020 | 31919397 | ||||
| 249 | OMIA:000625-10141 | domestic guinea pig | Mannosidosis, alpha | Man2b1 | missense | Naturally occurring variant | yes | c.679C>T | p.(R227W) | 2002 | 11959458 | ||||||||
| 199 | OMIA:000625-9913 | taurine cattle | Galloway (Cattle) | Mannosidosis, alpha | MAN2B1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.12840983G>A | NM_174561.2:c.662G>A | NP_776986.2:p.(R221H) | rs5334474945 | 1997 | 9208932 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 198 | OMIA:000625-9913 | taurine cattle | Angus (Cattle) Murray Grey (Cattle) | Mannosidosis, alpha | MAN2B1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.12842292T>C | NM_174561.2:c.961T>C | NP_776986.2:p.(F321L) | rs5334474873 | 1997 | 9208932 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1628 | OMIA:000625-9615 | dog | Doberman Pinscher (Dog) | Mannosidosis, alpha | MAN2B1 | missense | Naturally occurring variant | unknown | Dog10K_Boxer_Tasha | 20 | g.49320989A>G | c.311A>G | p.(D104G) | XM_005632833.4; XP_005632890.1 | 2023 | 37761886 | |||
| 499 | OMIA:000625-9685 | domestic cat | Persian (Cat) | Mannosidosis, alpha | MAN2B1 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | A2 | g.9011118_9011121del | c.1749_1752del | p.(Q584Afs) | NM_001009222.1; NP_001009222.1 | 1997 | 9396732 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 297 | OMIA:000626-9913 | taurine cattle | Salers (Cattle) | Mannosidosis, beta | MANBA | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.22188765G>A | NM_174387.2:c.2574G>A | NP_776812.1:p.(W858*) | rs5334475094 | 1999 | 10594236 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 451 | OMIA:000626-9925 | goat | Mannosidosis, beta | MANBA | deletion, small (<=20) | Naturally occurring variant | yes | ARS1.2 | 6 | NC_030813.1:g.22409150del | NM_001285691.1:c.1398del | NP_001272620.1:p.W466fs | rs5334475113 | 1996 | 8921369 | The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries | |||
| 1093 | OMIA:000626-9615 | dog | Mixed Breed (Dog) | Beta mannosidosis | MANBA | duplication | Naturally occurring variant | yes | CanFam3.1 | 32 | g.24057654_24057658dup | c.2377_2381dup | p.(H794Hfs) | XM_005639236.3; XP_005639293.1; published as c.2377_2381dupTATCA | 2019 | 31439511 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 1072 | OMIA:000626-9615 | dog | German Shepherd Dog (Dog) | Beta mannosidosis | MANBA | missense | Naturally occurring variant | yes | CanFam3.1 | 32 | g.24147500A>T | c.560T>A | p.(I187N) | 2019 | 30983534 | ||||
| 1636 | OMIA:000626-9685 | domestic cat | Domestic Shorthair | Mannosidosis, beta | MANBA | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.121800342G>A | c.2506G>A | p.(G836R) | ENSFCAT00000007560, variant was reported in a single affected cat | 2024 | 37913889 | |||
| 1473 | OMIA:002381-9913 | taurine cattle | Romagnola (Cattle) | Skeletal-cardio-enteric dysplasia | MAP2K2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.19923991C>T | NM_001038071.2:c.535G>A | NP_001033160.2:p.(R179W) | NM_001038071.2; NP_001033160.2; possible de-novo causal variant | 2021 | 34209498 | |||
| 943 | OMIA:001432-9615 | dog | Dachshund, Miniature Long-Haired (Dog) | Cone-rod dystrophy 4 | MAP9 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.52905336_52927296del | c.75+181_1378-215del | XM_005629374.1; An approximately 22kb deletion "approximately 30 Mb upstream of RPGRIP1 . . . The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene." … " The size of the deletion based on genome build CanFam3.1 MAP9_corrected is 21,961 bp, with deletion breakpoints in intron 10 of MAP9 and MAP9." | 2016 | 27017229 | ||||
| 1416 | OMIA:002517-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH6 | MARS2 | BH6 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.86191230G>A | NM_001098971.1:c.1553G>A | NP_001092441.1:p.(R518Q) | NM_001098971.1 | rs434672528 | 2021 | 34915862 | |
| 1167 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | MC1R | E^D | missense | Naturally occurring variant | no | ARS-UCD1.3 | 18 | NC_037345.1:g.14705671T>C | NM_174108.2:c.296T>C | NP_776533.1:p.(L99P) | rs109688013 | 2016 | 27037038 | |||
| 1437 | OMIA:002716-9615 | dog | German Shepherd Dog (Dog) | Congenital idiopathic megaesophagus, risk factor | MCHR2 | repeat variation | Naturally occurring variant | yes | CanFam3.1 | 12 | Bell et al. (2022): "Within the first intron of MCHR2, we identified a 33 bp variable number tandem repeat (VNTR) containing a consensus binding sequence for the T-box family of transcription factors. Across dogs and wolves, the major allele includes two copies of the repeat, whereas the predominant alleles in GSDs have one or three copies. The single-copy allele is strongly associated with CIM (P-val = 1.32x10-17), with homozygosity for this allele posing the most significant risk". | 2022 | 35271580 | ||||||
| 1658 | OMIA:002814-9615 | dog | Eurasier (Dog) | Polioencephalopathy | MECR | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 2 | g.70793040A>G | c.823A>G | p.(M275V) | XM_038531348.1; XP_038387276.1, variant reported in 3 affected dogs | 2023 | 38041431 | |||
| 558 | OMIA:002043-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MED22-related | MED22 | deletion, small (<=20) | Naturally occurring variant | yes | 11 | p.(L38Rfs*25) | 2016 | 27646536 | |||||||
| 819 | OMIA:001932-9615 | dog | Swedish Vallhund (Dog) | Progressive retinal atrophy, MERTK-related | MERTK | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 17 | An insertion of "a full-length [6.401 kb] LINE-1 element comprising the 15 bp target site duplication [indicated by 'ins' in the g. notation], a 5’UTR, 900 bp 5’ ORF1, a 49 bp intergenic spacer, a 3,828 bp 3’ ORF2, a 3’UTR and poly(A) tail. The LINE-1 element has been inserted in the same orientation as the MERTK gene.". 200922: g. info has been moved to here (g.36338043-36338057ins) until it can be standardised | 2017 | 28813472 | Genomic location provided by Sally Ricketts | |||||
| 1489 | OMIA:002551-9615 | dog | Bull Mastiff (Dog) | Mitochondrial fission encephalopathy | MFF | delins, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 25 | g.40322999_40323003delinsCGCTCT | c.471_475delinsCGCTCT | p.(E158Afs*14) | XM_038574000.1; XP_038429928.1 | 2022 | 36085405 | |||
| 374 | OMIA:001106-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Tiroler Grauvieh (Cattle) | Axonopathy | MFN2 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 16 | NC_037343.1:g.41686003G>A | NM_001190270.1:c.2229C>T | "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript". Variant initially identified in Tiroler Grauvieh and later reported in additional breeds: PMID:34779908 | rs5334475057 | 2011 | 21526202 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 472 | OMIA:002153-9615 | dog | Schnauzer-Beagle Cross (Dog) | Neuroaxonal dystrophy | MFN2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.84289962_84289964del | c.1617_1619del | p.(E539del) | NM_001284441.1; NP_001271370.1; published as c.1617_1619delGGA; genomic position considers 3' rule of the HGVS | 2011 | 21643798 | Genomic position in CanFam3.1 provided by Robert Kuhn. | ||
| 1637 | OMIA:002371-9940 | sheep | Kerry Hill (Sheep) | Microcephaly, MFSD2A-related | MFSD2A | duplication | Naturally occurring variant | yes | ARS-UI_Ramb_v2.0 | 1 | NC_056054.1:g.14577421dup | XM_004001833.5:c.285dup | XP_004001882.2:p.(D96Rfs*9) | XM_004001833.5; XP_004001882.2 | 2024 | 37921236 | |||
| 1694 | OMIA:001962-9986 | rabbit | Lionhead Dwarf | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | duplication | Naturally occurring variant | yes | 15 | NC_013683.1:g.103727963_103738667dup | XM_002717263.3:c.202_701dup | XP_002717309.2:p.(E235Lfs*23) | 2024 | 38712841 | |||||
| 551 | OMIA:001962-9615 | dog | Chihuahua (Dog) Chinese Crested (Dog) | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 19 | g.13010761del | c.846del | p.(F282Lfs*13) | XM_014121438.2;XP_013976913.1; published as c.843delT; coordinates in the table have been updated to a recent reference genome and / or transcript | 2015 | 25551667 | Breed and p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1148 | OMIA:001962-9685 | domestic cat | Domestic Shorthair | Neuronal ceroid lipofuscinosis, 7 | MFSD8 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.98935076del | c.780del | p.(Q262Kfs*33) | XM_019828986.2; XP_019684545.1; published as c.780delT | 2020 | 31860737 | |||
| 1374 | OMIA:002465-9615 | dog | Italian Cane Corso (Dog) | Dental-skeletal-retinal anomaly | MIA3 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 38 | g.16920529_16920530del | c.3822+3_3822+4del | p.(V1238_K1274del) | XM_005640835.3; XP_005640892.1; published as g.16920529_16920530delAT, leads to skipping of two exons: XM_005640835.3:r.3712_3822del | 2021 | 34680893 | |||
| 644 | OMIA:001565-9913 | taurine cattle | Ayrshire (Cattle) | Abortion and stillbirth due to mutation in MIMT1 | MIMT1 | deletion, gross (>20) | Naturally occurring variant | yes | 18 | a 110 kb deletion in the MIMT1 gene | 2010 | 21152099 | |||||||
| 1287 | OMIA:002309-9646 | giant panda | Cataract | MIP | missense | Naturally occurring variant | yes | c.686G>A | p.(S229N) | 2021 | 33530927 | ||||||||
| 505 | OMIA:000755-93934 | Japanese quail | Osteopetrosis | MITF | deletion, small (<=20) | Naturally occurring variant | yes | same MITF variant as for silver, as reported in 1998 | 2001 | 11169846 | |||||||||
| 385 | OMIA:001401-10036 | golden hamster | Waardenburg syndrome, type 2A | MITF | splicing | Naturally occurring variant | yes | A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. | 2003 | 12871913 | |||||||||
| 678 | OMIA:001931-9913 | taurine cattle | Holstein (black and white) (Cattle) | Depigmentation associated with microphthalmia | MITF | deletion, gross (>20) | Naturally occurring variant | yes | 22 | a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 | 2014 | 25199536 | |||||||
| 1378 | OMIA:001401-9823 | pig | Bama Xiang Zhu, China (Pig) | Waardenburg syndrome, type 2A | MITF | missense | Chemical mutagenesis (ENU) | yes | 13 | c.740T>C | p.(L247S) | 2017 | 29094203 | ||||||
| 837 | OMIA:001680-9913 | taurine cattle | Holstein (black and white) (Cattle) | Glass-eyed albino | MITF | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 22 | g.31628127_31628129del | p.(R211del) | UMD3.1 position g.31746506_31746508del | rs5334474965 | 2017 | 28904385 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 189 | OMIA:001680-9913 | taurine cattle | Fleckvieh-Simmental, Germany (Cattle) | Dominant white with bilateral deafness | MITF | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 22 | NC_037349.1:g.31628131C>A | NM_001001150.2:c.629G>T | NP_001001150.1:p.(R210I) | UMD3.1 position is g.31746502 | rs5334474903 | 2011 | 22174915 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1023 | OMIA:000214-9796 | horse | American Paint (Horse) | White spotting, blue eyes and deafness | MITF | SW5 | deletion, gross (>20) | Naturally occurring variant | yes | EquCab3.0 | 16 | NC_009159.3:g.21503211_21566617del | "~63-kb deletion spanning exons 6-9 of the MITF gene" | 2019 | 30644113 | ||||
| 1180 | OMIA:000214-9796 | horse | American Paint (Horse) | Splashed white | MITF | SW6 | deletion, gross (>20) | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21551060_21559770del | NC_009159.3:g.21551060-21559770del (Magdesian et al., 2020) | 2020 | 32242630 | ||||
| 1626 | OMIA:000214-9796 | horse | Thoroughbred (Horse) | Splashed white | MITF | SW8 | deletion, gross (>20) | Naturally occurring variant | yes | EquCab3.0 | 16 | NC_009159.3:g.21555811_21558139delinsAAAT | 2023 | 37697831 | |||||
| 166 | OMIA:000214-9796 | horse | American Trotter (Horse) | White | MITF | MITF^244Glu | missense | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21556522C>T | NM_001163874.1:c.1031G>A | NP_001157346.1:p.(G344E) | Published as XM_005600318.1:c.731G>A; XP_005600375.1:p.Gly244Glu) - updated in this table to reflect recent transcript ID | rs3435075789 | 2017 | 27592871 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124 |
| 1606 | OMIA:000214-9796 | horse | Purebred Spanish (Horse) | Splashed white | MITF | SW9 | missense | Naturally occurring variant | yes | EquCab3.0 | 16 | NC_009159.3:g.21559940T>A | NM_001163874.1:c.961A>T | NP_001157346.1:p.(N321Y) | NM_001163874.1; NP_001157346.1; published as c.993A>T, variant associated with increased depigmentation | 2023 | 37406837 | ||
| 1488 | OMIA:000214-9796 | horse | American Paint (Horse) Quarter Horse (Horse) | Splashed white | MITF | SW7 | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 16 | NC_009159.3:g.21559953_21559955del | NM_001163874.1:c.949_951del | NP_001157346.1:p.R317del | NM_001163874.1; NP_001157346.1; published as c.949_951delTCT | 2022 | 35672910 | ||
| 156 | OMIA:000214-9796 | horse | Freiberger (Horse) | Macchiato | MITF | macchiato | missense | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21564980T>C | NM_001163874.1:c.629A>G | NP_001157346.1:p.(N310S) | rs5334475186 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 793 | OMIA:000214-9796 | horse | Quarter Horse (Horse) | Splashed white | MITF | SW3 | deletion, small (<=20) | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21567245_21567249del | NM_001163874.1:c.837_841del | NP_001157346.1:p.(C280Sfs*20) | NM_001163874.1; NP_001157346.1; published as c.837_841delGTGTC | 2012 | 22511888 | ||
| 792 | OMIA:000214-9796 | horse | American Miniature Horse (Horse) American Paint (Horse) Appaloosa (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Tori hobune, Estonia (Horse) Trakehner (Horse) | Splashed white | MITF | SW1 | delins, small (<=20) | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21579201delinsATAATAACCTA | g.20117302Tdelins11 | rs5334475212 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | ||
| 806 | OMIA:000214-9796 | horse | American Trotter (Horse) Arab (Horse) Belgian Draft (Horse) Cavall Menorquí, Spain (Horse) Clydesdale (Horse) Freiberger (Horse) Icelandic Horse (Horse) Morgan (Horse) Quarter Horse (Horse) Shetland Pony (Horse) Thoroughbred (Horse) Warmblood (Horse) Welsh Pony (Horse) | White splashing | MITF | regulatory | Naturally occurring variant | no | EquCab3.0 | 16 | NC_009159.3:g.21608936C>T | Published as g.20147039C>T (EquCab2.0); may not be causal as the variant was identified to be a common variant across multiple breeds in a later study: PMID: 38600096 | 2017 | 28084638 | Breed information updated based on PMID: 38600096 | ||||
| 1205 | OMIA:001680-452646 | American mink | Hedlund | MITF | h | splicing | Naturally occurring variant | yes | MusPutFur1.0.86 | c.33+1G>A | GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) | 2019 | 30872653 | ||||||
| 849 | OMIA:001401-9823 | pig | Rongchang, China (Pig) | Waardenburg syndrome, type 2A | MITF | insertion, small (<=20) | Naturally occurring variant | yes | Sscrofa11.1 | 13 | g.51377987_51377988insTTTAGTTTAAAAAA | a 14 bp insertion "in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene generated a novel silencer" | rs5334475179 | 2016 | 27349893 | ||||
| 976 | OMIA:002146-9615 | dog | Bull Terrier (Dog) Miniature Bull Terrier (Dog) | Lethal acrodermatitis | MKLN1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 14 | g.5731405T>G | c.400+3A>C | p.(G105Sfs*10) | This variant is "located within the 5’-splice site of intron 4 of the MKLN1 gene" | 2018 | 29565995 | |||
| 1209 | OMIA:001654-8932 | rock pigeon | Almond | MLANA | st | repeat variation | Naturally occurring variant | yes | "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) | 2020 | 32433666 | ||||||||
| 1014 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, MLH1-related | MLH1 | nonsense (stop-gain) | Naturally occurring variant | yes | 2 | c.1029C<G | p.(Y343*) | Dray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein". Ozirmak Lermi et al. (2022) reported the c. and p. coordinates of this variant. | 2018 | 30108684 | ||||||
| 1013 | OMIA:002145-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MLH1-related | MLH1 | deletion, small (<=20) | Naturally occurring variant | yes | 2 | g.99561829_99561830del | Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" | 2018 | 29490919 | |||||||
| 360 | OMIA:000031-9615 | dog | American Staffordshire Terrier (Dog) Beagle (Dog) Belgian Shepherd Dog, Malinois (Dog) Doberman Pinscher (Dog) German Pinscher (Dog) Large Munsterlander (Dog) Miniature Pinscher (Dog) Rhodesian Ridgeback (Dog) | Dilute | MLPH | d^1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 25 | g.48121642G>A | c.-22G>A | 2007 | 17519392 | Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool | |||
| 1216 | OMIA:000031-9615 | dog | Chihuahua (Dog) Italian Greyhound (Dog) Mudi (Dog) Pekingese (Dog) Pumi (Dog) Shetland Sheepdog (Dog) Shih Tzu (Dog) Tibetan Mastiff (Dog) Yorkshire Terrier (Dog) | Dilute | MLPH | d^3 | insertion, small (<=20) | Naturally occurring variant | no | CanFam3.1 | 25 | g.48150749_50insC | c.667_668insC | p.(H223Pfs*41) | "(NM_001103219.2: c.667_668insC or chr25: g.48150749_50insC" (van Buren et al. (2020) | 2020 | 32531980 | ||
| 948 | OMIA:000031-9615 | dog | Chow Chow (Dog) Sloughi (Dog) Thai Ridgeback (Dog) | Dilute | MLPH | d^2 | missense | Naturally occurring variant | yes | CanFam3.1 | 25 | g.48150787G>C | c.705G>C | p.(Q235H) | 2018 | 29349785 | |||
| 1690 | OMIA:002849-9940 | sheep | Manech Tête Rousse, France (Sheep) | Methylmalonyl-CoA mutase deficiency | MMUT | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 20 | NC_040271.1:g.23776347G>A | XM_004018875.4:c.1225C>T | XP_004018923.1:p.(Q409*) | 2024 | 38424485 | ||||
| 1433 | OMIA:000884-9031 | chicken | Rose comb | MNR2 | R2 | complex rearrangement | Naturally occurring variant | no | galGal3 | 7 | g.16499781_16499782ins[23881384_23790414inv;16499583–16499781] | predicted to be the result of a recombination event between the wild-type allele and the R1 allele: "R2 does not carry the entire inversion but instead has two duplicated segments, one 91 kb fragment (23,790,414–23,881,384 bp) that represents a remaining fragment of the inverted region together with a small duplicated fragment of 198 bp (16,499,583–16,499,781 bp)" | 2012 | 22761584 | |||||
| 745 | OMIA:000884-9031 | chicken | Rose comb | MNR2 | R1 | inversion | Naturally occurring variant | no | galGal3 | 7 | g.16499782_23881391delins23881384_16499781 | published as a 7.38 Mb inversion | 2012 | 22761584 | |||||
| 492 | OMIA:001819-9913 | taurine cattle | Brown Swiss (Cattle) Tiroler Grauvieh (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 24 | NC_037351.1:g.20911933del | XM_024984177.1:c.1881del | XP_024839945.1:p.(S628Vfs9*) | Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). Variant was initially described in Tyrolean Grey cattle and later reported in Brown Swiss cattle (PMID: 37675885) | rs5334474910 | 2016 | 27919260 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 446 | OMIA:001819-9913 | taurine cattle | Japanese Black, Japan (Cattle) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 24 | NC_037351.1:g.20936257_20936259del | NM_174081.2:c.769_771del | NP_776506.1:p.(Y257del) | published as c.769_771delTAC | 2000 | 10801779 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||
| 1356 | OMIA:001819-9615 | dog | Cavalier King Charles Spaniel (Dog) English Cocker Spaniel (Dog) | Xanthinuria, type II | MOCOS | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.53989863del | c.383del | p.(A128Gfs*30) | c.383delC; transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) | 2021 | 34584846 | |||
| 1355 | OMIA:001819-9615 | dog | Manchester Terrier (Dog) | Xanthinuria, type II | MOCOS | splicing | Naturally occurring variant | yes | CanFam3.1 | 7 | g.53995018C>A | c.232G>T | p.(G48_Y77del) | ENSCAFT00000028243.4; “Ensembl VEP determined the consequence of the variant to be a missense, splice region variant … the variant results in the removal of all 90 bp (30 amino acids) of exon 2 (p.Gly48_Tyr77del); the genomic position is based on supplementary table S3 (Tate et al., 2021)”; transcript ENSCAFT00000028243.4 | 2021 | 34584846 | |||
| 1357 | OMIA:001819-9615 | dog | Dachshund (Dog) | Xanthinuria, type II | MOCOS | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.54001790A>G | c.137T>C | p.(L46P) | transcript ENSCAFT00000028243.4; genomic position based on supplementary table S3 (Tate et al., 2021) | 2021 | 34584846 | |||
| 483 | OMIA:001541-9913 | taurine cattle | Simmental (Cattle) | Arachnomelia, BTA23 | MOCS1 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 23 | g.13837657_13837658del | c.1224_1225del | p.(H408Qfs*51) | 220110: changed g.13837654_13837655del to g.13837657_13837658del based on HGVS 3'rule. ENSBTAT00000013792.6:c.1224_1225del ENSBTAP00000013792.5:p.His408GlnfsTer51 | rs383500843 | 2011 | 21255426 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. | |
| 326 | OMIA:001366-9031 | chicken | Retinal dysplasia and degeneration | MPDZ | nonsense (stop-gain) | Naturally occurring variant | yes | GRCg6a | Z | g.31023848G>A | c.1372C>T | p.(R458*) | 2011 | 21862650 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 342 | OMIA:002028-9615 | dog | Italian Hound (Dog) | Myeloperoxidase deficiency | MPO | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.32929382G>A | c.1936C>T | p.(R646*) | XM_847352.4; XP_852445.2; published as c.1987C>T (Ensembl transcript ID:ENSCAFT00000027699) | 2016 | 27296514 | |||
| 1592 | OMIA:002739-9615 | dog | Golden Retriever (Dog) | Polyneuropathy, hypomyelinating, MPZ-related | MPZ | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 38 | g.22037876T>C | c.434T>C | p.(I145T) | XM_038585926.1; XP_038441854.1; heterozygous in a single affected dog | 2023 | 37400349 | |||
| 491 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.47095176_47095177del | c.2904_2905del | p.(G934*) | rs5334475077 | 2009 | 19779552 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del | ||
| 208 | OMIA:001452-9913 | taurine cattle | Belgian Blue (Cattle) | Tail, crooked | MRC2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.47089627T>G | NM_001192670.1:c.1906T>G | NP_001179599.1:p.(C636G) | rs466131011 | 2012 | 22497452 | Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1417 | OMIA:002518-9913 | taurine cattle | Brown Swiss (Cattle) | Haplotype with homozygous deficiency BH14 | MRPL55 | BH14 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 7 | NC_037334.1:g.2996436C>T | NM_001303490.1:c.169C>T | NP_001290419.1:p.(R57*) | NM_001303490.1 | rs461014370 | 2021 | 34915862 | |
| 1015 | OMIA:002160-9544 | Rhesus monkey | Colorectal cancer, hereditary nonpolyposis, MSH6-related | MSH6 | missense | Naturally occurring variant | unknown | Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" | 2018 | 30108684 | |||||||||
| 618 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nt419(del7-ins10) | delins, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 2 | g.6281243_6281249delinsAAGCATACAA | c.419_425delinsAAGCATACAA | p.(F140*) | cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively | rs5334475091 | 1998 | 9501304 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021) |
| 212 | OMIA:000683-9913 | taurine cattle | Gelbvieh (Cattle) | Muscular hypertrophy (double muscling) | MSTN | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6279187T>C | NM_001001525.3:c.191T>C | NP_001001525.1:p.(L64P) | UMD3.1 position is g.6213889T>C | rs449270213 | 2015 | 25515003 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 771 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6279278C>A | NM_001001525.3:c.282C>A | NP_001001525.1:p.(F94L) | UMD3.1 position is g.6213980A>C | rs110065568 | 1998 | 9501304 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 772 | OMIA:000683-9913 | taurine cattle | Parthenais (Cattle) | Muscular hypertrophy (double muscling) | MSTN | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6279310C>G | NP_001001525.1:c.314C>G | NP_001001525.1:p.(S105C) | UMD3.1 position is g.6214012C>G | rs5334475047 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 773 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) | Muscular hypertrophy (double muscling) | MSTN | D182N | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6281368G>A | NM_001001525.3:c.544G>A | NP_001001525.1:p.(D182N) | rs5334475067 | 2002 | Reference not in PubMed; see OMIA 000683-9913 for reference details | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 299 | OMIA:000683-9913 | taurine cattle | Blonde d'Aquitaine (Cattle) Charolais (Cattle) Limousin (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6281434C>T | NM_001001525.3:c.610C>T | NP_001001525.1:p.(Q204*) | UMD3.1 position is g.6216138C>T | rs110344317 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 300 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6281500G>T | NM_001001525.3:c.676G>T | NP_001001525.1:p.(E226*) | UMD3.1 position is g.6216204G>T | rs5334474940 | 1998 | 9501304 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 489 | OMIA:000683-9913 | taurine cattle | Angus (Cattle) Asturian Valley (Cattle) Belgian Blue (Cattle) Blonde d'Aquitaine (Cattle) Braford (Cattle) Limousin (Cattle) Murray Grey (Cattle) Parthenais (Cattle) Santa Gertrudis (Cattle) South Devon (Cattle) | Muscular hypertrophy (double muscling) | MSTN | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6283674_6283684del | NM_001001525.3:c.818_828del | NP_001001525.1:p.(D273Rfs*14) | UMD3.1 position is g.6218379delATGAACACTCC; c. previously listed as c.821_831del - updated to recent transcript ID and incorrect EVA rs382669990 replaced [29/08/2024] | rs5384554823 | 1997 | 9288100 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021). | |
| 301 | OMIA:000683-9913 | taurine cattle | Maine-Anjou (Cattle) Marchigiana (Cattle) | Muscular hypertrophy (double muscling) | MSTN | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6283727G>T | NM_001001525.3:c.871G>T | NP_001001525.1:p.(E291*) | UMD3.1 position is g.6218432G>T; c.1004G>T updated to c.871G>T [29/08/2024] | rs5334475075 | 2013 | 22497537 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 203 | OMIA:000683-9913 | taurine cattle | Gascon (Cattle) Parthenais (Cattle) Piedmont (Cattle) | Muscular hypertrophy (double muscling) | MSTN | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 2 | NC_037329.1:g.6283794G>A | NM_001001525.3:c.938G>A | NP_001001525.1:p.(C313Y) | UMD3.1 position is g.6218499G>A | rs5334475012 | 1997 | 9314496 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1019 | OMIA:002161-9823 | pig | Large White (Pig) | Leg weakness, MSTN-related | MSTN | nonsense (stop-gain) | Naturally occurring variant | yes | Sscrofa11.1 | 15 | g.94623834C>A | c.820G>T | p.(E274*) | rs3473215843 | 2019 | 30699111 | |||
| 63 | OMIA:001508-9615 | dog | Labrador Retriever (Dog) | Myotubular myopathy 1 | MTM1 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.118885117C>A | c.465C>A | p.(N155K) | XM_005641935.3; XP_005641992.1 | rs1152388426 | 2010 | 20682747 | Genomic coordinates in CanFam3.1 and EVA ID provided by Robert Kuhn | |
| 91 | OMIA:001508-9615 | dog | Rottweiler (Dog) | Myotubular myopathy 1 | MTM1 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.118901282A>C | c.1151A>C | p.(Q384P) | XM_005641935.3; XP_005641992.1 | 2015 | 25664165 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 1459 | OMIA:001508-9615 | dog | Boykin Spaniel (Dog) | Myotubular myopathy 1 | MTM1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | X | g.118903496C>T | c.1467C>T | p.(R512*) | ENSCAFP00000028221.3 | 2020 | 32417001 | |||
| 1475 | OMIA:001508-9685 | domestic cat | Maine Coon (Cat) | Myotubular myopathy 1 | MTM1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | X | g.125938001C>T | c.455C>T | p.(A152V) | XM_004000974.4; XP_004001023.1 | 2022 | 35962713 | |||
| 1591 | OMIA:002727-9615 | dog | Golden Retriever (Dog) | Polyneuropathy, hypomyelinating, MTMR2-related | MTMR2 | splicing | Naturally occurring variant | unknown | UU_Cfam_GSD_1.0 | 21 | g.5387227G>A | c.1479+1G>A | XM_038568229.1, reported in two dogs | 2023 | 37400349 | ||||
| 1524 | OMIA:001467-9615 | dog | Golden Retriever (Dog) | Neuropathy, sensory ataxic | MTTY | deletion, small (<=20) | Naturally occurring variant | yes | M | m.5304del | 2009 | 19492087 | |||||||
| 437 | OMIA:000175-9796 | horse | Arab (Horse) Bashkir Curly (Horse) Quarter Horse (Horse) Trakehner (Horse) Welsh Pony (Horse) | Cerebellar abiotrophy | MUTYH | not known | Naturally occurring variant | yes | EquCab3.0 | 2 | NC_009145.3:g.13122415C>T | ENSECAT00000009202.3:c.541-13539C>T | ENSECAT00000009202.3:c.541-13539C>T ENSECAT00000024892.2:c.284G>A ENSECAP00000020698.1:p.Arg95His A SNP "located in exon 4 of TOE1 and approximately 1200 base pairs upstream of MUTYH, adjacent to a possible binding site for the transcription factor GATA2" (Brault et al., 2011). EquCab3.1 coordinate provided by Meredith O’Connell, working under the supervision of Professor E. Bailey. Additional breeds added based on supplementary table 6 of Durward-Akhurst et al. (2024, PMID: 38600096). | rs397160943 | 2011 | 21126570 | |||
| 14 | OMIA:001534-9031 | chicken | Resistance to myxovirus | MX1 | missense | Naturally occurring variant | no | GRCg6a | 1 | g.110260061G>A | c.1892G>A | p.(S631N) | rs313590198 | 2002 | 11932243 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 217 | OMIA:001978-9913 | taurine cattle | Holstein Friesian (Cattle) | Arthrogryposis, distal, type 1B | MYBPC1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 5 | NC_037332.1:g.65446598T>G | NM_001110773.1:c.884T>G | NP_001104243.1:p.(L295R) | rs5369172067 | 2015 | 26289121 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 902 | OMIA:000515-9685 | domestic cat | American Bobtail (Cat) American Bobtail Shorthair (Cat) Highlander (Cat) Munchkin (Cat) Ragamuffin (Cat) Ragdoll (Cat) | Cardiomyopathy, hypertrophic | MYBPC3 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.101329646G>A | c.2453C>T | p.(R818W) | XM_019812397.1; XP_019667956.1; published as p.(R820W); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17521870 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | ||
| 901 | OMIA:000515-9685 | domestic cat | Maine Coon (Cat) Maine Coon Polydactyl (Cat) Munchkin (Cat) Pixiebob Longhair (Cat) Scottish Fold (Cat) Siberian (Cat) | Cardiomyopathy, hypertrophic | MYBPC3 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D1 | g.101340772C>G | c.91G>C | p.(A31P) | XM_019812397.1; XP_019667956.1; variant initially reported in Main Coon cats and in a later study (Akiyama et al., 2023) identified in other breeds. | 2005 | 16236761 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. Additional breeds reported based on PMID:35709088. | ||
| 973 | OMIA:002141-9796 | horse | Belgian Draft (Horse) Quarter Horse (Horse) Welsh Pony (Horse) | Immune-mediated myositis | MYH1 | missense | Naturally occurring variant | yes | EquCab3.0 | 11 | NC_009154.3:g.53345548T>C | NM_001081759.1:c.959A>G | NM_001081759.1:p.(E320G) | The location of this likely causal variant was given as chr11:52,993,878T>C by Finno et al. (2018) in relation to the EquCab2.0 assembly. Applying NCBI's remap gives the EquCab3.0 coordinate as chr11:53,345,548 and p.(E320G) | rs3435577028 | 2018 | 29510741 | Breed information updated based on PMID: 38600096 | |
| 1500 | OMIA:002590-9913 | taurine cattle | Limousin (Cattle) | Cleft palate | MYH3 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 19 | g.[29609605-29609615del;29609623A>G] | c.[2864T>C;2872_2882del] | c.[I955T; p.L958Tfs*5] | NM_001101835.1 | 2022 | 36309651 | |||
| 556 | OMIA:002039-9913 | taurine cattle | Belgian Blue (Cattle) | Abortion (embryonic lethality), MYH6-related | MYH6 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 10 | g.21538917_21538919del | p.(K1730del) | 2016 | 27646536 | The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | ||||
| 1121 | OMIA:002212-9685 | domestic cat | Domestic Shorthair | Cardiomyopathy, hypertrophic, MYH7-related | MYH7 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B3 | g.76166296C>T | c.5647G>A | p.(E1883K) | XM_006932746.4; XP_006932808.1 | rs3166775194 | 2019 | 31164718 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | |
| 598 | OMIA:001200-9823 | pig | Tremor, high-frequency (Campus syndrome) | MYH7 | insertion, small (<=20) | Naturally occurring variant | yes | Sscrofa11.1 | 7 | g.75668349_75668350insGGCGGG | c.4320_4321insCCCGCC | p.(A1440_A1441insPA) | rs5334475166 | 2012 | 23153285 | The genomic location on Sscrofa10.2 was determined by Stephanie Shields (27/05/2020) and updated to the genomic Sscrofa11.1 location by Imke Tammen | |||
| 55 | OMIA:001608-9615 | dog | Pug (Dog) | May-Hegglin anomaly | MYH9 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.28120346G>A | c.5521G>A | p.(E1841L) | NM_001110767.1; NP_001104237.1; previously incorrectly listed in OMIA as p.(Q1841L) (corrected 11/2/2022) | 2011 | 21554370 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn. | ||
| 1372 | OMIA:001501-9615 | dog | Dachshund, Miniature (Dog) | Coat colour dilution and neurological defects | MYO5A | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 30 | g.18004551_18004552insT | c.4973_4974insA | p.(N1658Kfs*28). | cDNA and protein positions based on XM_022412522.1 and XP_022268230.1, respectively | 2021 | 34680875 | |||
| 510 | OMIA:001501-9796 | horse | Arab (Horse) | Lavender foal syndrome | MYO5A | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.139290592del | XM_023617258.1:c.4249del | XP_023473026.1:p.(R1417Afs*13) | XM_023617258.1; XP_023473026.1; published as g.138235715delC; coordinates in the table have been updated to a recent reference genome | 2010 | 20419149 | The genomic position in EquCab3.0 was provided by Gracie Zinsmeister, working under the guidance of Professor Ernie Bailey in April 2022 | ||
| 1079 | OMIA:002148-9615 | dog | Doberman Pinscher (Dog) | Deafness, bilateral, and vestibular dysfunction | MYO7A | missense | Naturally occurring variant | yes | CanFam3.1 | 21 | g.21563111C>T | c.3719G>A | p.(R1240Q) | 2019 | 31097876 | ||||
| 1316 | OMIA:002148-9823 | pig | Duroc (Pig) | Vestibular dysfunction | MYO7A | nonsense (stop-gain) | Naturally occurring variant | yes | Sscrofa11.1 | 9 | g.11280403C>T | c.541C>T | p.(Q181*) | cDNA position is based on transcript NM_001099928.1 | rs5334475170 | 2021 | 33955556 | ||
| 519 | OMIA:001342-8790 | emu | Mucopolysaccharidosis IIIB | NAGLU | deletion, small (<=20) | Naturally occurring variant | yes | c.1098_1099delGG | 2001 | 11414757 | |||||||||
| 202 | OMIA:001342-9913 | taurine cattle | Santa Gertrudis (Cattle) | Mucopolysaccharidosis IIIB | NAGLU | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.42624367G>A | NM_001102226.2:c.1354G>A | NP_001095696.1:p.(E452K) | rs5334475071 | 2007 | 17458708 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 956 | OMIA:001342-9615 | dog | Schipperke (Dog) | Mucopolysaccharidosis IIIB | NAGLU | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 9 | g.20407670_20407671ins[A[(40_70)];20407660_20407670] | c.2110_2111ins[A[(40_70)];2100_2110] | XM_548088; an insertion of 40 to 70 A nucleotides and an 11bp duplication of the sequence directly upstream of the poly-A | 2020 | 32081995 | ||||
| 986 | OMIA:001788-9615 | dog | Great Dane (Dog) Rottweiler (Dog) | Leukoencephalomyelopathy | NAPEPLD | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.16987327_16987328insC | c.345_346insC | p.(E116Rfs*186) | 2018 | 29643404 | ||||
| 985 | OMIA:001788-9615 | dog | Leonberger (Dog) | Leukoencephalomyelopathy | NAPEPLD | missense | Naturally occurring variant | yes | CanFam3.1 | 18 | g.16987520G>C | c.538G>C | p.(A180P) | 2018 | 29643404 | ||||
| 1469 | OMIA:002557-9913 | taurine cattle | Cikasto govedo, Slovenia (Cattle) | Leber optic neuropathy | ND4L | missense | Naturally occurring variant | yes | M | m.10432T>C | Novosel et al. (2022): "two “mutant” Cika cattle animals (GenBank acc. Nos. MZ901663 and MZ MZ901663)" | 2019 | Reference not in PubMed; see OMIA 002557-9913 for reference details | ||||||
| 1315 | OMIA:002348-9615 | dog | English Cocker Spaniel (Dog) | Retinal dysplasia | NDP | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.37950668_37950668insC | c.653_654insC | p.(M114Hfs*16) | 2021 | 33945575 | ||||
| 474 | OMIA:002120-9615 | dog | Greyhound (Dog) | Polyneuropathy | NDRG1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.29691070_29691079del10 | c.1080_1089del10 | p.(R361Sfs*60) | NM_001284434.1; NP_001271363.1 | 2010 | 20582309 | Genomic position in CanFam3.1 provided by Robert Kuhn and Mateo Etcheveste. | ||
| 73 | OMIA:002120-9615 | dog | Alaskan Malamute (Dog) | Polyneuropathy | NDRG1 | missense | Naturally occurring variant | yes | CanFam3.1 | 13 | g.29714606C>A | c.293G>T | p.(G98V) | NM_001284434.1; NP_001271363.1 | 2013 | 23393557 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1679 | OMIA:002840-9615 | dog | Mixed Breed (Dog) | Leigh syndrome | NDUFS7 | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 20 | g.57913322G>A | c.535G>A | p.(V179M) | XM_038568001.1; XP_038423929.1 | 2024 | 38316835 | |||
| 961 | OMIA:002137-9615 | dog | American Bulldog (Dog) | Nemaline myopathy, NEB-related | NEB | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 19 | g.52734272G>T | p.(S8042*) | NP_001258137.1 | 2016 | 27215641 | ||||
| 1083 | OMIA:002198-9615 | dog | Giant Schnauzer (Dog) | Progressive retinal atrophy, NECAP1-related | NECAP1 | missense | Naturally occurring variant | yes | CanFam3.1 | 27 | g.37468611G>A | c.544G>A | p.(G182R) | 2019 | 31117272 | ||||
| 316 | OMIA:000545-93934 | Japanese quail | Hypotrophic axonopathy | NEFL | nonsense (stop-gain) | Naturally occurring variant | yes | c.352C>T | p.(Q114*) | 1993 | 8468353 | ||||||||
| 632 | OMIA:000218-9615 | dog | Collie eye anomaly | NHEJ1 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 37 | g.25698028_25705826del | c.588+462_588+8260del | XM_005640671.1; a deletion of 7799bp in the NHEJ1 gene; for limitations on the utility of testing for the published likely causal variant, see the results of Fredholm et al. (2016) and Brown et al. (2018) | 2007 | 17916641 | |||||
| 756 | OMIA:000690-9615 | dog | Beagle (Dog) Brussels Griffon (Dog) Chihuahua (Dog) Dachshund, Miniature Wire-Haired (Dog) French Bulldog (Dog) Mixed Breed (Dog) Newfoundland (Dog) Pembroke Welsh Corgi (Dog) | Myoclonus epilepsy of Lafora | NHLRC1 | repeat variation | Naturally occurring variant | yes | 35 | 19 to 26 copies of a sequence of 12 nucleotides (12-mer; dodecamer) in the canine EPM2B gene (now called NHLRC1) | 2005 | 15637270 | Additional breeds based on PMID: 34357061 | ||||||
| 766 | OMIA:002103-9913 | taurine cattle | Angus (Cattle) | Developmental duplications | NHLRC2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 26 | NC_037353.1:g.34340886T>C | NM_001083723.2:c.932T>C | NP_001077192.1:p.(V311A) | rs5334474969 | 2014 | Reference not in PubMed; see OMIA 002103-9913 for reference details | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 679 | OMIA:001936-9913 | taurine cattle | Romagnola (Cattle) | Cataract, recessive, Romagnola | NID1 | deletion, gross (>20) | Naturally occurring variant | yes | 28 | "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" | 2014 | 25347398 | |||||||
| 563 | OMIA:001980-9615 | dog | American Bulldog (Dog) American Bully (Dog) | Ichthyosis, NIPAL4-related | NIPAL4 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 4 | g.52737379del | c.744delC | p.(I249*) | 2017 | 28122049 | ||||
| 622 | OMIA:000938-9615 | dog | Weimaraner (Dog) | Spinal dysraphism | NKX2-8 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 8 | g.15149895delinsAA | c.449delinsTT | p.(A150Vfs*6) | XM_847109.4; XP_852202.1 | 2013 | 23874236 | |||
| 1370 | OMIA:002464-9823 | pig | Large White (Pig) | Cryopyrin-associated periodic syndrome | NLRP3 | missense | Genome editing (CRISPR/Cpf1) | yes | 2 | p.(R259W) | 2020 | 32958688 | |||||||
| 1096 | OMIA:002206-9615 | dog | Alaskan Malamute (Dog) | Ciliary dyskinesia, primary, NME5-related | NME5 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 11 | g.25792084del | c.43delA | p.(T15Lfs*56) | XM_003639378.4:c.43delA; XP_003639426.1:p.(Thr15LeufsTer56) | 2019 | 31479451 | |||
| 1718 | OMIA:002874-9913 | taurine cattle | Montbéliarde (Cattle) | Haplotype with homozygous deficiency, NOA1-related | NOA1A | insertion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.72359797_72359798insG | NM_001038188.2:c.1086_1087insC | NP_001033277.1:(p.D363Rfs*9) | Published as ENSBTAT00000071135.1:p.D400RfsX9 | rs5411279036 | 2023 | Reference not in PubMed; see OMIA 002874-9913 for reference details | ||
| 664 | OMIA:001101-9031 | chicken | Polymorphic Nucleolar [PNU] strain, United States of America (Chicken) | Ribosomal RNA deficiency | NOR | deletion, gross (>20) | Naturally occurring variant | yes | "Embryos exhibiting a nucleolar phenotype of one large and one very small nucleolus (Pp) are heterozygous for a reduced rDNA cluster (+/p1) and were shown in the present study to contain about 66% of the complement of rRNA genes in normal individuals (+/+) that show two large equal-sized nucleoli (PP)" | 1994 | 8014461 | ||||||||
| 1244 | OMIA:000725-9913 | taurine cattle | Angus (Cattle) | Niemann-Pick type C1 | NPC1 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 24 | NC_037351.1:g.33099467C>G | NM_174758.2:c.2969C>G | NP_777183.1:p.(P990R) | NM_174758.2:c.2969C>G | rs482882512 | 2020 | 32970694 | ||
| 134 | OMIA:000725-9685 | domestic cat | Domestic Shorthair | Niemann-Pick disease, type C1 | NPC1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D3 | g.48234217C>G | c.2864G>C | p.(C955S) | rs5334475149 | 2003 | 12809639 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 146 | OMIA:000725-9685 | domestic cat | Domestic Shorthair | Niemann-Pick disease, type C1 | NPC1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | D3 | g.48250290T>G | c.1322A>C | p.(H441P) | rs5334475146 | 2017 | 28233346 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1572 | OMIA:002065-9685 | domestic cat | Japanese domestic Siamese (Cat) | Niemann-Pick disease, type C2 | NPC2 | missense | Naturally occurring variant | unknown | Felis_catus_9.0 | B3 | g.121865210G>A | c.367G>A | p.(V126M) | XM_003987833.6; XP_003987882.1 | 2023 | 37458497 | |||
| 420 | OMIA:002065-9685 | domestic cat | Niemann-Pick disease, type C2 | NPC2 | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | B3 | g.121872988C>T | c.82+5G>A | p.(G28_S29ins35) | rs5334475124 | 2014 | 25396745 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 634 | OMIA:001455-9615 | dog | Dachshund, Miniature Wire-Haired (Dog) Dachshund, Standard Wire-Haired (Dog) | Cone-rod dystrophy, Standard Wire-haired Dachshund | NPHP4 | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 5 | g.59912991_59913168del | c.479_526+130del | NM_001135788.1; 178-bp deletion in exon/intron 5 of NPHP4 (nephronophthisis 4, also known as nephroretinin) | 2008 | 18687878 | ||||
| 1171 | OMIA:002254-9615 | dog | Mixed Breed (Dog) | Glucocorticoid resistance | NR3C1 | splicing | Naturally occurring variant | yes | 2 | c.2032_2033insN[69] | An insertion of "69 nucleotides between nucleotides 2032 and 2033 compared with dog wild type GR [i.e. NR3C1]. These extra 69 nucleotides matched a part of the nucleotide sequence of dog genomic DNA corresponding to intron 6 . . . . Insertion of these extra 69 nucleotides between exons 6 and 7 introduced a frameshift and a premature termination codon (TGA) 15 bp downstream of the insertion. This insertion is thus predicted to result in a truncated protein of 682 amino acids, compared to the normal (wild type) 780 amino acids" (Yamanaka et al., 2019) The cause of this splice variant could not be determined in genomic DNA. | 2019 | 31651346 | ||||||
| 1264 | OMIA:002296-9615 | dog | Yorkshire Terrier (Dog) | XY difference of sexual development, NR5A1-related | NR5A1 | deletion, gross (>20) | Naturally occurring variant | yes | 9 | "a large deletion consisting of four exons of the NR5A1 gene" (Nowacka-Woszuk et al., 2020) | 2020 | 33128907 | |||||||
| 790 | OMIA:002117-9615 | dog | Labrador Retriever (Dog) | CHILD-like syndrome | NSDHL | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | X | g.120749179_120763577del | c.507+220_*9662del | XM_005641965.1; deletion of 14,399bp | 2017 | 28739597 | ||||
| 1243 | OMIA:002117-9615 | dog | Chihuahua (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.120752468G>A | c.700G>A | p.(G234R) | CanFam3.1 ChrX:120,752,468G>A; XM_014111859.2:c.700G>A; XP_013967334.1: p.Gly234Arg | 2019 | 31571289 | |||
| 1268 | OMIA:002117-9615 | dog | Chihuahua (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | X | g.120752486_120752490del | c.718_722delGAACA | p.(E240Pfs*17) | NC_006621.3: g.120,752,486_120,752,490delGAACA; XM_014111859.2:c.718_722delGAACA; XP_013967334.1:p.(Glu240Profs*17) (Christen et al., 2020) | 2020 | 33143176 | |||
| 1055 | OMIA:002117-9685 | domestic cat | Domestic Shorthair | Inflammatory linear verrucous epidermal nevi | NSDHL | missense | Naturally occurring variant | yes | Felis_catus_9.0 | X | g.127926365A>G | c.397A>G | p.(S133G) | XM_004000985.5; XP_004001034.1 | 2019 | 30474267 | Genomic position in Felis_catus_9.0 provided by Leslie Lyons and Reuben Buckley. | ||
| 1686 | OMIA:002117-9615 | dog | Appenzeller Sennenhund (Dog) | Verrucous epidermal keratinocytic nevi | NSDHL | deletion, gross (>20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | X | UU_Cfam_GSD_1.0; large heterozygous deletion of at least 120 kb at ChrX:121.96-122.08 Mb; a more complex structural rearrangement is possible | 2024 | 38659285 | ||||||
| 1410 | OMIA:002509-9913 | taurine cattle | Simmental (Cattle) | Haplotype with homozygous deficiency SH9 | NUBPL | SH9 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 21 | NC_037348.1:g.42154344C>A | NM_001193042.1:c.428C>A | NP_001179971.1:p.(S143Y) | NM_001193042.1 | rs5335823597 | 2021 | 34944310 | |
| 1468 | OMIA:002556-9913 | taurine cattle | Chianina (Cattle) | Double-outlet right ventricle | NUMB | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 10 | NC_037337.1:g.84751870G>A | NM_001101951.1:c.416C>T | NP_001095421.1:p.(T139M) | NM_001101951.1; NP_001095421.1 | 2022 | 35748177 | |||
| 555 | OMIA:002035-9913 | taurine cattle | Jersey (Cattle) | Abortion (embryonic lethality), OBFC1-related | OBFC1 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 26 | g.24461804_24461805del | c.379_380del | p.(K127Vfs*29) | rs455647476 | 2016 | 27646536 | 220110: Changed from g.24461803_24461804del to g.24461804_24461805del to adhere to HGVS 3'rule ENSBTAT00000019995.6:c.379_380del ENSBTAP00000019995.5:p.Lys127ValfsTer29 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del | ||
| 1242 | OMIA:001595-9940 | sheep | Merino (Sheep) | Brachygnathia, cardiomegaly and renal hypoplasia syndrome | OBSL1 | deletion, small (<=20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 2 | NC_040253.1:g.236304072del | XM_027965226.1:c.1716del | XP_027821027.1:p.(V573Wfs*119) | XM_027965226.1:c.1716delC | 2020 | 32933480 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC | ||
| 1602 | OMIA:002130-9544 | Rhesus monkey | Coat colour, oculocutaneous albinism | OCA2 | missense | Naturally occurring variant | yes | c.2363C>T | p.(S788L) | 2020 | 32259106 | ||||||||
| 846 | OMIA:002130-9615 | dog | German Spitz (Dog) | Coat colour, oculocutaneous albinism, OCA2-related | OCA2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 3 | g.31715704A>C | "LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G) . . . Comparative sequence analyses revealed that LOC100855460 actually represents the 5'-end of the canine OCA2 gene. The CanFam 3.1 reference genome assembly is incorrect and separates the first two exons from the remaining exons of the OCA2 gene. We amplified a canine OCA2 cDNA fragment by RT-PCR and determined the correct full-length mRNA sequence (LT844587.1)." | 2017 | 28973042 | |||||
| 288 | OMIA:000162-9913 | taurine cattle | Holstein Friesian (Cattle) Red Holstein, Switzerland (Cattle) | Cardiomyopathy, dilated | OPA3 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 18 | NC_037345.1:g.53152213G>A | NM_001245934.1:c.343C>T | NP_001232863.1:p.(Q115*) | UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 | rs479222100 | 2011 | 20923700 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 1141 | OMIA:002227-9940 | sheep | Istrska pramenka (Sheep) | Otocephaly | OTX2 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 7 | NC_040258.1:g.71478714G>A | XM_015097088.2:c.265C>T | XP_014952574.2:p.(R89*) | Paris et al. (2020): XM_015097088.2:c.265C > T | 2020 | 31969185 | |||
| 454 | OMIA:001564-9615 | dog | Greater Swiss Mountain Dog (Dog) | Bleeding disorder, P2RY12-related | P2RY12 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 23 | g.45909987_45909989del | c.516_518del | p.(S173del) | NM_001003365.1; NP_001003365.1; c.516_518delCTC; "a 3 base-pair deletion predicted to result in elimination of a serine from the extracellular domain was identified in the gene encoding P2RY12" | 2011 | 21554368 | |||
| 103 | OMIA:002031-9615 | dog | Lundehund (Dog) | Lundehund syndrome | P3H2 | missense | Naturally occurring variant | yes | CanFam3.1 | 34 | g.22046092C>G | c.1849G>C | p.(E617Q) | XM_535843.6; XP_535843.2 | 2016 | 27485430 | |||
| 428 | OMIA:001437-9913 | taurine cattle | Brown Swiss (Cattle) | Beta-lactoglobulin, aberrant low expression | PAEP | regulatory | Naturally occurring variant | yes | ARS-UCD1.2 | 11 | g.103255964C>A | c.-215C>A | "C to A transversion at position 215 bp upstream of the translation initiation site" | rs5334475105 | 2006 | 17033029 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 1605 | OMIA:001688-9796 | horse | Purebred Spanish (Horse) | Splashed white | PAX3 | SW10 | nonsense (stop-gain) | Naturally occurring variant | unknown | EquCab3.0 | 6 | NC_009149.3:g.11196181G>A | XM_005610643.3:c.583C>T | XP_005610700.1:p.(R195*) | XM_005610643.3; XP_005610700.1; association with increased depigmentation, published as c.927C>T | 2023 | 37406837 | ||
| 791 | OMIA:001688-9796 | horse | Lipizzan horse (Horse) Noric (Horse) Quarter Horse (Horse) | Splashed white | PAX3 | SW2 | missense | Naturally occurring variant | no | EquCab3.0 | 6 | NC_009149.3:g.11199026C>T | XM_001495160.4:c.209G>A | XP_001495210.1:p.(C70Y) | rs5334475189 | 2012 | 22511888 | Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 | |
| 978 | OMIA:001688-9796 | horse | Appaloosa (Horse) | Splashed white | PAX3 | SW4 | missense | Naturally occurring variant | no | EquCab3.0 | 6 | NC_009149.3:g.11199140G>C | XM_001495160.4:c.95C>G | XP_001495210.1:p.(P32R) | rs5334475206 | 2013 | 23659293 | ||
| 1659 | OMIA:001688-9685 | domestic cat | Maine Coon (Cat) | Blue eye colour, dominant | PAX3 | DBE^RE | nonsense (stop-gain) | Naturally occurring variant | no | F.catus_Fca126_mat1.0 | C1 | NC_051841.1:g.205787310G>A | XM_019838731.3:c.937C>T | XP_019694290.1:p.(Q313*) | 2024 | 38869246 | |||
| 1685 | OMIA:001688-9685 | domestic cat | Celestial Maine Coon (Cat) Siberian (Cat) | Blue eye colour, dominant | PAX3 | DBE^CEL | insertion, gross (>20) | Naturally occurring variant | no | Felis_catus 9.0 | C1 | NC_018730.3:g.206974029_206974030insN[395] | 2024 | 38644700 | |||||
| 1704 | OMIA:001688-9685 | domestic cat | Altai (Cat) British Longhair (Cat) British Shorthair (Cat) Persian (Cat) Ragdoll (Cat) Sphynx (Cat) | Blue eye colour, domianant | PAX3 | DBE^ALT | insertion, gross (>20) | Naturally occurring variant | unknown | Felis_catus 9.0 | C1 | NC_018730.3:g.206975776_206975777insN[433] | 2024 | 38997957 | |||||
| 583 | OMIA:001575-9615 | dog | Gordon Setter (Dog) Irish Setter (Dog) Old Danish Pointing Dog (Dog) Polish Lowland Sheepdog (Dog) Polish Tatra Sheepdog (Dog) Poodle, Miniature (Dog) Poodle, Standard (Dog) Tibetan Terrier (Dog) | Rod-cone dysplasia 4 | PCARE | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 17 | g.22907394_22907395insG | c.3149_3150insC | p.(C1051Vfs*90) | NM_001284459.1; NP_001271388.1; genomic position adjusted based on HGVS 3' rule; EVA variant with equivalent alleles: rs397510935 | rs1152388416 | 2013 | 22686255 | ||
| 1443 | OMIA:002548-9913 | taurine cattle | Holstein Friesian (Cattle) | Deficiency of haplotype HH35 | PCDH15 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 26 | NC_037353.1:g.5325675C>G | XM_059881970.1:c.2599C>G | XP_059737953.1:p.(L867V) | XM_015460562.2; XP_015316048.2 | rs469553146 | 2022 | 35361830 | ||
| 1515 | OMIA:002606-9615 | dog | Vizsla (Dog) | skeletal dysplasia 3 | PCYT1A | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 33 | g.30067814A>G | c.673T>C | p.Y225H | XM_038583131.1; XP_038439059.1 | 2022 | 36553621 | |||
| 1662 | OMIA:002728-9615 | dog | Saarloos Wolfhond (Dog) | PCYT2 deficiency | PCYT2 | missense | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 9 | g.1207490A>G | c.4A>G | p.(I2V) | XM_038546296.1; XP_038402224.1 | 2024 | 38277988 | |||
| 475 | OMIA:001314-9615 | dog | Cardigan Welsh Corgi (Dog) Chinese Crested (Dog) Pomeranian (Dog) | Rod-cone dysplasia 3 | PDE6A | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 4 | g.59145362del | c.1847del | p.(N616Tfs*29) | NM_001003073.1; NP_001003073.1; published as c.1940delA (based on GenBank Z68340); variant initially identified in Cardigan Welsh Corgi and later reported in additional breeds: PMID:27525650 | 1999 | 10393029 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 582 | OMIA:001669-9615 | dog | Sloughi (Dog) | Rod-cone dysplasia 1a | PDE6B | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91747685_91747686insACTTCAGG | c.2448_2449insTGAAGTCC | p.(K817*) | NM_001002934.2; NP_001002934.2; "an 8-bp insertion after codon 816" of the PDE6B gene | 2000 | 11124530 | |||
| 282 | OMIA:000882-9615 | dog | Irish Setter (Dog) | Rod-cone dysplasia 1 | PDE6B | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91747713C>T | c.2421G>A | p.(W807*) | NM_001002934.1; NP_001002934.1 | 1993 | 8387203 | |||
| 528 | OMIA:001674-9615 | dog | American Staffordshire Terrier (Dog) | Cone-rod dystrophy 1 | PDE6B | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91747728_91747730del | c.2404_2406del | p.(802del) | NM_001002934.1; NP_001002934.1 | 2013 | 24045995 | |||
| 1230 | OMIA:002282-9615 | dog | Spanish Water Dog (Dog) | PRA, PDE6B-related | PDE6B | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 3 | g.91749865_91749870del | c.2218-2223del | p.(F740_F741del) | NM_001002934.1; NP_001002934.1 | 2020 | 32639685 | |||
| 1022 | OMIA:002163-9544 | Rhesus monkey | Cone dystrophy 4, PDE6C-related | PDE6C | missense | Naturally occurring variant | yes | Mmul_8.0.1 | 9 | p.(R565Q) | 2019 | 30667376 | |||||||
| 281 | OMIA:001406-9615 | dog | Clumber Spaniel (Dog) Sussex Spaniel (Dog) | Pyruvate dehydrogenase deficiency | PDP1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 29 | g.38788845C>T | c.829C>T | p.(Q277*) | XM_005638127.1; XP_005638184.1; published as c.754C>T, p.(Q252*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2007 | 17095275 | |||
| 1461 | OMIA:002552-9940 | sheep | Pancreatic agenesis | PDX1 | deletion, gross (>20) | Genome-editing (CRISPR-Cas9) | yes | Oar_rambouillet_v1.0 | 10 | NC_040261.1:g.33940517_33940724del | XM_027973895.1:c.195_403del | XM_027973895.1; 208bp deletion | 2017 | 29234093 | |||||
| 1278 | OMIA:002303-9685 | domestic cat | Cerebral dysgenesis | PEA15 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | F1 | g.66768324del | c.176del | p.(N59Tfs*29) | XM_023247767.1; XP_023103535.1; published as felCat9 chrF1:66768323 GT -> G; c.176delA by Graff et al. (2020) | rs5334475160 | 2020 | 33290415 | |||
| 820 | OMIA:001827-9913 | taurine cattle | Montbéliarde (Cattle) Vorderwälder, Germany (Cattle) | Abortion due to haplotype MH1 | PFAS | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.27895397C>T | NM_001256564.1:c.3613C>T | NP_001243493.1:p.(R1205C) | rs455876205 | 2017 | 28803020 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 271 | OMIA:000421-9615 | dog | American Cocker Spaniel (Dog) English Springer Spaniel (Dog) Whippet (Dog) | Glycogen storage disease VII | PFKM | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 27 | g.6620819C>T | c.2228G>A | p.(W473*) | NM_001003199.1; NP_001003199.1 | 1996 | 8702726 | Genomic and protein coordinates in CanFam3.1 provided by Robert Kuhn | ||
| 45 | OMIA:000421-9615 | dog | Deutscher Wachtelhund (Dog) | Glycogen storage disease VII | PFKM | missense | Naturally occurring variant | yes | CanFam3.1 | 27 | g.6631627G>A | c.550C>T | p.(R184W) | NM_001003199.1; NP_001003199.1 | 2012 | 22446493 | Genomic coordinates in CanFam3.1 provided by Robert Kuhn and Zoe Shmidt. | ||
| 1288 | OMIA:001128-9823 | pig | Duroc (Pig) | Pale soft exudative meat | PHKG1 | splicing | Naturally occurring variant | yes | Sscrofa11.1 | 3 | g.16830320C>A | c.919-5C>A | ENSSSCT00000008491.4:c.919-5C>A Ma et al. 2014: "a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon" | rs330928088 | 2014 | 25340394 | |||
| 406 | OMIA:001953-9913 | taurine cattle | Belgian Blue (Cattle) | Arthrogryposis, lethal syndrome | PIGH | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 10 | NC_037337.1:g.79469727G>C | NM_001038116.2:c.211-10C>G | rs451004237 | 2015 | 25895751 | Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370 | |||
| 109 | OMIA:002084-9615 | dog | Soft Coated Wheaten Terrier (Dog) | Dyskinesia, paroxysmal, PIGN | PIGN | missense | Naturally occurring variant | yes | CanFam3.1 | 1 | g.14705240C>T | c.398C>T | p.(T133I) | XM_022415750.1; XP_022271458.1 | 2016 | 27891564 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1305 | OMIA:002324-9615 | dog | Parson Russell Terrier (Dog) | Epilepsy, mitochondrial dysfunction and neurodegeneration | PITRM1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 2 | g.32188565_32188570del | c.175_180del | p.(L59_S60del) | ENSCAFT00000008673; ENSCAFT00000008673.4 | 2021 | 33835239 | |||
| 232 | OMIA:000649-9940 | sheep | Texel (Sheep) | Microphthalmia | PITX3 | missense | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 22 | NC_040273.1:g.25497953C>G | NM_001178053.1:c.338G>C | NP_001171524.1:p.(R113P) | Oar_v3.1 position is g.22045744C>G | 2010 | 20084168 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1404 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^insG/+ | insertion, small (<=20) | Genome-editing (CRISPR-Cas9) | yes | 3 | c.152_153insG | 2022 | 34980882 | |||||||
| 1406 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^Tins/+ | insertion, small (<=20) | Genome-editing (ZFN) | yes | 3 | c.642_643insT | 2015 | 25798056 | |||||||
| 1405 | OMIA:000807-9823 | pig | Polycystic kidney disease | PKD1 | PKD1^TGCTins/+ | insertion, small (<=20) | Genome-editing (ZFN) | yes | 3 | c.642_643insTGCT | 2015 | 25798056 | |||||||
| 72 | OMIA:000807-9615 | dog | Bull Terrier (Dog) | Polycystic kidney disease | PKD1 | missense | Naturally occurring variant | yes | CanFam3.1 | 6 | g.38856816G>A | c.9559G>A | p.(E3187K) | rs397509460 | 2011 | 21818326 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1610 | OMIA:000807-9685 | domestic cat | Scottish Fold (Cat) | Polycystic kidney disease | PKD1 | delins, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | E3 | g.42848725del | c.5250del | p.(G1641fs) | variant reported in a single cat | 2023 | 37489504 | |||
| 1611 | OMIA:000807-9685 | domestic cat | American Shorthair (Cat) | Polycystic kidney disease | PKD1 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | E3 | g.42850283C>T | c.6808C>T | p.(R2162W) | variant reported in a single cat | 2023 | 37489504 | |||
| 314 | OMIA:000807-9685 | domestic cat | American Shorthair (Cat) Exotic Shorthair (Cat) Himalayan (Cat) Maine Coon (Cat) Munchkin (Cat) Persian (Cat) Ragdoll (Cat) Scottish Fold (Cat) Scottish Straight (Cat) Siberian (Cat) | Polycystic kidney disease | PKD1 | nonsense (stop-gain) | Naturally occurring variant | yes | Felis_catus_9.0 | E3 | g.42858112C>A | c.9882C>A | p.(C3294*) | This variant was published as c.10063C>A, p.(C3284*); positions in this table are based on NC_018738.3 and XP_023102816.1, respectively. | rs5334475162 | 2004 | 15466259 | The varaint has been initially identified in Persian cats but has since been reported in other breeds, e.g. PMID:31155548; PMID:37489504; PMID:35709088. | |
| 1585 | OMIA:000807-9615 | dog | Lagotto Romagnolo (Dog) | Polycystic kidney disease | PKD1 | nonsense (stop-gain) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 6 | g.39295382G>T | c.7195G>T | p.(E2399*) | NM_001006650.1; NP_001006651.1 | 2023 | 37372390 | |||
| 1523 | OMIA:002525-9823 | pig | PKD2 overexpression | PKD2 | insertion, gross (>20) | Genome-editing (CRISPR-Cas9) | yes | insertion of transgene vector pCAG-muhPKD2 (c.1532A > T/p.511D > V)-3 × FLAG-floxP-neo-pH11 into the pH11 safe harbor site | 2022 | 36452154 | |||||||||
| 1424 | OMIA:002525-9685 | domestic cat | Siberian (Cat) | Polycystic kidney disease 2 | PKD2 | deletion, small (<=20) | Naturally occurring variant | yes | Felis_catus_9.0 | B1 | g.134992553del | c.2211del | (p.K737Nfs*2) | XM_011281830.3; XP_011280132.2; published as c.2211delG | 2021 | 33785770 | |||
| 897 | OMIA:000844-9615 | dog | Basenji (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.42267825del | c.433del | p.(P145Rfs*23) | NM_001256262.1; NP_001243191.1 | 1994 | 7520391 | |||
| 896 | OMIA:000844-9615 | dog | Labrador Retriever (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.42268632C>T | c.799C>T | p.(Q267*) | NM_001256262.1; NP_001243191.1 | 2012 | 22805166 | 20181218 Thanks to Maarten de Groot for advising FN of the genomic location | ||
| 894 | OMIA:000844-9615 | dog | Pug (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.42268681T>C | c.848T>C | p.(V283A) | NM_001256262.1; NP_001243191.1 | 2012 | 22805166 | |||
| 895 | OMIA:000844-9615 | dog | Beagle (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | missense | Naturally occurring variant | yes | CanFam3.1 | 7 | g.42268927G>A | c.994G>A | p.(G332S) | NM_001256262.1; NP_001243191.1 | 2012 | 22805166 | |||
| 898 | OMIA:000844-9615 | dog | West Highland White Terrier (Dog) | Pyruvate kinase deficiency of erythrocyte | PKLR | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 7 | g.42269752_42269757dup | c.1333_1338dup | p.(K445_T446dup) | NM_001256018.1; NP_001242947.1; the original publication described "a 6 base pair insertion in exon 10". In accordance with HGVS recommendations, the variant is annotated in this table as a 6 bp duplication and updated a recent reference sequences. This shifts the position of the predicted amino acid change by about 21 amino acids. | 1999 | 10490091 | |||
| 899 | OMIA:000844-9685 | domestic cat | Abyssinian (Cat) Bengal (Cat) Caracal (Cat) Chausie (Cat) Egyptian Mau (Cat) European Shorthair (Cat) Highlander (Cat) Highlander Shorthair (Cat) LaPerm (Cat) Lykoi (Cat) Maine Coon (Cat) Maine Coon Polydactyl (Cat) Minuet Longhair (Cat) Munchkin (Cat) Neva Masquerade (Cat) Norwegian Forest Cat (Cat) Pixiebob Longhair (Cat) Savannah (Cat) Siberian (Cat) Singapura (Cat) Toyger (Cat) | Pyruvate kinase deficiency of erythrocyte | PKLR | splicing | Naturally occurring variant | yes | Felis_catus_9.0 | F1 | g.70310110G>A | c.707-53G>A | XM_023247386.1:c.707-53G>A; published as c.693+304G>A | rs5334475134 | 2012 | 23110753 | The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770); Grahn et al. (2012) reported that the variant is present in many breeds and suggested genotyping in Bengals, Egyptian Maus, La Perms, Maine Coon cats, Norwegian Forest cats, Savannahs, Siberians, and Singapuras. Additional breeds reported based on PMID:35709088. | ||
| 417 | OMIA:001864-9615 | dog | Chesapeake Bay Retriever (Dog) Golden Retriever (Dog) | Ectodermal dysplasia/skin fragility syndrome | PKP1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 7 | g.1966531C>G | c.202+1G>C | 2012 | 22384142 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||||
| 113 | OMIA:002105-9615 | dog | Papillon (Dog) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | missense | Naturally occurring variant | yes | CanFam3.1 | 10 | g.26544820G>A | c.1579G>A | p.(T527A) | 2017 | 28107443 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1267 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | nonsense (stop-gain) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 3 | g.230750869G>A | c.1186C>T | p.(Q396*) | Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. | 2021 | 33159255 | |||
| 1266 | OMIA:002105-9940 | sheep | Swaledale, United Kingdom of Great Britain and Northern Ireland (Sheep) | Neuroaxonal dystrophy, PLA2G6-related | PLA2G6 | splicing | Naturally occurring variant | unknown | Oar_rambouillet_v1.0 | 3 | NC_040254.1:g.230766713T>C | XM_004006987.4:c.336-2A>G | XP_012031020.2:p.(L71Wfs*3) | 2021 | 33159255 | ||||
| 339 | OMIA:001935-9913 | taurine cattle | Simmental (Cattle) | Zinc deficiency-like syndrome | PLD4 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 21 | g.69352995G>A | c.702G>A | p.(W234*) | UMD3.1 position is g.71001232G>A | rs378824791 | 2014 | 25052073 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. | |
| 351 | OMIA:002080-9615 | dog | Eurasier (Dog) | Epidermolysis bullosa, simplex, PLEC | PLEC | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 13 | g.37461941C>T | c.3947G>A | p.(W1316*) | CanFam3 chr13: g.37461941G>A; XM_539204.6:c.3947G>A; XP_539204.2:p.Trp1316Stop: | 2016 | 27878870 | Updated variant coordinates kindly provided by Tosso Leeb on 8 May 2020 | ||
| 412 | OMIA:002020-9615 | dog | Scottish Terrier (Dog) | Ligneous membranitis | PLG | splicing | Naturally occurring variant | yes | 1 | c.1256+2T>A | possibly NM_001286960.1 c.1262+2T>A; CanFam3.1 g.49514382A>T | 2015 | 26360520 | ||||||
| 1338 | OMIA:002020-9615 | dog | Maltese (Dog) | Ligneous membranitis | PLG | deletion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 1 | g.49534880_49540865del | c.-5645_49+292del | XM_005615560.1; a deletion of 5986 bp involving exon 1 and the flanking region | 2021 | 34370320 | ||||
| 1078 | OMIA:002195-9615 | dog | Welsh Springer Spaniel (Dog) | Cardiomyopathy, dilated, PLN-related | PLN | missense | Naturally occurring variant | yes | CanFam3.1 | 1 | g.58588129C>T | c.26G>A | p.(R9H) | NM_001003332.1; NP_001003332.1 | 2019 | 30794913 | c. coordinate kindly provided by Tosso Leeb | ||
| 165 | OMIA:001982-9796 | horse | Thoroughbred (Horse) Warmblood (Horse) | Fragile Foal Syndrome | PLOD1 | missense | Naturally occurring variant | yes | EquCab3.0 | 2 | NC_009145.3:g.39927817C>T | XM_001491331.6:c.2032G>A | XP_001491381.1:p.(G678R) | rs1136065234 | 2015 | 25637337 | rsID and Variant coordinates obtained from Zhang et al. (2020): "g.39927817C>T (rs1136065234; NC_009145.3, Equ-Cab3.0)" c. and p. coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 248 | OMIA:000770-9986 | rabbit | Chinchilla (Rabbit) | Tremor, X-linked | PLP1 | pt | missense | Naturally occurring variant | yes | X | T>A | 1994 | 7525875 | ||||||
| 82 | OMIA:000770-9615 | dog | Springer Spaniel (Dog) | Tremor, X-linked | PLP1 | missense | Naturally occurring variant | yes | CanFam3.1 | X | g.77200833A>C | c.110A>C | p.(H37P) | 1990 | 1723945 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1493 | OMIA:002578-9913 | taurine cattle | Holstein (black and white) (Cattle) | Mast cell tumour, congenital | PLP2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | X | NC_037357.1:g.87216480C>T | NM_203363.1:c.50C>T | NP_976239.1:p.(T17I) | NM_203363.1; XP_005642144.1 | 2022 | 36139188 | |||
| 697 | OMIA:000211-9615 | dog | Classic Merle | PMEL | M | insertion, gross (>20) | Naturally occurring variant | yes | 10 | "an insertion of a tRNA-derived SINE . . . . The insertion occurs at the boundary of intron 10 and exon 11 and is flanked by a 15-bp target site duplication . . . . The SINE insertion is in reverse orientation, with the 5' end closer to exon 11." Allele M (265-269bp); phenotype = Classic Merle = "standard" of Murphy et al. (2018) | 2006 | 16407134 | |||||||
| 1103 | OMIA:000211-9615 | dog | No Merle pattern - solid coat | PMEL | Mc | insertion, gross (>20) | Naturally occurring variant | no | 10 | Mc (208-230bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | |||||||
| 1104 | OMIA:000211-9615 | dog | No Merle pattern - solid coat | PMEL | Mc+ | insertion, gross (>20) | Naturally occurring variant | no | 10 | Mc+ (231-245bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | |||||||
| 1105 | OMIA:000211-9615 | dog | No Merle pattern - diluted - brownish hue | PMEL | Ma | insertion, gross (>20) | Naturally occurring variant | no | 10 | Ma (247-254bp); phenotype = No Merle pattern – diluted–brownish hue; = "cryptic" of Murphy et al. (2018) | 2018 | 30235206 | |||||||
| 1106 | OMIA:000211-9615 | dog | Muted, undefined, diluted - brownish hue | PMEL | Ma+ | insertion, gross (>20) | Naturally occurring variant | no | 10 | Ma+ (255-264bp); phenotype = Muted, undefined, diluted–brownish hue = "dilute" of Murphy et al. (2018) | 2018 | 30235206 | |||||||
| 1107 | OMIA:000211-9615 | dog | Minimal Merle, areas deleted to white, tweed | PMEL | Mh | insertion, gross (>20) | Naturally occurring variant | yes | 10 | Mh (269-277bp); phenotype = Minimal Merle, areas deleted to white, tweed = "harlequin" of Murphy et al. (2018) | 2018 | 30235206 | |||||||
| 1166 | OMIA:001544-9913 | taurine cattle | Rat-tail syndrome | PMEL | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.2 | 5 | g.57345302_57345304del | c.50_52del | p.(L19del) | rs385468954 | 2016 | 27037038 | ||||
| 903 | OMIA:001438-9796 OMIA:000733-9796 | horse | American Miniature Horse (Horse) Ardennes (Horse) Comtois (Horse) Icelandic Horse (Horse) Missouri Fox Trotter, Germany (Horse) Morgan (Horse) Rocky Mountain, United States of America (Bighorn sheep) Shetland Pony (Horse) | Coat colour, silver AND Multiple congenital ocular anomalies | PMEL | missense | Naturally occurring variant | no | EquCab3.0 | 6 | NC_009149.3:g.74569773G>A | NM_001163889.1:c.1849C>T | NP_001157361.1:p.(R617C) | NM_001163889.1; NP_001157361.1; previously listed in OMIA as g.73665304 and published a C (wild type) to T (Silver) transition, p.Arg618Cys, as well as p.(R625C); coordinates in this table have been updated to a recent reference genome and / or transcript | rs3448111155 | 2006 | 17029645 | The genomic position in EquCab3.0 was provided by Mary Katherine Easterwood, working under the guidance of Professor Ernie Bailey in April 2022. Breed information updated based on PMID: 38600096 | |
| 1054 | OMIA:002183-9823 | pig | Landrace (Pig) | Embryonic lethality | PNKP | missense | Naturally occurring variant | yes | Sscrofa11.1 | 6 | g.54880241T>C | p.(Q96R) | Derks et al. (2019): "deleterious missense mutation in the PNKP gene (6:g.54880241G>T), predicted to be strongly deleterious by SIFT (0.02) and PROVEAN (-2.9). The missense mutation causes a glutamine to arginine amino acid substitution (ENSSSCP00000003467:p.Gln96Arg)" | rs5334475176 | 2019 | 30875370 | |||
| 616 | OMIA:001588-9615 | dog | Golden Retriever (Dog) | Ichthyosis, PNPLA1-related | PNPLA1 | delins, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 12 | g.5417388_5417390delinsTACTACTA | c.1445_1447delinsTACTACTA | p.(N482Ifs*11) | NM_001290109.2; NP_001277038.2 | 2012 | 22246504 | |||
| 765 | OMIA:000827-9913 | taurine cattle | Brown Swiss (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) | Progressive degenerative myeloencephalopathy (Weaver syndrome) | PNPLA8 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 4 | NC_037331.1:g.49600585C>T | XM_005205444.4:c.1703G>A | XP_005205501.2:p.(S568N) | rs800397662 | 2016 | 26992691 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1470 | OMIA:000827-9615 | dog | Australian Shepherd (Dog) | hereditary ataxia | PNPLA8 | duplication | Naturally occurring variant | yes | CanFam3.1 | 18 | g.12143242_12143243dup | c.1169_1170dup | p.(H391Ffs*4) | XM_005630935.2; XP_005630992.1 | 2022 | 35864734 | |||
| 1052 | OMIA:002181-9823 | pig | Landrace (Pig) | Embryonic lethality | POLR1B | splicing | Naturally occurring variant | yes | Sscrofa11.1 | 3 | g.43952776T>G | Derks et al. (2019): "Skipping of exon 14 introduces a glutamic acid and a premature stop codon in the second codon of the terminal exon, lacking the final 370 amino acids located in the conserved subunit 2, hybrid-binding domain (binding to the DNA strand)" | rs5334475168 | 2019 | 30875370 | ||||
| 1291 | OMIA:002315-9615 | dog | Karelian Bear Dog (Dog) | Pituitary dwarfism | POU1F1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 31 | g.784534C>A | c.605-3C>A | Kyöstilä et al. (2021) "the NNSPLICE 0.9 splice prediction tool (Reese et al. 1997) predicted this variant to weaken the splice acceptor of POU1F1 intron 4 from a score of 0.97 to 0.67." | 2021 | 33550451 | ||||
| 157 | OMIA:000327-9796 | horse | Quarter Horse (Horse) | Ehlers-Danlos syndrome | PPIB | missense | Naturally occurring variant | yes | EquCab3.0 | 1 | NC_009144.3:g.129307092G>A | NM_001099761.1:c.115G>A | NP_001093231.1:p.(G39R) | rs396329681 | 2007 | 17498917 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 588 | OMIA:000161-9913 | taurine cattle | Polled Hereford (Cattle) | Cardiomyopathy and woolly haircoat syndrome | PPP1R13L | duplication | Naturally occurring variant | yes | ARS-UCD1.2 | 18 | g.53013747_53013753dup | c.956-962dupACAGGCG | p.(G335Efs*36) | 2009 | 19016676 | Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | |||
| 423 | OMIA:001504-9615 | dog | Italian Cane Corso (Dog) | Neuronal ceroid lipofuscinosis, 1 | PPT1 | splicing | Naturally occurring variant | yes | CanFam3.1 | 15 | g.2860424G>A | c.124+1G>A | 2017 | 28008682 | |||||
| 1068 | OMIA:001311-9615 | dog | Miniature Schnauzer (Dog) | Photoreceptor dysplasia | PPT1 | PPT1^dci | complex rearrangement | Naturally occurring variant | yes | CanFam3.1 | 15 | g.2874661_2875048con2877563_2877607inv | 2019 | 30541930 | |||||
| 579 | OMIA:001504-9615 | dog | Dachshund (Dog) | Neuronal ceroid lipofuscinosis, 1 | PPT1 | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.2883477_2883478insC | c.736_737insC | p.(F246Lfs*29) | NM_001010944.1; NP_001010944.1 | 2010 | 20494602 | p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017; genomic coordinates in CanFam3.1 provided by Zoe Shmidt and Robert Kuhn. | ||
| 1353 | OMIA:001504-9940 | sheep | Neuronal ceroid lipofuscinosis, 1 | PPT1 | delins, small (<=20) | Genome-editing (CRISPR-Cas9) | yes | Oar_rambouillet_v1.0 | 1 | NC_040252.1:g.15235231_15235231delinsTTA | XP_004001885.2:p.(R151X) | 2019 | 31289301 | ||||||
| 76 | OMIA:001298-9615 | dog | American Cocker Spaniel (Dog) Australian Cattle Dog (Dog) Australian Shepherd (Dog) Australian Stumpy Tail Cattle Dog (Dog) Chesapeake Bay Retriever (Dog) Chihuahua (Dog) Chinese Crested (Dog) English Cocker Spaniel (Dog) Entlebucher Mountain Dog (Dog) Finnish Lapphund (Dog) Golden Retriever (Dog) Karelian Bear Dog (Dog) Kuvasz (Dog) Labrador Retriever (Dog) Lapponian Herder (Dog) Norwegian Elkhound (Dog) Nova Scotia Duck Tolling Retriever (Dog) Poodle, Miniature (Dog) Poodle, Toy (Dog) Portuguese Podengo (Dog) Portuguese Water Dog (Dog) Spanish Water Dog (Dog) Swedish Lapphund (Dog) Swedish White Elkhound (Dog) Yorkshire Terrier (Dog) | Progressive rod-cone degeneration | PRCD | missense | Naturally occurring variant | yes | CanFam3.1 | 9 | g.4188663C>T | c.5G>A | p.(C2Y) | ENSCAFT00845030294.1; ENSCAFP00845023755.1; ROS_Cfam_1.0:g.4864649C>T; Portuguese Podengo and Swedish White Elkhound were reported in PMID: 37582787 | rs852451717 | 2006 | 16938425 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1553 | OMIA:002693-9940 | sheep | Cheviot (Sheep) | Achondroplasia, PRICKLE1-related | PRICKLE1 | deletion, small (<=20) | Naturally occurring variant | yes | 3 | 10 bp deletion in the open reading frame | 2016 | Reference not in PubMed; see OMIA 002693-9940 for reference details | |||||||
| 175 | OMIA:001085-9823 | pig | Meat quality (Rendement Napole) | PRKAG3 | RN- | missense | Naturally occurring variant | yes | Sscrofa11.1 | 15 | g.120863533C>T | c.749G>A | p.(R250Q) | The paper by Milan et al. (2000) reported this variant as c.599G>A and p.R200Q | rs1109104772 | 2000 | 10818001 | The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020) | |
| 176 | OMIA:001085-9823 | pig | Meat quality (Rendement Napole) | PRKAG3 | RN- | missense | Naturally occurring variant | yes | Sscrofa11.1 | 15 | g.120863537C>T | c.745G>A | p.(I249V) | rs1108399077 | 2001 | 11729159 | he genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020) | ||
| 283 | OMIA:000220-9615 | dog | Jack Russell Terrier (Dog) | Severe combined immunodeficiency disease, autosomal | PRKDC | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 29 | g.49588C>A | c.10849G>T | p.(E3617*) | NM_001006651.2; NP_001006652.2 ; published as c.10879G>T; p.(E3627*); coordinates in the table have been updated to a recent reference genome and / or transcript | 2002 | 11867233 | |||
| 511 | OMIA:000220-9796 | horse | Arab (Horse) | Severe combined immunodeficiency disease, autosomal | PRKDC | deletion, small (<=20) | Naturally occurring variant | yes | EquCab3.0 | 9 | NC_009152.3:g.36395752_36395756del | NM_001163858.1:c.9478_9482del | NP_001157330.1:p.(N3160fs*3) | A 5bp deletion giving rise to a frameshift in PRKDC The following details (from which the coordinate fields were populated) were provided by Meredith O’Connell, Tanya German, Isabella Pisani and Karalie Andrews, under the supervision of Professor Ernie Bailey. 20 Feb 2019 NC_009152.3 g.36395752-36395976del; NM_001163858 c.9478_9482del; NP_001157330 p.N3160fs*3. The g. coordinates were previously listed incorrectly in this table as g.36395752_36395759del [03/06/2024] |
1997 | 9103416 | |||
| 291 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.2 | 6 | g.95896205G>A | c.1573C>T | p.(R525*) | rs109639251 | 2009 | 19887637 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 352 | OMIA:001485-9913 | taurine cattle | Angus (Cattle) | Dwarfism, Angus | PRKG2 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 6 | NC_037333.1:g.95896205G>A | NM_001144099.1:c.2032C>T | NP_001137571.1:p.(R678*) | ENSBTAT00000003877.4:c.2032C>T ENSBTAP00000003877.4:p.Arg678Ter | rs109639251 | 2009 | 19887637 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | |
| 1373 | OMIA:001485-9615 | dog | Dogo Argentino (Dog) | Dwarfism, disproportionate | PRKG2 | splicing | Naturally occurring variant | yes | CanFam3.1 | 32 | g.5299068C>A | c.1634+1G>T | cDNA position based on XM_022413533.1 | 2021 | 34680883 | ||||
| 719 | OMIA:000380-9031 | chicken | Feathering, Z-linked | PRLR | duplication | Naturally occurring variant | no | Z | The tandem duplication of this region results in the partial duplication of two genes; the prolactin receptor and the gene encoding sperm flagellar protein 2. | 2008 | 18713476 | ||||||||
| 1447 | OMIA:001372-9913 | taurine cattle | Criollo Lechero Tropical, Costa Rica (Cattle) | Slick hair | PRLR | SLICK4 | nonsense (stop-gain) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099113C>G | NM_001039726.2:c.1281C>G | NP_001034815.1:p.(Y427*) | 2021 | 33259090 | |||
| 544 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK1 | deletion, small (<=20) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099214del | NM_001039726.2:c.1382del | NP_001034815.1:p.(A461Vfs*2) | rs517047387 | 2014 | 25519203 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of Sharma et al. (2017) Animal Genetics 48(3):369-370, breed infromation updated based on PMID:39377537 | |
| 974 | OMIA:001372-9913 | taurine cattle | Carora, Venezuela (Bolivarian Republic of) (Cattle) Criollo Lechero Tropical, Costa Rica (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK3 | nonsense (stop-gain) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099226C>A | NM_001039726.2:c.1394C>A | NP_001034815.1:p.(S465*) | rs5334474999 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 | |
| 1448 | OMIA:001372-9913 | taurine cattle | Blanco Orejinegro, Colombia (Cattle) Carora, Venezuela (Bolivarian Republic of) (Cattle) Chino Santandereano, Colombia (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK5 | nonsense (stop-gain) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099228A>T | NM_001039726.2:c.1396A>T | NP_001034815.1:p.(K466*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 1449 | OMIA:001372-9913 | taurine cattle | Carora, Venezuela (Bolivarian Republic of) (Cattle) Costeno con Cuernos (Cattle) Criollo Caqueteño, Colombia (Cattle) Criollo Lechero Tropical, Costa Rica (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) Senepol (Cattle) Tropicarne, Mexico (Cattle) | Slick hair | PRLR | SLICK6 | nonsense (stop-gain) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099267C>T | NM_001039726.2:c.1435C>T | NP_001034815.1:p.(Q479*) | 2021 | 33259090 | Breed infromation updated based on PMID:39377537 | ||
| 975 | OMIA:001372-9913 | taurine cattle | Carora, Venezuela (Bolivarian Republic of) (Cattle) Casanareño, Colombia (Cattle) Chino Santandereano, Colombia (Cattle) Hartón del Valle, Colombia (Cattle) Limonero, Venezuela (Bolivarian Republic of) (Cattle) Romosinuano, Venezuela (Bolivarian Republic of) (Cattle) | Slick hair | PRLR | SLICK2 | nonsense (stop-gain) | Naturally occurring variant | no | ARS-UCD1.3 | 20 | NC_037347.1:g.39099321C>T | NM_001039726.2:c.1489C>T | NP_001034815.1:p.(R497*) | rs5334474702 | 2018 | 29527221 | Breed infromation updated based on PMID:39377537 | |
| 1507 | OMIA:000944-447135 | Bank vole | Susceptibility to atypical scrapie | PRNP | missense | Naturally occurring variant | yes | p.(M109I) | 2022 | 35731839 | |||||||||
| 698 | OMIA:001515-9615 | dog | Great Dane (Dog) | Colorectal hamartomatous polyposis and ganglioneuromatosis | PTEN | insertion, gross (>20) | Naturally occurring variant | yes | 26 | "Duplication of PTEN" | 2011 | 20952721 | |||||||
| 988 | OMIA:002196-9615 | dog | Doberman Pinscher (Dog) | Deafness, unilateral and vestibular dysfunction | PTPRQ | insertion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 15 | g.22989897_22989898insA | c.9230_9231insA | p.(N3077Kfs*24) | XM_022428131.1; XP_022283839.1; published as an A insertion at CFA15: 22 989 894 and p.(N2032Kfs*24) based on ENSCAFT00000009346.4 - renamed due to HGVS 3'rule and RefSeq IDs | 2018 | 29460419 | |||
| 1688 | OMIA:001139-9913 | taurine cattle | Red Angus (Cattle) | Glycogen storage disease V | PYGM | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 29 | NC_037356.1:g.42989581G>A | NM_175786.2 c.1948C>T | NP_786980.1:p.(R650*) | published as c.2257C>T in ARS-UCD1.2 | 2024 | 38678201 | |||
| 193 | OMIA:001139-9913 | taurine cattle | Charolais (Cattle) | Glycogen storage disease V | PYGM | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 29 | NC_037356.1:g.42991370G>A | NM_175786.2:c.1468C>T | NP_786980.1:p.(R490W) | rs5334475023 | 1996 | 8845714 | Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 | ||
| 388 | OMIA:001139-9940 | sheep | Merino (Sheep) | Glycogen storage disease V | PYGM | splicing | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 21 | NC_040272.1:g.44787090C>T | NM_001009192.2:c.2380-1G>A | a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 | rs402505013 | 1997 | 9267848 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | ||
| 1689 | OMIA:002848-9913 | taurine cattle | Brown Swiss (Cattle) | Spermatogenic failure, QRICH2-related | QRICH2 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 19 | NC_037346.1:g.55436710del | XM_002696205.5:c.4929del | XP_002696251.3:C1644Afs*52 | Coordinates in this table consider 3' rule of HGVS recommendation | 2022 | 35255804 | |||
| 88 | OMIA:001913-9615 | dog | Gordon Setter (Dog) Old English Sheepdog (Dog) | Ataxia, cerebellar, in Old English Sheepdogs and Gordon Setters | RAB24 | missense | Naturally occurring variant | yes | CanFam3.1 | 4 | g.36055678A>C | c.113A>C | p.(Q38P) | XM_005619162.3; XP_005619219.1 | 2014 | 24516392 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 730 | OMIA:001970-9615 | dog | Alaskan Husky (Dog) | Polyneuropathy, ocular abnormalities and neuronal vacuolation | RAB3GAP1 | insertion, gross (>20) | Naturally occurring variant | yes | CanFam3.1 | 19 | g.37903870_37903871insN[218] | c.614_615insN[218] | XM_851254.3; published as 218 bp SINE insertion in exon 7; sequence of the mutant allele was submitted to ENA (accession LN864704); transcript analysis identified a new internal splice acceptor site within the SINE insertion resulting in a novel “exon 7” | 2015 | 26596647 | ||||
| 546 | OMIA:001970-9615 | dog | Black Russian Terrier (Dog) Rottweiler (Dog) | Polyneuropathy, ocular abnormalities and neuronal vacuolation | RAB3GAP1 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 19 | g.37908634del | c.743del | p.P248Lfs*4 | XM_022406115.1; XP_022261823.1, published as c.743delC | rs851283827 | 2016 | 26607784 | Genomic coordinates in CanFam3.1 and EVA ID provided by Zoe Shmidt and Robert Kuhn. | |
| 221 | OMIA:002037-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RABGGTB | RABGGTB | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 3 | NC_037330.1:g.69060748T>C | NM_001015646.1:c.584A>G | NP_001015646.1:p.(Y195C) | ENSBTAT00000024551.6:c.584A>G ENSBTAP00000024551.6:p.Tyr195Cys | rs1118263722 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |
| 1123 | OMIA:001547-9031 | chicken | Wingless-2 | RAF1 | nonsense (stop-gain) | Naturally occurring variant | yes | GRCg6a | 12 | g.5374854G>A | c.175C>T | p.(R59*) | NC_006099.5:g.5374854G>A ENSGALT00000033956.3:c.175C>T ENSGALP00000033314.3:p.Arg59Ter | rs314452077 | 2019 | 31075853 | |||
| 284 | OMIA:001574-9615 | dog | Frisian Water Dog (Dog) | Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive | RAG1 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.31631772C>A | c.2893G>T | p.(E965*) | 2011 | 21293384 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1621 | OMIA:002763-9541 | crab-eating macaque | Severe combined immunodeficiency disease | RAG1 | nonsense (stop-gain) | Base-editing | yes | Macaca_fascicularis_5.0 | 14 | g.30840789G>T | c.181C>T | p.(Q61*) | XM_005578172.2; XP_005578229.1 | 2023 | 37661226 | ||||
| 1613 | OMIA:002757-9615 | dog | Belgian Shepherd Dog (Dog) | Ataxia, cerebellar, RALGAPA1-related | RALGAPA1 | deletion, gross (>20) | Naturally occurring variant | unknown | UU_Cfam_GSD_1.0 | 8 | g.14468376_14473136del | c.6080-2893_6944+1003del | p.(V2027Qfs*7) | XM_038544497.1; XP_038400425.1; published as g.14,468,376_14,473,136del4761 | 2023 | 37628572 | |||
| 1369 | OMIA:002458-9796 | horse | Thoroughbred (Horse) | Hypoparathyroidism | RAPGEF5 | nonsense (stop-gain) | Naturally occurring variant | yes | EquCab3.0 | 4 | NC_009147.3:g.54108297G>T | XM_023639352.1:c.2624C>A | XP_023495120.1:p.(S875*) | 2020 | 32986719 | ||||
| 209 | OMIA:002433-9913 | taurine cattle | Simmental (Cattle) | Thrombopathia | RASGRP2 | missense | Naturally occurring variant | yes | ARS-UCD1.3 | 29 | NC_037356.1:g.42978791A>G | NM_001099946.1:c.701T>C | NP_001093416.1:p.(L234P) | rs385444696 | 2007 | 18039909 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 585 | OMIA:002433-9615 | dog | American Eskimo Dog (Dog) | Thrombopathia | RASGRP2 | duplication | Naturally occurring variant | yes | CanFam3.1 | 18 | g.52417256dup | c.452dup | p.(D151Efs) | XM_849829.5; XP_854922.1; published as c.452-453insA | 2007 | 17656327 | |||
| 477 | OMIA:002433-9615 | dog | Basset Hound (Dog) | Thrombopathia | RASGRP2 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.52417313_52417315del | c.509_511del | p.(F170del) | XM_849829.5; XP_854922.1 | 2007 | 17656327 | |||
| 285 | OMIA:002433-9615 | dog | Landseer (Dog) | Thrombopathia | RASGRP2 | nonsense (stop-gain) | Naturally occurring variant | yes | CanFam3.1 | 18 | g.52419245C>T | c.982C>T | p.(R328*) | XM_849829.5; XP_854922.1 | 2007 | 17656327 | |||
| 1323 | OMIA:002365-9615 | dog | Giant Schnauzer (Dog) Schnauzer, Standard (Dog) | Cardiomyopathy, dilated | RBM20 | deletion, gross (>20) | Naturally occurring variant | yes | 28 | 22 bp deletion and frame shift in exon 11 of RBM20 | 2014 | Reference not in PubMed; see OMIA 002365-9615 for reference details | |||||||
| 913 | OMIA:000876-9031 | chicken | Riboflavinuria | RBP | splicing | Naturally occurring variant | yes | 8 | A "deletion in the rd ribBP cDNA correspond[ing] precisely to an exon. The splice site following this exon contains a G-->A mutation at position 1 of the downstream 5'-splice donor sequence. | 1993 | 8226844 | ||||||||
| 993 | OMIA:002151-9615 | dog | Irish Soft Coated Wheaten Terrier (Dog) | Microphthalmia, isolated, with coloboma | RBP4 | deletion, small (<=20) | Naturally occurring variant | yes | CanFam3.1 | 28 | g.7830265_7830267del | c.90_92del | p.(K31del) | XM_534969.6; XP_534969.3; published as c.282_284delGAA and p.(K30del); coordinates in the table have been updated to a recent reference genome and transcript, and are in accordance with the HGVS 3'-rule | 2018 | 29847795 | |||
| 710 | OMIA:001260-9615 | dog | Collie (Dog) | Rod-cone dysplasia 2 | RD3 | insertion, gross (>20) | Naturally occurring variant | yes | 7 | "22 bp insertion changes the last 61 amino acids of the encoded protein" | 2009 | 19130129 | |||||||
| 1377 | OMIA:002469-9685 | domestic cat | Retinopathy | RDH5 | missense | Naturally occurring variant | yes | Felis_catus_9.0 | B4 | g.84417264G>T | c.542G>T | p.(G181V) | XM_019835050.1; XP_019690609.1 | 2021 | 34726233 | Genomic position in Felis_catus_9.0 provided by Joshua Khamis. | |||
| 1663 | OMIA:001867-9940 | sheep | Lissencephaly and cerebellar hypoplasia | RELN | unpublished | unknown | Entry has been created to generate an OMIAvariantID for a variant that is currently in the process of being published. Information will be updated once manuscript has been published. | 2024 | Reference not in PubMed; see OMIA 001867-9940 for reference details | ||||||||||
| 673 | OMIA:001867-9940 | sheep | Spanish Churro (Sheep) | Lissencephaly and cerebellar hypoplasia | RELN | deletion, gross (>20) | Naturally occurring variant | yes | Oar_rambouillet_v1.0 | 4 | NC_040255.1:g.50313243_50313273del | NM_001306121.1:c.5410_5440del | A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) | 2013 | 24260534 | The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. | |||
| 1580 | OMIA:001867-9615 | dog | White Swiss Shepherd Dog (Dog) | Lissenecephaly and cerebellar hypoplasia | RELN | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 18 | g.16909944del | c.2839del | p.(V947*) | XM_038562771.1; XP_038418699.1; reported as g.16909942TG>T - information in this table has been updated to reflect HGVS nomenclature. | 2023 | 37334487 | |||
| 1717 | OMIA:002873-9913 | taurine cattle | Normande (Cattle) | Haplotype with homozygous deficiency, RFC5-related | RFC5 | deletion, small (<=20) | Naturally occurring variant | yes | ARS-UCD1.3 | 17 | NC_037344.1:g.57188407_57188409del | NM_001075358.1:c.573_575del | NP_001068826.1:p.(E192del) | Published as ENSBTAT00000085991.1:p.E369del | rs5366807285 | 2023 | Reference not in PubMed; see OMIA 002873-9913 for reference details | ||
| 29 | OMIA:001346-9615 | dog | English Mastiff (Dog) | Autosomal dominant PRA | RHO | missense | Naturally occurring variant | yes | CanFam3.1 | 20 | g.5637394G>C | c.11C>G | p.(T4R) | 2002 | 11972042 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | |||
| 1709 | OMIA:002865-9986 | rabbit | New Zealand White (Rabbit) | Cerebral palsy, RHOB-related | RHOB | missense | Genome-editing (CRISPR-Cas9) | yes | OryCun2.0 | 2 | NC_013670.1:g.169569191_169569192delinsTT | XM_008254781.2:c.218_219delinsTT | XP_008253003.1:p.(S73F) | 2024 | 39080495 | ||||
| 1442 | OMIA:002547-9913 | taurine cattle | Holstein-Friesian, Switzerland (Cattle) | Haplotype HH25 deficiency | RIOX1 | deletion, gross (>20) | Naturally occurring variant | yes | ARS-UCD1.2 | 10 | g.84938408_84938437del | c.396_425del | p.(A133_E142del) | NM_001099702.1; NP_001093172.1; published as c.396_425delGGCGCAGACCCCGGCGGCACGCTTGGTGGA | 2022 | 35361830 | |||
| 676 | OMIA:001901-9913 | taurine cattle | Nordic Red (Cattle) | Abortion due to deletion of RNASEH2B | RNASEH2B | deletion, gross (>20) | Naturally occurring variant | yes | UMD3.1 | 12 | g.20100648_20763119del | A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality. | 2014 | 24391517 | Genomic position gained from Mesbah-Uddin et al. (2021) - structural variant id esv4015629 (Database of Genomic Variants archive extracted from Ensembl release 94 - http://ftp.ensembl.org/pub/release-94/). | ||||
| 376 | OMIA:001686-9913 | taurine cattle | Belgian Blue (Cattle) | Dwarfism, proportionate, with inflammatory lesions | RNF11 | splicing | Naturally occurring variant | yes | ARS-UCD1.3 | 3 | NC_037330.1:g.95015373T>C | NM_001077953.1:c.124-2A>G | NM_001077953.1 | rs3423159409 | 2012 | 22438830 | Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) | ||
| 1726 | OMIA:002876-9615 | dog | Miniature American Shepherd (Dog) | Neuroaxonal dystrophy, RNF170-related | RNF170 | deletion, small (<=20) | Naturally occurring variant | yes | UU_Cfam_GSD_1.0 | 16 | NC_049237.1:g.23653872del | XM_038559916.1:c.367del | XP_038415844.1:p.(A123Qfs*11) | 2024 | 39177409 | ||||
| 344 | OMIA:002038-9913 | taurine cattle | Holstein Friesian (Cattle) | Abortion (embryonic lethality), RNF20 | RNF20 | nonsense (stop-gain) | Naturally occurring variant | yes | ARS-UCD1.3 | 8 | NC_037335.1:g.91297797A>T | NM_001081587.1:c.2077A>T | NP_001075056.1:p.(K693*) | rs5334474936 | 2016 | 27646536 | Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool | ||
| 1297 | OMIA:002317-9986 | rabbit | Sauteur d'Alfort | Sauteur | RORB | s^am | splicing | Naturally occurring variant | yes | OryCun2.0 | 1 | g.61103503G>A | This variant corresponds to a change from GT to AT in the 5’ donor site of intron 9 (Carneiro et al., 2021) | rs3166922596 | 2021 |