Search Results

Advanced search

1315 variant records found

[show instead phene records]

By default, variants are sorted chronologically by year of publication, to provide a historical perspective. Readers can re-sort on any column by clicking on the column header. Click it again to sort in a descending order. To create a multiple-field sort, hold down Shift while clicking on the second, third etc relevant column headers.

WARNING! Inclusion of a variant in this table does not automatically mean that it should be used for DNA testing. Anyone contemplating the use of any of these variants for DNA testing should examine critically the relevant evidence (especially in breeds other than the breed in which the variant was first described). If it is decided to proceed, the location and orientation of the variant sequence should be checked very carefully.

OMIA ID(s) Species Name Breed(s) Variant Phenotype Gene Allele Type of Variant Deleterious? Reference Sequence Chr. g. or m. c. or n. p. Verbal Description EVA ID Inferred EVA rsID Year Published PubMed ID(s) Acknowledgements
OMIA 000042-9031 chicken Wisconsin hypoalpha mutant (WHAM) Analphalipoproteinaemia ABCA1 missense yes GalGal5 Z g.54792686G>A c.265G>A p.(E89K) 2002 12364545 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 002238-9913 cattle Shorthorn Ichthyosis, ABCA12-related ABCA12 missense yes ARS-UCD1.2 2 g.103016791T>C c.6776T>C p.(L2259P) NM_001191294.2:c.6776T>C; NP_001178223.2:p.(Leu2259Pro) 2019 31568573
OMIA 002238-9913 cattle Poll Hereford Ichthyosis, ABCA12-related ABCA12 insertion, small (<=20) yes ARS-UCD1.2 2 g.103043495_103043496insC c.5689_5690insC p.(S1784Ifs*33) BTA 2:103043495–103043496insC; ENSBTAT00000004518.6:c.5689‐5690insC; ENSBTAP00000004518.6:p.(Ser1784Ilefs*33) (Eager et al., 2020) ss7094285003 2020 32567073
OMIA 002238-9913 cattle Chianina Ichthyosis, ABCA12-related ABCA12 missense yes UMD3.1 2 g.103543077A>G c.5,804A>G p.(H1935R) 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002179-9615 dog Labrador Retriever Stargardt disease 1 ABCA4 insertion, small (<=20) yes CanFam3.1 6 g.55146549insC c.4176insC p.(F1393Lfs*3) Mäkeläinen et al. (2019): "ENSCAFT00000005367 exon28 4170dupC* V1390fs" Importantly, the same authors also explain in Table S3 that "*The insertion is found in a cytosine mononucleotide-repeat region [55,146,550–55,146,556] and it is arbitrary at what position the actual insertion occurs. In the text we have denoted the insertion as c.4176insC, p.F1393Lfs*1395)." 2019 30889179
OMIA 001402-9615 dog Border Collie Adverse reaction to certain drugs ABCB1 regulatory no 14 c.-6-180T>G 2011 21488961
OMIA 001402-9685 domestic cat Adverse reaction to certain drugs ABCB1 deletion, small (<=20) yes A2 c.1930_1931del TC ABCB11930_1931del TC (cDNA reference sequence NM_001171064.2) within exon 15 results in a frameshift generating a series of stop codons immediately downstream from the deletion. The protein product is predicted to be severely truncated (~50%) and non functional. (Mealey and Burke, 2015) 2015 25660379
OMIA 001402-9615 dog Australian Shepherd Border Collie Collie German Shepherd Dog Longhaired whippet Miniature Australian shepherd Old English Sheepdog Shetland Sheepdog Silken windhound Waller White Swiss shepherd Adverse reaction to certain drugs ABCB1 deletion, small (<=20) yes 14 c.295_298delAGAT p.(D75fs) 2001 11692082 Variant information gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005
OMIA 001402-9615 dog Border Collie Adverse reaction to certain drugs ABCB1 insertion, small (<=20) yes 14 c.73insAAT 2010 21113104
OMIA 001524-9615 dog Shetland Sheepdog Gallbladder mucoceles ABCB4 insertion, small (<=20) yes 14 c.1583_1584G 2010 20598156
OMIA 001089-9542 Japanese macaque Antigen B ABO haplotype no Allele B reflects the peptide haplotype p.266Met + p.268Ala 2000 10984838
OMIA 001089-9541 crab-eating macaque A antigen ABO haplotype no p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
OMIA 001089-9544 Rhesus monkey Antigen A ABO haplotype no p.266L + p.268G Allele A is reflected in the peptide haplotype p.266Leu + p.268Gly 1998 9583803
OMIA 001089-9544 Rhesus monkey Antigen B ABO haplotype no p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
OMIA 001089-9541 crab-eating macaque B antigen ABO haplotype unknown p.266M + p.268A Allele B is a reflection of the peptide haplotype p.266Met + p.268Ala 1998 9583803
OMIA 001089-9579 agile gibbon Alleles A and B ABO missense no c.2178C>A and c.2185G>C Haplotype c.2178C + c.2185G is allele A; haplotype c.2178A + c.2185C is allele B 2009 19298858
OMIA 001089-9580 common gibbon Blood group system ABO ABO missense no c.2178C>A and c.2185G>C 2009 19298858
OMIA 001089-9598 chimpanzee O (lack of antigen) ABO O^del deletion, small (<=20) no c.514_522delGTGCTGGAG p.(V172-E174del) 1999 10380696
OMIA 001089-9598 chimpanzee O (lack of antigen) ABO O^x missense no c.791A>C p.(Y264C) 1999 10380696
OMIA 002140-9615 dog German Hunting Terrier Exercise induced metabolic myopathy ACADVL nonsense (stop-gain) unknown CanFam3.1 5 g.32193689C>A c.1728C>A p.(Y576*) 2018 29491033
OMIA 001271-9796 horse Miniature Dwarfism, ACAN-related ACAN D4 deletion, small (<=20) yes EquCab3.0 1 g.95257458_95257500del p.(F2017_D2023del) rs1095048839 2018 30058072
OMIA 001271-9796 horse Miniature Shetland Dwarfism, ACAN-related ACAN D3* missense yes EquCab3.0 1 g.95282140C>G p.(A505P) This variant was named D3* by Eberth et al. (2018) rs1095048823 2017 27942904 Variant coordinates obtained from Eberth et al. (2018)
OMIA 001271-9796 horse Miniature Dwarfism, ACAN-related ACAN D2 missense yes EquCab3.0 1 g.95284530C>T p.(V424M) 2018 30058072
OMIA 001271-9796 horse Miniature Dwarfism, ACAN-related ACAN D1 deletion, small (<=20) yes EquCab3.0 1 g.95291270del p.(K82fs) rs1095048841 2018 30058072
OMIA 000702-9031 chicken Nanomelia ACAN nonsense (stop-gain) yes GalGal4 10 g.12554157G>T c.4537G>T p.(E1513*) 1994 7827752 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001271-9913 cattle Dexter Bulldog calf ACAN BD2 regulatory yes UMD3.1 21 g.20800319C>T c.-198C>T 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001271-9913 cattle Dexter Scottish Highland Bulldog calf ACAN BD1 insertion, small (<=20) yes UMD3.1 21 g.20844569_20844570insGGCA c.2266_2267insGGCA 2007 17952705 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001271-9913 cattle Miniature Zebu Bulldog calf ACAN insertion, small (<=20) yes UMD3.1 21 g.20851004_20851005insC c.5688_5689insC p.(V1897fs*9) cDNA position based on transcript NM_173981.2 2018 30305023
OMIA 002177-9615 dog Akita American Akita Amelogenesis imperfecta, ACP4-related ACPT insertion, small (<=20) yes CanFam3.1 1 c.1189dupG p.(A397Gfs) 2019 30877375
OMIA 002226-9615 dog Australian Kelpie Intestinal lipid malabsorption ACSL5 deletion, gross (>20) yes CanFam3.1 28 g.23380074_23483377del NC_006610.3CFA28:g.23380074_23483377del (O/Brien et al., 2020) 2020 33106515
OMIA 000388-9685 domestic cat Domestic Shorthair Fibrodysplasia ossificans progressiva ACVR1 missense yes Felis_catus_9.0 C1 c.617G>A p.(R206H) Casal et al. (2019): NC_018730.3. 2019 31007133
OMIA 001520-9615 dog Glen of Imaal Terrier Cone-rod dystrophy 3 ADAM9 deletion, gross (>20) yes 16 "a deletion of exons 15 and 16 which alters the reading frame leading to a premature stop codon" in the ADAM9 gene 2010 20691256
OMIA 001870-9615 dog Beagle Glaucoma, primary open angle ADAMTS10 missense yes 20 p.(G661R) 2011 21379321
OMIA 001870-9615 dog Norwegian Elkhound Glaucoma, primary open angle ADAMTS10 missense yes CanFam3.1 20 g.53101896G>A c.1159G>A p.(A387T) 2014 25372548 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001976-9615 dog Petit Basset Griffon Vendéen Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 inversion yes CanFam3.1 3 Forman et al. (2015): "a 4.96 Mb inversion . . . with breakpoints in intron 12 of ADAMTS17 (chr3:40,812,274) and a downstream intergenic region (chr3:45,768,123)". 2015 26683476
OMIA 001976-9615 dog Basset Hound Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 deletion, small (<=20) yes CanFam3.1 3 g.40614853_40614872del "19 bp deletion in exon 2 of ADAMTS17 (CanFam3.1 chr3:40,614,853-40,614,872)" 2015 26474315
OMIA 000588-9615 dog Jack Russell Terrier Lancashire heeler Miniature Bull Terrier Lens luxation ADAMTS17 splicing yes CanFam3.1 3 g.40782144G>A c.1473+1G>A rs1152388408 2010 20375329 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001976-9615 dog Basset Fauve de Bretagne Glaucoma, primary open angle, ADAMTS17-related ADAMTS17 missense yes CanFam3.1 3 g.40808345G>A c.1552G>A p.(G518S) 2015 26474315 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000588-9615 OMIA 001976-9615 dog Chinese Shar-Pei Primary open-angle glaucoma (POAG), primary lens luxation (PLL), or both ADAMTS17 deletion, small (<=20) yes CanFam3.1 3 g.40935387_40935392delCGTGGT c.3070_3075delCGTGGT p.(V1025_V1026del) 2018 29287154
OMIA 000328-9615 dog Doberman Pinscher Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) yes CanFam3.1 11 g.2408978C>T c.769C>T p.(R257*) 2019 31294848
OMIA 000328-9940 sheep White Dorper Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) yes Oar_rambouillet_v1.0 5 g.1938399G>T c.424G>T p.(E142*) XM_012156230:c.424G>T, XP_012011620:p.Glu142* (Joller et al., 2017) 2012 22497338 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000328-9940 sheep White Dorper Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 nonsense (stop-gain) yes Oar_rambouillet_v1.0 5 g.2088231G>A c.805G>A p.(V269M) XM_012156230:c.805G>A, XP_012011620:p.Val269Met (Joller et al., 2017) 2015 25354687 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000328-9913 cattle Belgian Blue Ehlers-Danlos syndrome, type VII (Dermatosparaxis) ADAMTS2 delins, small (<=20) yes UMD3.1 7 g.1957955_1957971delinsAGC c.464_480delinsAGC 1999 10417273 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 001140-9615 dog Nova Scotia Duck Tolling retriever Cleft lip with or without cleft palate ADAMTS20 deletion, small (<=20) yes CanFam3.1 27 c.1360_1361delAA p.(K453Ifs*3) 2015 25798845
OMIA 001562-9913 cattle Slovenian Cika Pulmonary hypoplasia and anasarca syndrome ADAMTS3 missense yes ARS-UCD1.2 6 g.87462016G>A c.1222C>T p.(H408T) NM_001192797.1: c.1222C>T; NP_001179726.1: p.(His408Tyr) (Häfliger et al., 2020) 2020 32069517
OMIA 001893-9615 dog Norwich Terrier Upper airway syndrome ADAMTS3 missense yes CanFam3.1 13 g.61287796G>A c.2786G>A p.(R929H) 2019 31095560
OMIA 001509-9615 dog Beagle Musladin-Lueke syndrome ADAMTSL2 missense yes CanFam3.1 9 g.49931561C>T c.661C>T p.(R221C) 2010 20862248 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001511-9913 cattle Angus Contractual arachnodactyly (Fawn calf syndrome) ADAMTSL3 deletion, gross (>20) yes 21 "a large (~58 kilobase pair) deletion affecting the ADAMTSL3 gene" 2014 Reference not in PubMed; see OMIA 001511-9913 for reference details
OMIA 001577-9615 dog Curly-coated retriever Glycogen storage disease IIIa AGL deletion, small (<=20) yes 6 c.4223delA 2007 17338148
OMIA 002135-9913 cattle Angus Arthrogryposis multiplex congenita, AGRN-related AGRN deletion, gross (>20) yes 16 A 23,363 bp deletion "encompasses the entirety of the ISG15 ubiquitin-like modifier (ISG15) gene . . . one or both of the 5' regulatory region of the hairy and enhancer split 4 (HES4) and of the agrin (AGRN) gene and of the first two exons of the AGRN gene" (Beever and Marron, 2011) 2011 Reference not in PubMed; see OMIA 002135-9913 for reference details
OMIA 000662-9940 sheep Romney Marsh Motor neuron disease, lower AGTPBP1 missense yes Oar_rambouillet_v1.0 2 g.35795594G>C c.2909G>C p.(R970P) protein and cDNA positions are based on XP_014948529.2 and XM_015093043.2, respectively 2012 22588130 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001672-9615 dog Coton de Tulear Primary hyperoxaluria type I (Oxalosis I) AGXT missense yes CanFam3.1 25 g.50968854G>A c.304G>A p.(G102S) XP_003639939.1:p.Gly102Ser rs397510072 2012 22486513 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001672-9940 sheep Zwartbles Type 1 Primary Hyperoxaluria AGXT missense yes Oar_rambouillet_v1.0 1 g.801189C>T c.584G>A p.(C195Y) NC_040252.1: g.801189C>T; XM_027966918.1: c.584G>A; XP_027822719.1: p.Cys195Tyr (Letko et al., 2020) 2020 33003365
OMIA 001222-9685 domestic cat Persian Leber congenital amaurosis AIPL1 nonsense (stop-gain) yes Felis_catus_9.0 E1 g.940445C>T c.577C>T p.(R193*) XM_023243858.1:c.577C>T 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 002205-9615 dog Rough Collie Recurrent inflammatory pulmonary disease AKNA deletion, small (<=20) yes CanFam3.1 11 g.68576241_68576244delCTGT c.2717_2720delACAG p.(D906Afs*173) XM_014117950.2: c.2717_2720delACAG; XP_013973425.1:p.(Asp906Alafs*173) 2019 31357536
OMIA 002250-9615 dog Saluki Succinic Semialdehyde Dehydrogenase Deficiency ALDH5A1 missense yes CanFam3.1 35 g.22572768G>A c.866G>A p.(G288D) XM_014110599.2: c.866G>A; XP_013966074.2: p.(Gly288Asp) (Vernau et al., 2020) 2020 32887425
OMIA 002316-9685 domestic cat Sphynx Cardiomyopathy, hypertrophic ALMS1 missense unknown Felis_catus_9.0 A3 g.92439157G>C c.7384G>C p.(G2462R) cDNA and protein positions have been predicted using Ensemble VEP based on transcript ENSFCAT00000077013.1 2021 33639992
OMIA 002162-9615 dog Karelian bear dog Hypophosphatasia ALPL missense yes CanFam3.1 2 g.77561953A>C c.1301T>G p.(V434G) 2019 30700765
OMIA 001551-9685 domestic cat Burmese Brachycephaly ALX1 deletion, small (<=20) yes B4 c.496delCTCTCAGGACTG 2016 26610632
OMIA 001009-9913 cattle Shorthorn Tibial hemimelia ALX4 deletion, gross (>20) yes 15 Deletion of 45,694 bp including exon 1 of ALX4 2012 Reference not in PubMed; see OMIA 001009-9913 for reference details
OMIA 001009-9913 cattle Galloway Tibial hemimelia ALX4 duplication yes ARS-UCD1.2 15 g.74384916_74384935dup UMD3.1 position is g.75154399_75154418dup. Duplication of 20bp in exon 2 is predicted to result in a frameshift leading to a premature stop codon and truncated protein. 2015 26076463 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001868-9615 dog Siberian Husky Blue eyes ALX4 duplication no CanFam3.1 18 g.44791414_44890185dup Deane-Coe et al. (2018): "a 98.6-kb duplication directly upstream of the Homeobox gene ALX4" 2018 30286082 g. coordinates kindly provided by Anna Letko and Cord Drögemüller (7th Oct 2019)
OMIA 000791-9615 dog Miniature Schnauzer Persistent Mullerian duct syndrome AMHR2 nonsense (stop-gain) yes 27 c.241C>T p.(R??*) 2009 18723470
OMIA 000565-9615 dog Giant Schnauzer Intestinal cobalamin malabsorption, AMN-related AMN deletion, gross (>20) yes 8 c.1113_1145del 2005 15845892
OMIA 000565-9615 dog Australian Shepherd Intestinal cobalamin malabsorption, AMN-related AMN regulatory yes 8 c.3G>A 2005 15845892
OMIA 000101-9615 dog Dalmatian Respiratory distress syndrome ANLN nonsense (stop-gain) yes CanFam3.1 14 g.47812143C>T c.31C>T p.(R11*) 2017 28222102 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001353-9615 dog German Shepherd Dog Platelet receptor for factor X, deficiency of ANO6 splicing yes CanFam3.1 27 g.8912219G>A 2015 26414452 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 002083-9913 cattle Japanese Black Abortion (embryonic lethality), ANXA10-related ANXA10 repeat variation yes 8 "a "34-kb deleted-type" CNV "associated with embryonic mortality at 30-60 days after artificial insemination. The CNV harbors exon 2 to 6 of ANNEXIN A10 (ANXA10). . . . Western blot analysis showed that the CNV results in a null allele of ANXA10." 2016 27881083
OMIA 000248-9615 dog Collie Neutropenia, cyclic AP3B1 insertion, small (<=20) yes 3 a single base pair insertion in exon 20 of AP3 beta gene (AP3B1) 2003 12897784
OMIA 000001-9913 cattle Friesian Holstein Abortion due to a nonsense mutation in APAF1 on haplotype HH1 APAF1 nonsense (stop-gain) yes UMD3.1 5 g.63150400C>T c.1741C>T p.(Q581*) rs448942533 2016 27289157 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001916-9615 dog Jack Russell Terrier Familial Adenomatous Polyposis APC delins, small (<=20) yes CanFam3.1 3 g.312131_312132delinsTT c.[462_463delinsTT] p.(K155X) NC_006585.3 c.[462_463delinsTT] 2020 32445578 Reference assembly and genomic location and cDNA reference ID kindly provided by Kyoko Yoshizaki, 17 Dec 2020
OMIA 001965-9913 cattle Holstein Holstein cholesterol deficiency APOB insertion, gross (>20) yes 11 "1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing [p.Gly135ValfsX10)]" 2016 26763170
OMIA 000991-9796 horse Warmblood Androgen insensitivity syndrome AR deletion, gross (>20) yes X c.1630_1654del "a 25-bp deletion of the DNA-binding domain [of the AR gene]" 2017 28192783 c. coordinates obtained from Villagomez et al. (2019)
OMIA 000991-9796 horse Quarter Horse Androgen insensitivity syndrome (AIS) AR regulatory yes X c.1A>G mutation in start codon 2012 22095250
OMIA 000991-9796 horse Thoroughbred Androgen insensitivity syndrome AR missense yes X c.2042G>C p.(W681S) 2016 27073903 p. coordinates obtained from Villagomez et al. (2019)
OMIA 000991-9796 horse Tennessee Walking Horse Androgen insensitivity syndrome (AIS) AR deletion, small (<=20) yes EquCab3.0 X c.183delT p.(S61fs) Villagomez et al. (2020): NM_001163891.1:c.183delT; NP_001157363.1:p.(Ser61fs) 2020 31936796
OMIA 000991-9796 horse Thoroughbred Androgen insensitivity syndrome (AIS) AR missense yes EquCab3.0 X c.2132C>T p.(A711V) Villagomez et al. (2020): NM_001163891.1:c.2132C>T; NP_001157363.1:p.(Ala711Val) 2020 31936796
OMIA 001917-9615 dog Leonberger Saint Bernard Polyneuropathy, ARHGEF10-related ARHGEF10 deletion, small (<=20) yes CanFam2.0 16 c.1955_1958+6delCACGGTGAGC 2014 25275565
OMIA 001334-9913 cattle Swedish Red Sperm, short tail ARMC3 deletion, small (<=20) yes UMD3.1 13 g.24301426del c.1442del p.(A451fs*26) rs797454424 2016 26923438 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000666-9685 domestic cat Siamese Mucopolysaccharidosis VI, mild, in L476P/D520N cats ARSB missense yes A1 c.1558G>A p.(D520N) D520N/D520N and L476P/D520N cats have normal growth and appearance. L476P/D520N cats have a very mild MPS VI phenotype (increased incidence o degenerative joint disease). 1998 9421472
OMIA 000666-9615 dog Miniature Schnauzer Mucopolysaccharidosis VI ARSB deletion, gross (>20) yes CanFam3.1 3 g.27870127_27870182del c.‐24_32del a homozygous 56 bp deletion (NM_001048133.1:c.‐24_32del) (Raj et al., 2020) 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
OMIA 000666-9615 dog Miniature Poodle Mucopolysaccharidosis VI ARSB deletion, gross (>20) yes CanFam3.1 3 g.27870253_27870274del c.103_124del p.(A35Gfs*108) 2012 22329490 Variant information kindly provided by Karthik Raj and Urs Giger
OMIA 000666-9615 dog Great Dane Mucopolysaccharidosis VI ARSB nonsense (stop-gain) yes CanFam3.1 3 g.27870445C>T c.295C>T p.(Q99*) 2018 29157190 Variant information kindly provided by Karthik Raj and Urs Giger, and confirmed by Ensembl's VEP
OMIA 000666-9615 dog Miniature Pinscher Mucopolysaccharidosis VI ARSB missense yes CanFam3.1 3 g.27950471G>A c.910G>A p.(G304R) (NM_001048133.1:c.910G>A; NP_001041598.1:p.Gly304Arg) (Raj et al., 2020) 2020 32985704 g. coordinate kindly provided by Karthik Raj 29 Oct 2020
OMIA 000666-9685 domestic cat Siamese Mucopolysaccharidosis VI ARSB missense yes Felis_catus_6.2 A1 g.143229993T>C c.1427T>C p.(L476P) 1996 8910299 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001503-9615 dog American Staffordshire Terrier Neuronal ceroid lipofuscinosis, 4A ARSG missense yes CanFam3.1 9 g.15071276G>A c.296G>A p.(R99H) 2010 20679209 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000201-10042 North American deer mouse New Hampshire Melanic (non-agouti) ASIP deletion, gross (>20) no "a 125-kb deletion, which includes the upstream regulatory region and exons 1 and 2 of Agouti, results in a loss of Agouti expression" 2009 19649329
OMIA 000201-9627 red fox dark Standard Silver ASIP deletion, gross (>20) no "A deletion in the first coding exon of the agouti gene" 1997 9054949
OMIA 000201-9615 dog Coat colour, agouti ASIP insertion, gross (>20) no 24 "a short interspersed element and a poly(A) stretch inserted within the promoter region of the ASIP" 2013 22524303
OMIA 000201-9913 cattle Normande Brindle ASIP Abr insertion, gross (>20) no 13 "insertion of a full-length Bos taurus LINE element" 2006 16827753
OMIA 000201-9925 goat Peacock Valais Grüenochte Peacock ASIP A^pc repeat variation no 13 "The ASIP allele in Peacock goats, which we propose to term “peacock” (A^pc), has a quadruplication of the same ~45 kb region having five copies in the A^b allele. It is additionally flanked by triplicated segments of 27,996 bp and 41,807 bp on the left and right side of the quadruplicated sequence (Fig 3, S4 Fig, S5 Table). The central part of the A^pc allele has exactly the same breakpoints as the A^b allele suggesting a common origin of A^b and A^pc." (Henkel et al., 2019) "63'158'171-63'203'851: 4 copies (corresponds to the CNV in the Ab allele)" (Table S5; Henkel et al., 2019) 200922: Marius picked this g. entry up as requiring attention: "g.63130175_63245658 (3 copies)". Because this will take time to sort out, I have removed it from the g. field for the time being. 2019 31841508
OMIA 001602-93934 Japanese quail Feather colour, fawn-2/beige ASIP Y^f2 duplication no 20 Robic et al. (2019) concluded "that fawn-2 and beige are the same allele, and that it is caused by a 70,895-bp tandem duplication . . . [with breakpoints] (NC-029535 [1,371,395(or 98)–1,442,295 (or 98)]) . . . located downstream of the ITCH exon 1 and upstream of the ASIP exon e4 (5′ UTR). . . . The 70,895 bp of the duplicated region include the entire AHCY gene on one strand, and parts of the ASIP and ITCH genes on the other strand." 2019 30987584
OMIA 002200-9915 zebu Brahman Nellore darkness of hair coat ASIP delins, gross (>20) unknown 13 1155-bp deletion followed by an insertion of a transposable element of more than 150 bp that may impact the recruitment of ASIP non-coding exons (Trigo et al.2021) 2021 33910501
OMIA 000201-9925 goat Bezoar Valais Blackneck Valais Copperneck Wild type or Bezaur ASIP A^bz wild type (i.e. normal) no 13 "The goat genome reference sequence is derived from a San Clemente goat, which has a similar coat color pattern as bezoars. The genome reference therefore supposedly represents the wildtype allele at the ASIP locus, termed “bezoar” (Abz) [8]. Bezoars and all other Swiss goat breeds did not show any CNVs at the ASIP locus." (Henkel et al., 2019) 2019 31841508
OMIA 000201-61386 Kodkod Melanism (black coat) ASIP missense no p.(C126Y) 2015 25695801
OMIA 000201-61406 Colocolo Melanism (black coat) ASIP missense no p.(R120C) 2015 25695801
OMIA 000201-10141 domestic guinea pig Recessive black Asip deletion, small (<=20) no c.181_184delTTCA MH026115: c.181_184delTTCA; the deletion leads to a truncated protein of 77 amino acids due to the premature stop codon. 2019 30746725
OMIA 000201-10042 North American deer mouse Alaska Melanic (non-agouti) ASIP nonsense (stop-gain) no c.193?>? p.(Q65*) 2009 19649329
OMIA 000201-9691 leopard Black panther ASIP nonsense (stop-gain) no c.333C>A p.(C111*) 2012 23251368
OMIA 000201-9858 Western roe deer Melanistic (black) ASIP missense no c.33G>T p.(L11F) 2020 32545389
OMIA 000201-9793 ass No light points ASIP NLP missense no c.349T>C p.(C117R) 2015 25887951
OMIA 001602-93934 Japanese quail Feather colour, recessive black ASIP rb deletion, small (<=20) no 20 c.373_380del "A deletion of 8 bases was found in the ASIP gene" 2008 18287406
OMIA 000201-61455 Asiatic golden cat Black ASIP missense no c.384C>G p.(C128W) 2012 23251368
OMIA 000201-9986 rabbit Black (non-agouti) ASIP a insertion, small (<=20) no 4 c.5_6insA Letko et al. (2020): NM_001122939.1:c.5_6insA 2010 20004240
OMIA 000201-9838 Arabian camel Black and dark-brown coat colour ASIP haplotype no c.[23delT;c.25G>A] KU179868; c.[23delT;c.25G>A]. As described by Almathen et al. (2018), this haplotype comprises "a 1-bp deletion (23delT/T) and a SNP (25G/A) in exon 2 of ASIP". 2018 29893870
OMIA 000201-9615 dog Fawn or sable ASIP missense no 24 c.[244G>T;248G>A] p.(A82_R83delinsSH) 2005 15965787
OMIA 001602-93934 Japanese quail Feather colour, lethal yellow ASIP Y deletion, gross (>20) yes 20 g.1463709_1604872del141162 Nadeau et al. (2008): "a >90-kb deletion upstream of ASIP" 2008 18287407 The g. coordinates were provided by Robic et al. (2019)
OMIA 000201-9796 horse Coat colour, recessive black ASIP a deletion, small (<=20) no 22 g.2174_2184del c.191_201del 2001 11353392
OMIA 000201-9925 goat Appenzell Girgentana Saanen White or tan ASIP A^Wt repeat variation no ARS1 13 "CNV [copy number variation] affecting a region of less that 100 kb including the ASIP and AHCY genes" (Fontanesi et al., 2009)."spans 154,677 bp ofthe reference genome sequence and comprises the entire coding sequence ofthe ASIP, AHCYand ITCH genes. The individual copies are arranged in tandem in a head to tail orientation." (Henkel et al., 2019) 200922: moved the g. entry to here (g.63,226,824-63,381,501 (3 copies)) until it can be standardised 2009 20016133
OMIA 000201-9925 goat Grisons Striped Toggenburg Swiss markings ASIP A^sm repeat variation no ARS1 13 "8 tandem copies of a 13,433 bp sequence from the 5’-flanking region of ASIP" (Henkel et al., 2019) 200922: moved g. entry to here (g.63,129,198-63,142,631 (8 copies)) until it can be fixed 2019 31841508
OMIA 000201-9925 goat Chamois Colored St. Gallen Booted Badgerface ASIP A^b repeat variation no ARS1 13 "a five-fold amplification of45,680 bp located ~61 kb downstream ofthe Asm amplification" (Henkel et al., 2019) 200922: move the g. entry to here (g.63,158,171-63,203,851 (5 copies)), until it can be fixed 2019 31841508
OMIA 000201-9615 dog Coat colour, agouti ASIP insertion, gross (>20) no CanFam3.1 24 "a short interspersed nuclear element (SINE) insertion in intron 1 of ASIP that allows for the differentiation of the a(w) wolf sable and a(t) black-and-tan alleles" 200922: g. entry moved here (g.23365298ins239) until can be standardised 2011 21846741 Genomic location and description kindly provided by Professor Claire Wade in August 2018.
OMIA 000201-9615 dog German Shepherd Dog Recessive black ASIP missense no CanFam3.1 24 g.23393552C>T c.286C>T p.(R96C) rs851336386 2004 15520882 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000201-9685 domestic cat Coat colour, non-agouti (black) ASIP a deletion, small (<=20) no Felis_catus_9.0 A3 g.25086566_25086567del c.264_265del p.(M89Efs*59) "a 2 bp deletion in the ASIP gene [at nucleotide positions 123-124]" XM_019826162.2:c.264_265delCA 2003 12620197 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000201-9940 sheep Merino White fleece ASIP Wt insertion, gross (>20) no Oar_rambouillet_v1.0 13 a 190kb tandem duplication encompassing the ASIP gene, the neighbouring AHCY gene and the promoter for a third gene ITCH 2008 18493018
OMIA 000201-9940 sheep Recessive black ASIP a missense no Oar_rambouillet_v1.0 13 g.66474980T>A c.376T>A p.(C126S) Published as g.5172T>A (Norris et al. 2008). cDNA and protein positions based on NM_001134303.1 and NP_001127775.1 2008 18493018 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000201-9940 sheep Recessive black ASIP a deletion, small (<=20) no Oar_rambouillet_v1.0 13 g.66475132_66475136del published as g.100_105del / D5 and predicted to result in a frame shift followed by a premature stop codon 63 amino acids downstream of the start site 2002 12354151 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000201-9986 rabbit Black and tan ASIP a^t deletion, gross (>20) no OryCun2.0 4 g.5455408_5466123del Letko et al. (2020): NC_013672.1:g.5,455,408_5,466,123del 2020 31729778
OMIA 000213-89462 water buffalo White ASIP insertion, gross (>20) no UOA_WB_1 14 "2,809-bp-long LINE-1 insertion in the ASIP (agouti signaling protein) gene" (Liang et al. (2020) 2020 33212507
OMIA 002325-9685 domestic cat Encephalopathy, spongy ASPA missense yes E1 c.859G>C p.(A287P) 2021 33779415
OMIA 002099-9615 dog German Shepherd Dog Ichthyosis, ASPRV1-related ASPRV1 missense yes CanFam3.1 10 c.1052T>C p.(L351P) 2017 28249031
OMIA 000194-9913 cattle Holstein-Friesian Citrullinaemia ASS1 nonsense (stop-gain) yes UMD3.1 11 g.100802781C>T c.256C>T p.(R86*) 1989 2813370 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001471-9615 dog Standard Poodle Neonatal encephalopathy with seizures ATF2 missense yes CanFam3.1 36 g.19078954T>G c.152T>G p.(M51R) 2008 18074159 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001954-9615 dog Lagotto Romagnolo Neurodegenerative vacuolar storage disease ATG4D missense yes CanFam3.1 20 g.50618958G>A c.1288G>A p.(A430T) 2015 25875846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001552-9615 dog Tibetan Terrier Neuronal ceroid lipofuscinosis, 12 ATP13A2 splicing yes 2 c.1620delG Originally c.1623delG p.P541fs*597 (Farias et al., 2011); revised coordinates from Wöhlke et al. (2011) 2011 21362476 22022275 Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017 present the original coordinates rather than the revised ones, with no explanation.
OMIA 001552-9615 dog Australian Cattle Dog Neuronal ceroid lipofuscinosis, 12 ATP13A2 missense yes CanFam3.1 2 g.81208162C>T c.1118C>T p.(T373I) Schmutz et al. (2019): "The ATP13A2 variant was a missense variant, XM_005617949.3:c.1118C > T, predicted to result in a non-conservative exchange of a threonine into an isoleucine, XP_005618006.1:p.(Thr373Ile)" 2019 30956123
OMIA 002110-9615 dog Belgian Shepherd Ataxia, cerebellar, ATP1B2-related ATP1B2 insertion, gross (>20) yes CanFam3.1 5 "a 227 bp SINE insertion into exon 2 of the ATP1B2 gene" 200922: g. and c. info moved here (g.32551064_32551065insLT796559; c.130_131insLT796559.1) until they can be standardised 2017 28620085
OMIA 001450-9913 cattle Belgian Blue Red and White Dutch Congenital muscular dystonia 1 ATP2A1 missense yes UMD3.1 25 g.26191380C>T c.1675C>T p.(R559C) 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001464-9913 cattle Romagnola Pseudomyotonia, congenital ATP2A1 missense yes UMD3.1 25 g.26197204G>T c.857G>T p.(G286V) 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001464-9913 cattle Romagnola Pseudomyotonia, congenital ATP2A1 missense yes UMD3.1 25 g.26197429G>T c.632G>T p.(G211V) 2012 23046865 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001464-9913 cattle Chianina Pseudomyotonia, congenital ATP2A1 missense yes UMD3.1 25 g.26198573G>A c.491G > A p.(R164H) 2008 18786632 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002265-9615 dog Irish Terrier Darier disease ATP2A2 insertion, gross (>20) yes CanFam3.1 26 p.(T700Vfs*6) Linek et al. (2020): "a heterozygous SINE insertion [~205bp] into the ATP2A2 gene, at the end of intron 14, close to the boundary of exon 15", giving rise to NP_001003214.1:p.(Thr700Valfs*6) 2020 32354065
OMIA 000640-9615 dog Labrador Retriever Menkes disease ATP7A missense yes CanFam3.1 X g.60279238C>T c.980C>T p.(T327I) rs852523339 2016 26747866 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001071-9685 domestic cat Wilson disease ATP7B missense yes A1 p.(P550L) 2020 31687873
OMIA 001071-9685 domestic cat Wilson disease ATP7B missense yes A1 c.3890C>G p.(T1297R) 2019 30561139
OMIA 001071-9615 dog Labrador Retriever Wilson disease ATP7B missense yes CanFam3.1 22 g.225112G>A c.4358G>A p.(R1453Q) rs851958524 2016 26747866 30 Dec 2020: correct genomic location provided by Angelica K Kallenberg
OMIA 001645-10036 golden hamster Black tremor Atrn insertion, gross (>20) yes Kuramoto et al. (2002): "an approximately 10-kb DNA fragment, which had 557-bp direct repeats in both ends and was flanked by the identical 6-bp target duplication sequences, [that] was inserted into exon 24" 2002 11773967
OMIA 000487-9796 horse Belgian draft horse Friesian horse Hydrocephalus B3GALNT2 nonsense (stop-gain) yes EquCab3.0 1 g.76887901C>T c.1423C>T p.(Q475*) Ducro et al./ (2015): "The nomenclature for the mutation is c.1423C>T [GenBank:XM_001491545] corresponding to p.Gln475* [GenBank:XP_001491595]". As at 25 April 2019, Ensembl's Variant Effect Predictor (VEP) gives the EquCab3 c. and p. coordinates as having not changed from the EquCab2 coordinates reported by Ducro et al. (2015). The Ensembl ref is ENSECAT00000049072 2015 26452345 c. and p. variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. EquCab3 g. coordinate provided by Meredith O’Connell, working under the supervision of Professor Ernie Bailey, 24 April 2019
OMIA 001885-9940 sheep Lacaune Fecundity, Lacaune, FecL B4GALNT2 regulatory no Oar_v3.1 11 g.36938224T>A rs588626728 2013 24086150
OMIA 001885-9940 sheep Lacaune Fecundity, Lacaune, FecL B4GALNT2 regulatory no Oar_v3.1 11 g.37034573A>G 2013 24086150
OMIA 002068-9796 horse Friesian horse Dwarfism, Friesian B4GALT7 splicing yes EquCab3.0 14 g.3772591C>T c.50G>A p.(R17K) 2016 27793082 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. FN thanks Elizabeth Huffman, who updated the g. coordinates to EquCab3, working under the supervision of Professor Ernie Bailey; 23 April 2020.
OMIA 002045-9615 dog Hungarian Puli Bardet-Biedl syndrome 4 BBS4 nonsense (stop-gain) yes CanFam3.1 30 g.36063748A>T c.58A>T p.(K20*) 2017 28533336
OMIA 002216-9544 Rhesus monkey Bardet-Biedl syndrome 7 BBS7 deletion, small (<=20) yes Mmul_8.0.1 c.160delG p.(A54fs) 2019 31589838
OMIA 002178-9823 pig Large White Abortion, BBS9 and BMPER-related BBS9 deletion, gross (>20) yes Sscrofa11.1 18 g.39817373_40029300del Derks et al. (2018): "a large deletion in complete LD with the SSC18 haplotype of approximately 212kb (position 39,817,373 to 40,029,300), spanning a part of the BBS9 gene ... [and reducing] expression of the downstream BMPER gene" 2018 30231021
OMIA 001592-9615 dog Cavalier King Charles Spaniel Episodic falling BCAN deletion, gross (>20) yes 7 a 15.7kb deletion in the BCAN gene 2012 21821125
OMIA 000627-9913 cattle Poll Hereford Maple syrup urine disease BCKDHA nonsense (stop-gain) yes ARS-UCD1.2 18 g.50551011C>T c.148C>T p.(Q50*) cDNA position based on ENSBTAT00000021342.6 1990 2303405
OMIA 000627-9913 cattle Shorthorn Maple syrup urine disease BCKDHA missense yes UMD3.1 18 g.50837932C>T c.1380C>T p.(P372L) 1999 10425233 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001079-9940 sheep Spælsau yellow fat BCO2 insertion, gross (>20) yes 15 "insertion of a 7.9 kb endogenous Jaagsiekte Sheep Retrovirus (enJSRV) sequence in the first intron of the BCO2 gene" (Kent et al. 2021) 2021 34193038
OMIA 001079-9986 rabbit Yellow fat BCO2 deletion, small (<=20) yes 1 delAAT 2015 26002694
OMIA 001079-9913 cattle Holstein Yellow fat BCO2 nonsense (stop-gain) yes ARS-UCD1.2 15 g.22552375G>A c.306G>A p.(W102*) UMD3.1 position is g.22877552G>A; cDNA position is based on XM_024975217.1 rs109226280 2009 19398771 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001079-9940 sheep Norwegian White Yellow fat BCO2 nonsense (stop-gain) yes Oar_rambouillet_v1.0 15 g.25024133C>T c.196C>T p.(Q66*) Oar_v3.1 position is g.21947481C>T rs1090867485 2010 20122251 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001554-9615 dog Lapponian Herder Multifocal retinopathy 3 BEST1 cmr3 deletion, small (<=20) yes 18 c.1388delC p.(Pro463fs) 2010 21197113 Variant information and allele abbreviation gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005
OMIA 001553-9615 dog Coton de Tulear Multifocal retinopathy 2 BEST1 cmr2 missense yes 18 c.482G>A p.(G161D) 2007 17460247
OMIA 001444-9615 dog Boerboel Bull Mastiff English Mastiff Great Pyrenees Multifocal retinopathy 1 BEST1 cmr1 nonsense (stop-gain) yes CanFam3.1 18 g.54478586C>T c.73C>T p.(R25*) 2007 17460247 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001660-9615 dog Great Dane Myopathy, Great Dane BIN1 splicing yes 19 IVS10-2A>G 2013 23754947
OMIA 002306-9940 sheep Rasa Aragonesa Fecundity BMP15 FecX^RA missense unknown Oar3.1 X g.50970948C>T c.1172C>T p.(T400I) protein position based on ENSOART00000010201 2020 31927415
OMIA 002306-9940 sheep Blanche du Massif Central Noire du Velay Fecundity BMP15 FecX^N regulatory unknown Oar3.1 X g.50977717T>A 2020 32636872
OMIA 001719-9940 sheep Belclare Irish Cambridge Fecundity, Belclare BMP15 FecX(B) missense no Oar_rambouillet_v1.0 X g.56594843C>A c.1100G>T p.(S367I) 2004 14627550 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001799-9940 sheep Olkuska Fecundity, Olkuska BMP15 FecX(O) missense no Oar_rambouillet_v1.0 X g.56594934T>G c.1009A>C p.(N337H) Protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively. 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001357-9940 sheep Lacaune Fecundity, Lacaune BMP15 FecX(L) missense no Oar_rambouillet_v1.0 X g.56594981C>T c.962G>A p.(C321Y) cDNA position based on NP_001108239.1 2007 17038554 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001798-9940 sheep Grivette Fecundity, Grivette BMP15 FecX(Gr) missense no Oar_rambouillet_v1.0 X g.56594993G>A c.950C>T p.(T317I) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively 2013 23637641 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000386-9940 sheep Romney Marsh Fecundity, Inverdale BMP15 FecX(I) missense no Oar_rambouillet_v1.0 X g.56595047A>T c.896T>A p.(V299D) protein and cDNA positions based on NP_001108239.1 and NM_001114767.1, respectively rs398521635 2000 10888873 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001350-9940 sheep Romney Marsh Fecundity, Hanna BMP15 FecX(H) nonsense (stop-gain) no Oar_rambouillet_v1.0 X g.56595072G>A c.871C>T p.(Q291*) previously listed as c.1184C>T; protein and cDNA position based on NP_001108239.1 and NM_001114767.1, respectively rs413916687 2000 10888873
OMIA 000384-9940 sheep Irish Cambridge Fecundity, Galway BMP15 FecX(G) nonsense (stop-gain) no Oar_rambouillet_v1.0 X g.56595225G>A c.718C>T p.(Q239*) rs425019156 2004 14627550
OMIA 001800-9940 sheep Rasa Aragonesa Fecundity, Rasa Aragonesa BMP15 FecX® deletion, small (<=20) no Oar_rambouillet_v1.0 X g.56595467_56595483del c.460_476del p.(W154Nfs*55) published as c.525_541delTGGGTCCAGAAAAGCCC based on AF236079, protein and cDNA position in table based on NP_001108239.1 and NM_001114767.1, respectively 2008 18355397 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002107-9940 sheep Tunisian Barbarine Fecundity, Barbarine BMP15 FecX(Bar) complex rearrangement no Oar_rambouillet_v1.0 X g.[56600937insG; 56600945_56600947delTAG; 56600948C>A] c.[301G>T; 302_304delCTA; 310insC] p.(A101Cfs*113) "a composite polymorphism associating a single nucleotide substitution (c.301G > T), a 3 bp deletion (c.302_304delCTA) and a C insertion (c.310insC) in the ovine BMP15 cDNA leading to a frame shift at protein position 101" - cDNA positions based on NM_001114767 2017 28506298
OMIA 002306-9823 pig German Landrace Infertility and increased litter size BMP15 nonsense (stop-gain) yes Sscrofa11.1 X g.44618787C>T p.(R212*) "NP_001005155.2:p.R212X" (Flossmann et al., 2021) 2021 33413103
OMIA 001551-9615 dog Brachycephaly BMP3 missense yes CanFam3.1 32 g.5231894C>A c.1344C>A p.(F448L) rs851217657 2012 22876193 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000383-9940 sheep Booroola Han, small-tailed Fecundity, Booroola BMPR1B FecB(B) missense no Oar_rambouillet_v1.0 6 g.34010859T>C c.914A>G p.(Q305R) Position on Oar_v3.1: g.29382188T>C rs418841713 2001 11259271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000576-9823 pig Yorkshire Knobbed acrosome defect BOLL deletion, gross (>20) yes Sscrofa11.1 15 g.101549770_101604750del 2020 32975846
OMIA 001512-9615 dog Invasive transitional cell carcinoma of the bladder BRAF missense yes CanFam3.1 16 g.8296284T>A p.(V595E) 2015 25767210
OMIA 002132-9615 dog German Shorthaired Pointer Abortion (embryonic lethality), BTBD17-related BTBD17 insertion, small (<=20) yes CanFam3.1 9 g.6048201_6048202insG rs852549625 2017 29053721
OMIA 001991-9913 cattle Nordic Red Stillbirth BTBD9 deletion, gross (>20) yes UMD3.1 23 "∼525 KB deletion on Chr23:12,291,761-12,817,087 (overlapping BTBD9, GLO1 and DNAH8)" 2016 27091210
OMIA 001622-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup C BTN1A1 nonsense (stop-gain) no GalGal4 28 g.808011C>A c.165C>A p.(C55*) rs735807319 2005 16051833 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001575-9615 dog Gordon Setter Irish Setter Miniature Poodle Old Danish Pointing Dog Polski Owczarek Nizinny Polski Owczarek Podhalanski Standard Poodle Tibetan Terrier Rod-cone dysplasia 4 C17H2orf71 insertion, small (<=20) yes 17 c.3149_3150insC 2013 22686255
OMIA 000303-9031 chicken White Leghorn Dwarfism, autosomal C1H12ORF23 nonsense (stop-gain) yes GalGal5 1 g.53688583C>T c.433G>A p.(W59*) Wu et al. (2018): "NM_001006244.1:c.433G > A . . . NP_001006244.1:p.(Trp59∗)" 2018 29930570
OMIA 000155-9615 dog Brittany Spaniel C3 deficiency C3 deletion, small (<=20) yes 20 "a deletion of a cytosine at position 2136 (codon 712), leading to a frameshift that generates a stop codon 11 amino acids downstream" 1998 9510185
OMIA 002201-9913 cattle Normande Abortion due to haplotype NH7 CAD missense yes ARS-UCD1.2 11 g.72409143T>C p.(Y452C) published as CAD g.72399397T>C; p.Tyr452Cys 2019 31056337 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001820-9615 dog Parson Russell Terrier Ataxia, spinocerebellar CAPN1 missense yes 18 c.344G>A p.(C115Y) 2013 23741357
OMIA 001138-9615 dog American Foxhound Beagle Hypocatalasia CAT missense yes CanFam3.1 18 g.33397548G>A c.979G>A p.(A327T) 2000 11137458 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001416-9612 gray wolf Coat colour, dominant black CBD103 K^B deletion, small (<=20) no 3bp deletion of the CBD103 gene 2009 19197024
OMIA 001416-9614 coyote Coat colour, dominant black CBD103 deletion, small (<=20) no 3bp deletion of the CBD103 gene 2009 19197024
OMIA 001416-9615 dog Coat colour, dominant black CBD103 ΔG23 = K^B deletion, small (<=20) no CanFam3.1 16 g.58965449_58965451del "a 3-base pair (bp) deletion in the second exon of CBD103, the ortholog of human DEFB103, that predicts an in-frame glycine deletion (ΔG23)" rs851502010 2007 17947548 Genomic location and other details provided by Professor Claire Wade August 2018. Allele designations taken from Ollivier et al. (2013)
OMIA 002167-9913 cattle Nordic Red Asthenospermia CCDC189 splicing yes ARS-UCD1.2 25 g.26880841C>T Touru et al. (2019): "a variant disrupting a canonical 5’ splice donor site (GCA_000003055.3:Chr25:g.27138357C>T) in CCDC189 (transcript - ID:ENSBTAT00000045037) encoding the coiled-coil domain containing protein 189." 2019 30975085
OMIA 001540-9615 dog Old English Sheepdog Ciliary dyskinesia, primary CCDC39 nonsense (stop-gain) yes CanFam3.1 34 g.13952270C>T c.286C>T p.(R96*) 2011 21131972 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001521-9615 dog Schapendoes Generalized PRA CCDC66 insertion, small (<=20) yes 20 c.521_522insA p.(N174Kfs) "a 1-bp insertion in exon 6 leading to a stop codon" 2010 19777273
OMIA 001521-9615 dog Portugese water dog Progressive retinal atrophy, early onset CCDC66 EOPRA insertion, small (<=20) yes CanFam3.1 20 g.33717704_33717705insT c.2262_c.2263insA p.(V747Sfs*8) 2020 33273526
OMIA 001752-9823 pig Resistance to PRRS virus CD163 deletion, gross (>20) no 5 Burkhard et al (2018): "the deletion of exon 7 of CD163 using CRISPR/Cas9 editing" 2018 29925651
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 missense no 28 c.120C>G p.(C40W) 2004 15564460
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 tva^r2 insertion, small (<=20) no 28 c.48insCTCG 2004 15564460
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) no 28 c.502_511delCGCTCACCCC 2015 25873518
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 deletion, small (<=20) no 28 c.502_516delCGCTCACCCCGCCCC 2015 25873518
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 splicing no 28 c.506-515del10 2012 22171251
OMIA 001299-9031 chicken Resistance to avian sarcoma and leukosis viruses, subgroup A CD320 splicing no 28 c.507-511del5 2012 22171251
OMIA 002386-9544 Rhesus monkey OKT4 epitope deficiency CD4 missense unknown 11 c.C793T p.(A265W) 2021 33893743
OMIA 000102-9031 chicken Sex-linked extreme dilution CDKN2A B0 complex rearrangement no Z The B0 allele is characterised by two non-coding variants: "The first, SNP1, is within the CDKN2A (ARF) promoter region, 265 bp upstream of the transcription start site (according to GenBank AY138245), and the second, SNP2, is located at nucleotide position 385 bp in CDKN2A intron 1" 2010 20374521
OMIA 000102-9031 chicken Sex-linked dilution CDKN2A B2 missense no GalGal5 Z g.78636802C>T c.28C>T p.(R10C) 2010 20374521 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000102-9031 chicken Sex-linked barring CDKN2A B1 missense no GalGal5 Z g.78636804T>A c.26T>A p.(V9D) 2010 20374521 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001890-198806 ruff Male body size/courtship behaviour CENPN inversion unknown "a 4.5Mb inversion on the ruff orthologue of chicken chromosomr GGA11 which, due to the well-known lethality of recombinants within an inversion, has created a supergene determining male breeding behaviour, body size and plumage colour" 2016 26569123
OMIA 001830-9913 cattle Holstein Abortion due to haplotype HH7 CENPU deletion, small (<=20) yes UMD3.1 27 g.14168130_14168133del Hozé et al. (2019): "Considering that CENPU is transcribed in the antisense orientation, this mutation is predicted to result in deletion of the nucleotides located at position +3 to + 6 bp after the splicing donor site of exon 11. Using cross-species nucleotide alignment, we observed that the nucleotide at position +3 is entirely conserved among vertebrates . . . , which suggests that it plays an important role in regulation of CENPU splicing. If modified after exon 11, the abnormal splicing of CENPU could cause mRNA decay or the production of a protein modified after residue 319 out of 409 AA. Based on these factors, we assumed that mutation g.14168130_14168133delTACT on chromosome 27 alters the splicing of CENPU and is embryonic lethal." 2020 31733857
OMIA 001502-9913 cattle Montbeliarde Caprine-like Generalized Hypoplasia Syndrome CEP250 nonsense (stop-gain) yes UMD3.1 13 g.65369074C>T c.493C>T p.(Q165*) 2015 25902731 Coordinates obtained from and/or confirmed by EBI's VEP
OMIA 001244-9685 domestic cat Retinal degeneration II CEP290 splicing yes Felis_catus_9.0 B4 g.112522818C>A c.7584+9G>T published as IVS50 + 9T>G (affected animal is homozygous G) XM_023256243.1:c.7584+9G>T 2007 17507457 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000636-9823 pig Membranoproliferative glomerulonephritis type II CFH missense yes Sscrofa11.1 10 g.2553907T>G c.3610T>G p.(I1166R) CFH is located on Chr10 in Sscrofa10.2, but recorded as 'unplaced/NW_018085100.1' in Sscrofa11.1. 2002 12466119 The genomic location on Sscrofa11.1 was determined by Stephanie Shields (27/05/2020)
OMIA 002072-9615 dog Old Danish Pointing Dog Myasthenic syndrome, congenital CHAT missense yes 28 g.1484906G>A c.??G>A p.(V29M) 2007 17586598 20181218 Thanks to Maarten de Groot for advising FN of the genomic location of this variant.
OMIA 002125-9913 cattle Montbeliarde Neurocristopathy CHD7 deletion, small (<=20) yes UMD3.1 14 g.28085731_28085735del p.(K594Afs*29) 2017 28904385
OMIA 002022-9913 cattle Red Danish Arthrogryposis multiplex congenita, CHRNB1-related CHRNB1 deletion, small (<=20) yes ARS-UCD1.2 19 g.27122027del c.55del p.(A19Pfs47*) Published as Chr19:27757270CG > C; CHRNB1 c.55delG; (p.Ala19Profs47*) 2016 27364156 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000685-9615 dog Jack Russell Terrier Myasthenic syndrome, congenital, due to CHRNE CHRNE insertion, small (<=20) yes 5 c.633_634insC p.(G212Rfs*274) 2015 26429099
OMIA 000685-9913 cattle Brahman Myasthenic syndrome, congenital, CHRNE-related CHRNE 470del20 deletion, small (<=20) yes ARS-UCD1.2 19 g.26485848_26485867del c.470_489del Kraner et al. (2002): "a loss of 20 bp within the coding sequence of exon 5 (Fig. 2), between nucleotide 469 and 490 (nucleotide numbering referring to the cDNA sequence published under accession number X02597". These authors (and subsequent authors) call this variant "470del20". The current (2020) HGVS nomenclature is c.470_489del 200922: g. information move here (g.27119615) until standardised 2002 12481987 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000685-9615 dog Heideterrier Myasthenic syndrome, congenital, due to CHRNE CHRNE insertion, small (<=20) yes CanFam3.1 5 g.31707450_31707451insG c.1436_1437insG p.(S479Rfs*14) 2017 28508416
OMIA 000698-9615 dog Australian Cattle Dog Myotonia CLCN1 insertion, small (<=20) yes 16 c.2665insA p.(R889fs) 2007 17552451 Variant information gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005
OMIA 000698-89462 water buffalo Myotonia CLCN1 splicing yes c.396C>T 2013 23339992
OMIA 000698-9925 goat Myotonia CLCN1 missense yes ARS1 4 g.13857007C>G c.2590G>C p.(P864A) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000031898.1 1996 8855341
OMIA 000698-9615 dog Labrador Retriever Myotonia congenita CLCN1 nonsense (stop-gain) yes CanFam3.1 16 g.6348929T>A c.2275A>T p.(R759X) Quitt et al. (2018): "Chr16:6348929 T A CLCN1 ENSCAFG00000003619.3 stopgain" 2018 29934119
OMIA 000698-9615 dog Miniature Schnauzer Myotonia CLCN1 missense yes CanFam3.1 16 g.6366383C>T c.803C>T p.(T268M) 1999 10452529 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000698-9796 horse New Forest Pony Myotonia CLCN1 missense yes EquCab3.0 4 g.96518592A>C c.1775A>C p.(D592A) c.1775A>C, Genbank acc. XM_001915636); p.D592A, Genbank acc. XP_001915671 (Wijnberg et al., 2014) 2012 22197188 (FN thanks Izabela De Assis Rocha, who provided genomic location in EquCab3.0 and the Genbank acc IDs, working under the supervision of Professor Ernie Bailey; 15 April 2020) Revised genomic location kindly provided by Cord Drögemüller; 21 May 2021
OMIA 000698-9685 domestic cat Myotonia CLCN1 splicing yes Felis_catus_6.2 A2 g.157306905G>T c.1930+1G>T 2014 25356766 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000698-9940 sheep Rasa Aragonesa Myotonia CLCN1 missense yes Oar_rambouillet_v1.0 4 g.115541101G>A c.277G>A p.(E93K) Oar_v3.1 position is g.106140081G>A published as p.Gln93Lys. cDNA and protein position predicted using Variant Effect Predictor ENSOART00020002372.1 rs401726021 2015 25744800 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001887-9913 cattle Belgian Blue Osteopetrosis with gingival hamartomas CLCN7 missense yes ARS-UCD1.2 25 g.[1139611G>T; 1139613A>G] c.[2248T>C; 2250C>A] p.(Y750Q) 2014 24159188 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001135-9913 cattle Japanese Black Renal dysplasia CLDN16 Type 1 deletion, gross (>20) yes 1 37kb deletion of exons 1-4 2000 10810088
OMIA 001135-9913 cattle Japanese Black Renal dysplasia CLDN16 Type 2 deletion, gross (>20) yes UMD3.1 1 "a 56-kb deletion that eliminates exons 1-4 and 21-bp of exon 5" 200922: g. info moved to here (g.77528017_?) until can be standardised 2002 12047224 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 001482-9615 dog Golden Retriever Neuronal ceroid lipofuscinosis, 5 CLN5 deletion, small (<=20) yes 22 c.934_935delAG p.(E312Vfs*6) 2015 25934231 Breed information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
OMIA 001482-9615 dog Australian Cattle Dog Border Collie Neuronal ceroid lipofuscinosis, 5 CLN5 nonsense (stop-gain) yes CanFam3.1 22 g.30574637C>T c.619C>T p.(Q207*) rs1152388418 2005 16033706 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020: g. coordinate corrected, with thanks to Angelica K Kallenberg
OMIA 001482-9940 sheep Borderdale Neuronal ceroid lipofuscinosis, 5 CLN5 splicing yes Oar_rambouillet_v1.0 10 g.56313269G>A c.571+1G>A rs422165326 2008 17988881 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001482-9913 cattle Devon Neuronal ceroid lipofuscinosis, 5 CLN5 insertion, small (<=20) yes UMD3.1 12 g.52461241_52461242insG c.662_663insG p.(R221Gfs*6) 2006 16935476 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210909: after checking the genome assembly sequence, FN changed g.52461241insG to g.52461241_52461242insG; and c.662insG to c.662_663insG
OMIA 001443-9615 dog Australian Shepherd Neuronal ceroid lipofuscinosis, 6 CLN6 missense yes CanFam3.1 30 g.32247875T>C c.829T>C p.(W277R) 2011 21234413 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 001443-9685 domestic cat Domestic medium-haired Neuronal ceroid lipofuscinosis, 6 CLN6 nonsense (stop-gain) yes Felis_catus_9.0 B3 g.39334330G>A c.668G>A p.(W223*) ENSFCAT00000025909:c.668G>A; XM_003987007.5:c.668G>A (Katz et al. (2020) 2020 32518081
OMIA 001443-9940 sheep South Hampshire Neuronal ceroid lipofuscinosis CLN6 deletion, gross (>20) yes Oar_rambouillet_v1.0 7 deletion of exon 1 2013 23338040
OMIA 001443-9940 sheep Merino Neuronal ceroid lipofuscinosis, 6 CLN6 missense yes Oar_rambouillet_v1.0 7 g.16039510G>A c.184C>T p.(R62C) protein and cDNA position based on NP_001035379.1 and NM_001040289.1, respectively rs399747319 2006 17046213 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001962-9542 Japanese macaque Neuronal ceroid lipofuscinosis, 7 CLN7 deletion, small (<=20) yes 4 c.769delA p.(I257Lfs*36) 2018 30048804
OMIA 001506-9615 dog Alpenländische Dachsbracke Neuronal ceroid lipofuscinosis, 8 CLN8 deletion, gross (>20) yes CanFam3.1 37 g.30852988_30902901del a homozygous deletion encompassing the entire CLN8 gene 2017 28024876 g. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
OMIA 001506-9615 dog Saluki Neuronal ceroid lipofuscinosis, 8 CLN8 insertion, small (<=20) yes CanFam3.1 37 g.30874636dupT c.349dupT p.(E117*) "an insertion of 1 bp (T) in the CLN8 gene (Fig. S2) in a short T repeat, thereby changing the stretch of 9 T's to a stretch consisting of 10 T's. The exact position of the inserted base could obviously not be verified, given that this was an insertion of a single base in a stretch of nine repeats of the same base (CFA37:g.30874628–30874636). According to the recommended nomenclature, the T insertion was noted as a T duplication in the T farthest in the 3′ direction (g.30874636dupT; c.349dupT)" 2018 29446145
OMIA 001506-9615 dog English Setter Neuronal ceroid lipofuscinosis, 8 CLN8 missense yes CanFam3.1 37 g.30874779T>C c.491T>C p.(L164P) 2005 15629147 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001506-9615 dog Australian Shepherd German Shorthaired Pointer Neuronal ceroid lipofuscinosis, 8 CLN8 nonsense (stop-gain) yes CanFam3.1 37 g.30883950G>A c.585G>A p.(W195*) NM_001012343: c.585G>A (Guo et al., 2014) 2014 24953404 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; confirmed by Guo et al. (2019, pages 3, 4, 5 and 6), assuming that the g. coordinate (g.30,895,648) in the abstract of Guo et al. (2019) is a typo.
OMIA 000119-9685 domestic cat Blood group system AB CMAH regulatory no B2 "an indel in the exon 1 5' UTR" 2007 17553163
OMIA 000119-9685 domestic cat Blood group system AB CMAH regulatory no B2 "2 SNPs upstream of the start" 2007 17553163
OMIA 000119-9685 domestic cat Blood group system AB CMAH regulatory no B2 an indel in the exon 1 5' UTR 2007 17553163
OMIA 000119-9685 domestic cat Blood group system AB CMAH missense no B2 c.187A>G p.(I63V) 2016 27755584
OMIA 000119-9685 domestic cat 2019 TYPING PANEL CMAH deletion, small (<=20) no Felis_catus_6.2 B2 c.1322delT p.(L441*) 2018 30235335
OMIA 000119-9685 domestic cat Blood group system AB CMAH missense no Felis_catus_9.0 B2 g.4935348G>A c.232G>A p.(V78M) XM_011282052.3:c.232G>A; initially reported as Felis_catus_6.2: B2:4587414G>A; c.139G>A; p.(V47M) 2007 17553163 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770):
OMIA 000119-9685 domestic cat 2019 TYPING PANEL CMAH missense no Felis_catus_9.0 B2 g.4935385G>T c.269G>T p.(G90V) XM_011282052.3:c.269G>T; Initially reported as c.179G>T; p.(G60V) 2016 27755584 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000119-9685 domestic cat 2019 TYPING PANEL CMAH missense no Felis_catus_9.0 B2 g.4938728T>A c.358T>A p.(Y120N) XM_011282052.3:c.358T>A - The original (2007) designation was c.265T>A. A revised designation of c.268T>A; p.(Y89N) was reported by Kehl et al. (2019), Felis_catus_6.2: g.4590792T>A. 2007 17553163 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000119-9685 domestic cat 2019 TYPING PANEL CMAH missense no Felis_catus_9.0 B2 g.4947519C>T c.454C>T p.(P152S) XM_011282052.3:c.454C>T; initially reported as c.364C>T; p.(P122S) 2016 27171395 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000119-9685 domestic cat Blood group system AB CMAH missense no Felis_catus_9.0 B2 g.4985762G>A c.1693G>A p.(D565N) XM_011282052.3:c.1693G>A; Felis_catus_6.2: g.4637820G>A; c.1600G>A; p.(D534N) 2007 17553163 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001977-9615 dog Shetland Sheepdog Progressive retinal atrophy, due to CNGA1 mutations CNGA1 deletion, small (<=20) yes 13 c.1752_1755delAACT 2015 26202106
OMIA 001481-9615 dog German Shepherd Dog Achromatopsia-2 CNGA3 missense yes 10 c.1270C>T p.(R424W) 2015 26407004
OMIA 001481-9615 dog Labrador Retriever Achromatopsia-2 CNGA3 deletion, small (<=20) yes 10 c.1931_1933delTGG p.(V644del) 2015 26407004
OMIA 001481-9940 sheep Awassi Achromatopsia-2 (day blindness) CNGA3 missense yes Oar_rambouillet_v1.0 3 g.108958871C>T c.1618G>A p.(G540S) 2017 28282490 Genomic coordinate on Oar_v4.0 (g.102602387G>A) kindly provided by Eyal Seroussi via Elisha Gootwine. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 001481-9940 sheep Awassi Achromatopsia-2 (day blindness) CNGA3 nonsense (stop-gain) yes Oori1 scaffold00739 3 g.263324C>T c.706C>T p.(R236*) In a pers. comm. to FN via Elisha Gootwine, Eyal Seroussi advises that the Oar_v4.0 assembly has errors in the region of of this mutation, such that it cannot be mapped onto that assembly. It can, however, be mapped on to the Ovis aries musimon sequence: "Exon 8 mutation is at position 263,324 in Ovis aries musimon unplaced genomic scaffold, alternate assembly Oori1 scaffold00739 (Sequence ID: NW_011942977.1 Length: 1056687)" 2010 19874885
OMIA 000830-9615 dog Papillon Phalène Progressive retinal atrophy CNGB1 delins, small (<=20) yes 2 c.2685delA2687_2688insTAGCTA p.(Y889Sfs*5) 2013 24015210
OMIA 001365-9615 dog Alaskan Malamute Miniature Australian shepherd Achromatopsia (cone degeneration, hemeralopia), AMAL CNGB3 deletion, gross (>20) yes 29 "deletion removing all exons of canine CNGB3" 2002 12140185
OMIA 001676-9615 dog German Shorthaired Pointer Achromatopsia (cone degeneration, hemeralopia), GSPT CNGB3 missense yes CanFam3.1 29 g.32837065G>A c.784G>A p.(D262N) 2002 12140185 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool 30 Dec 2020 Chromosome corrected, thanks to Angelica K Kallenberg
OMIA 002301-9615 dog Labrador Retriever Leonberger Saint Bernard Laryngeal paralysis and polyneuropathy CNTNAP1 LPPN3 missense yes CanFam3.1 9 g.20298261C>T c.2810G>A p.(G937E) XM_548083.6:c.2810G>A; XP_548083.3:p.Gly937Glu rs24587752 2020 33261176
OMIA 001718-9823 pig Dwarfism, Schmid metaphyseal chondrodysplasia COL10A1 missense yes Sscrofa11.1 1 g.81767089C>T c.1768G>A p.(G590R) 2000 11130976 The genomic and CDS position was determined by Stephanie Shields and the effect was confirmed with Ensembl VEP (27/05/2020)
OMIA 001772-9615 dog Labrador Retriever Skeletal dysplasia 2 (SD2) COL11A2 missense yes CanFam3.1 12 g.2652874G>C c.143G>C p.(R48P) 2013 23527306 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002126-9615 dog Golden Retriever Osteogenesis imperfecta, type III, COL1A1-related COL1A1 missense yes 9 c.1276G>C p.(G208A) 2000 11147834
OMIA 002127-9913 cattle Red Angus Osteogenesis imperfecta, type II, COL1A1-related COL1A1 missense yes ARS-UCD1.2 19 g.36463798G>A c.1063G>A p.(G355S) Petersen et al. (2019): "PolyPhen-2 predicted the mutation to be “probably damaging” with a score of 1.000 (sensitivity 0.00; specificity 1.00). Similarly, PROVEAN prediction classified the variant as “Deleterious” with a score of − 4.615, exceeding both the default (− 2.5) and stringent (− 4.1) thresholds for this classification." The genomic coordinate in the UMD3.1 assembly is g.37094333G>A (Petersen et al., 2019). The coding sequence coordinates are c.1063G>A (ENSBTAT00000017420.4) (Petersen, pers. comm.) ss1342331437356 2019 30788588
OMIA 002127-9913 cattle Fleckvieh Osteogenesis imperfecta, type II, COL1A1-related COL1A1 delins, small (<=20) yes ARS-UCD1.2 19 g.36470764-36470767delinsT c.3145_3148delinsT p.(A1049_P1050delinsS) UMD3.1 position is g.37101299_37101302delinsT; cDNA position based on ENSBTAT00000017420.4 rs876049195 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 002127-9913 cattle Holstein Osteogenesis imperfecta, type II, COL1A1-related COL1A1 missense yes ARS-UCD1.2 19 g.36473359T>A c.3917T>A p.(V1306E) NM_001034039.2: c.3917T>A; XP_024835395.1: p.Val1306Glu (Jacinto et al., 2021) 2021 33672767
OMIA 002112-9615 dog Beagle Osteogenesis imperfecta, COL1A2-related COL1A2 delins, small (<=20) yes 14 "a mutation in which nucleotides 3991-3994 ("CTAG") were replaced with "TGTCATTGG." The first seven bases of the inserted sequence were identical to nucleotides 4002-4008 of the normal canine COL1A2 sequence. The resulting frameshift changed 30 amino acids and introduced a premature stop codon." 2001 11393792
OMIA 002112-9615 dog Chow Chow Osteogenesis imperfecta, COL1A2-related COL1A2 splicing yes CanFam2.0 14 g.22845733G>A c.936+1G>A 2018 29036614
OMIA 002112-9615 dog Lagotto Romagnolo Osteogenesis imperfecta, COL1A2-related COL1A2 duplication yes CanFam3.1 14 g.19898279_19898281dup c.877_879dupCCC p.(P293dup) NM_001003187.1:c.877_879dupCCC; NP_001003187.1:p.Pro293dup 2019 31468557
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 deletion, gross (>20) yes ARS-UCD1.2 5 g.32301911_32308589del "Sanger sequencing revealed the precise breakpoints of the heterozygous deletion from position 32 301 911 located in intron 25 to 32 308 589 located within exon 45. The 6679 bp deletion includes the entire sequence of 18 exons (26–44) plus the first 36 nucleotides of exon 45" (Jacinto et al., 2020) 2020 33316082
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 delins, gross (>20) yes ARS-UCD1.2 5 g.32303127_32306640delinsTCTGGGGAGC 2020 32894162
OMIA 001926-9913 cattle Charolais Salers Bulldog calf COL2A1 missense yes UMD3.1 5 g.32469820G>A c.1791G>A p.(G600D) 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 missense yes UMD3.1 5 g.32471813G>A c.2158G>A p.(G720S) 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001926-9913 cattle Danish Holstein bulldog calf COL2A1 splicing yes UMD3.1 5 g.32473300G>A c.2463+1G>A 2016 27296271 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 missense yes UMD3.1 5 g.32475732G>A p.(G960R) 2014 25017103
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 missense yes UMD3.1 5 g.32476082G>A c.2986G>A p.(G996S) rs876243579 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001926-9913 cattle Holstein Bulldog calf COL2A1 missense yes UMD3.1 5 g.32476808G>A c.3166G>A p.(G1056S) 2019 30378686
OMIA 000710-9615 dog English Springer Spaniel Nephropathy COL4A4 nonsense (stop-gain) yes 25 c.2806C>T p.(Q904*) 2012 22369189
OMIA 000710-9615 dog English Cocker Spaniel Nephropathy COL4A4 nonsense (stop-gain) yes CanFam3.1 25 g.39953906A>T c.115A>T p.(K39*) 2007 17552442 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001112-9615 dog Navasota (mixed breed) Nephritis, X-linked COL4A5 deletion, small (<=20) yes X a 10 base pair deletion in exon 9 of COL4A5 2008 18931484
OMIA 001112-9615 dog Samoyed Nephritis, X-linked COL4A5 nonsense (stop-gain) yes CanFam3.1 X g.82196868G>T c.3079G>T p.(G1027*) 1994 8171024 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002165-9615 dog Labrador Retriever Ehlers-Danlos syndrome, classic type, 1 COL5A1 deletion, small (<=20) yes CanFam3.1 9 g.50806169delG c.3038delG p.(G1013Vfs*260) XM_022423936.1,c.3038delG. This "variant arose by a de novo mutation event during the development of the mother." (Bauer et al., 2019) 2019 31546637
OMIA 002165-9615 dog Mixed breed Ehlers-Danlos syndrome, classic type, 1 COL5A1 missense yes CanFam3.1 9 g.50832936G>A c.4711G>A p.(G1571R) XM_022423936.1,c.4711G>A; XP_022279644.1,p.(Gly1571Arg) 2019 31546637
OMIA 002165-9685 domestic cat Domestic Shorthair Ehlers-Danlos syndrome, classic type, 1 COL5A1 deletion, small (<=20) yes Felis_catus_9.0 D4 g.93210344delC c.3420delG p.(L1141Sfs*134) 2018 30246406
OMIA 002295-9913 cattle Holstein Ehlers-Danlos syndrome, classic type, 2 COL5A2 missense yes ARS-UCD1.2 2 g.7331916G>T c.2366G>T p.(G789V) XM_024979774.1: c.2366G>T; XP_024835542.1: p.Gly789Val (Jacinto et al., 2020) 2020 33143196
OMIA 001967-9615 dog Landseer Muscular dystrophy, Ullrich type COL6A1 nonsense (stop-gain) yes 31 c.289C>T p.(Q97*) 2015 26438297
OMIA 002274-9615 dog Labrador Retriever Muscular dystrophy, COL6A3-related COL6A3 splicing yes CanFam3.1 25 g.48007994C>T c.6210+1G>A CanFam3.1 chr25:48,007,994C > T; NM_001103215.1 c.6210 + 1G > A (Bolduc et al., 2020) 2020 32439203
OMIA 002274-9615 dog Labrador Retriever Muscular dystrophy, COL6A3-related COL6A3 nonsense (stop-gain) yes CanFam3.1 25 g.48014962G>A c.4726C>T p.(R1576*) CanFam3.1 chr25:48,014,962G > A; NM_001103215.1 c.4726C > T, p.R1576* (Bolduc et al., 2020) 2020 32439203
OMIA 002260-9913 cattle Holstein de novo mutation in an AI sire COL6A3 missense yes UMD3.1 3 g.117453719G>A p.(T1894M) Bourneuf et al. (2017) detected COL6A3 g.117453719G>A; p.T1894M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. 2017 28904385
OMIA 000341-9615 dog Basset Hound Epidermolysis bullosa, dystrophic COL7A1 complex rearrangement yes CanFam3.1 20 c.2028_2034del; c.1993_2050+56dup p.(V677Sfs*11) The variant is a "complex duplication event spanning parts of exon 15 and intron 15 of the COL7A1 gene, starting at position 40,524,267 and ending at 40,524,380 on chromosome 20 (CanFam3.1 assembly) (Garcia et al., 2020). cDNA and protein positions are based on NM_001002980.1 and NP_01002980.1, respectively. 2020 33291836
OMIA 000341-9615 dog Central Asian Shepherd Epidermolysis bullosa, dystrophic COL7A1 nonsense (stop-gain) yes CanFam3.1 20 g.40532043C>T c.4579C>T p.(R1527*) 2017 28493971 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 000341-9615 dog Golden Retriever Epidermolysis bullosa, dystrophic COL7A1 missense yes CanFam3.1 20 g.40538034G>A c.5716G>A p.(G1906S) 2003 12874109 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000341-9913 cattle Rotes Höhenvieh Vorderwald Epidermolysis bullosa, dystrophic COL7A1 nonsense (stop-gain) yes UMD3.1 22 g.51873390C>T c.4762C>T p.(R1588*) rs876174537 2012 22715415 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001523-9615 dog Samoyed Oculoskeletal dysplasia 2 COL9A2 deletion, gross (>20) yes 15 a 1,267 bp deletion that eliminates part of the 5’UTR, all of exon 1 and part of intron 1 2010 20686772
OMIA 001522-9615 dog Labrador Retriever Oculoskeletal dysplasia 1 COL9A3 insertion, small (<=20) yes CanFam2.0 24 g.49699850_49699851insG c.10_11insG Goldstein et al. (2010): "a 1-base insertion (guanine) in exon 1 that changes a string of four guanines (CFA24: 49,699,847–49,699,850; CanFam2) to a string of five guanines (c. 7–10 insG). This shifts the open reading frame of the putative protein, alters amino acids 4–48, and introduces a premature stop codon at codon 49 (p.A4GX46)" 200922: to render this consistent with HGVS nomenclature, I am assuming that the insertion is after the last nucleotide, i.e. g.49,699,847_49,699,850insG becomes g.49699850_49699851insG; and c. 7_10insG becomes c.10_11insG. The p. info (p.A4GX46) has been removed until it can be standardised 2010 20686772
OMIA 001522-9615 dog Northern Inuit Dog Oculoskeletal dysplasia 1 COL9A3 nonsense (stop-gain) yes CanFam3.1 24 g.46660067C>T c.700C>T p.(R234*) 2019 31415586
OMIA 001621-9685 domestic cat Devon Rex Sphynx Muscular dystrophy-dystroglycanopathy (limb-girdle) COLQ missense yes Felis_catus_8.0 C2 g.133094150G>A c.1190G>A p.(C397Y) rs869320615 2015 26327126 26374066 Genomic location obtained via Ensembl's VEP
OMIA 001988-9615 dog Bedlington Terrier Wilson disease, COMMD1 type COMMD1 deletion, gross (>20) yes 10 deletion "breakpoints were positioned at 65.3091 and 65.3489 Mb of dog chromosome 10, in intron 1 and intron 2 of COMMD1 respectively, a deletion of 39.7 kb" 2005 16293123
OMIA 001529-9913 cattle Holstein Dominant red COPA DR^DR missense no UMD3.1 3 g.9479761C>T c.478C>T p.(R160C) 2017 28904385 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002159-9694 tiger Golden tiger CORIN missense no c.1759C>T p.(H587Y) 2017 28281538
OMIA 002159-9685 domestic cat Siberian Sunshine (golden) CORIN wb^SIB missense no B1 c.2383C>T p.(R795C) 2021 33970502
OMIA 002111-9913 cattle Red Holstein Friesian Cataract, recessive, CPAMD8-related CPAMD8 nonsense (stop-gain) yes UMD3.1 7 g.5995966C>T c.220C>T p.(Q74*) 2017 28683140
OMIA 000881-9685 domestic cat Rod-cone dysplasia CRX Rdy deletion, small (<=20) yes E2 A single base deletion in the cone-rod homeobox-containing gene (CRX): n.546delC 2010 20053974
OMIA 000168-10141 domestic guinea pig Cataract Cryz splicing yes "a 102-bp deletion towards the 3' end of the coding region. This deletion does not interfere with the reading frame but results in a protein 34 amino acids shorter." (Rodriguez et al., 1992) 1992 1390943
OMIA 000852-9925 goat Casein, alpha-S1, reduced concentration CSN1S1 insertion, gross (>20) no 6 "a 457-bp insertion within exon 19 (last untranslated exon). This insert is a truncated long interspersed repeated element (LINE) containing part of the ORF-2, the 3' UTR and the poly(A) tail of the original retroposon." 1994 7926797
OMIA 001623-9925 goat Casein, alpha-S2, absence CSN1S2 nonsense (stop-gain) no ARS1 6 g.86085134G>A c.763G>A p.(T110*) rs268293093 2001 11419340 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 001424-9925 goat absence of β‐casein CSN2 CSN2^0 deletion, small (<=20) no ARS1 6 g.86008401del Persuy et al. (1999): "allele CSN2^O had a one-nucleotide deletion in the 5' end of exon 7, which introduces a premature stop codon. The open reading frame of allele CSN2^O encodes a shortened polypeptide of 72 amino acids, compared to 223 amino acids for caprine pre beta-casein A." 1999 10612234 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 001424-9925 goat absence of β‐casein CSN2 CSN2^01 regulatory no ARS1 6 g.86015651A>G Cosenza et al. (2016): "nucleotide C .... negatively affects the promoter activity of the CSN2 gene" 2007 17931404 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 002033-9913 cattle Numerous breeds A2 milk CSN2 A2 missense no UMD3.1 6 g.87181619A>C c.245A>C p.(H82P) Note that cattle cannot be genotyped for the A2 allele solely on the basis of the c.245A>C variant because this variant is common to 4 other alleles; see Table 2 of Caroli et al. (2009) J. Dairy Sci. 92, 5335-5352 (Matt McClure, pers. comm.) rs43703011 2013 23102962 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002262-9913 cattle Montbeliarde de novo mutation in an AI sire CSNK1G2 missense yes UMD3.1 7 g.45885860G>C p.(D164H) Bourneuf et al. (2017) detected Chr7 CSNK1G2 g.45885860G>C; p.D164H as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. 2017 28904385
OMIA 001505-9615 dog American Bulldog Neuronal ceroid lipofuscinosis, 10 CTSD missense yes CanFam3.1 18 g.46013354G>A c.597G>A p.(M199I) 2006 16386934 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001786-9615 dog Beagle Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) yes CanFam3.1 2 g.19796293delC c.786delC p.(D262Efs*47) rs1152388404 2014 24164695
OMIA 001786-9615 dog Border Collie Intestinal cobalamin malabsorption due to CUBN mutation CUBN deletion, small (<=20) yes CanFam3.1 2 g.19974334delC c.8392delC p.(Q2798Rfs*3) 2013 23613799
OMIA 001786-9615 dog Komondor Intestinal cobalamin malabsorption, CUBN-related CUBN splicing yes CanFam3.1 2 g.19981457G>A c.8746+1G>A Fyfe et al. (2018): NM_001003148.1: c.8746 + 1G > A 2018 30591068
OMIA 001697-9913 cattle Jersey Abortion due to haplotype JH1 CWC15 nonsense (stop-gain) yes ARS-UCD1.2 15 g.15449431C>T c.163C>T p.(R55*) UMD3.1 position is g.15707169C>T, cDNA and protein positions based on XM_005215764.2 rs1115118696 2013 23349982 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 002131-9685 domestic cat Domestic Shorthair Methaemoglobinaemia, CYB5R3-related CYB5R3 missense yes B4 g.137967506G>A c.625G>A p.(G209S) Jaffey e al. (2019): "p.Gly209Ser amino acid change in transcript CYB5R3-202 (ENSFCAT00000056925) at position B4:137967506" 2019 31650629
OMIA 002131-9685 domestic cat Domestic Shorthair Methaemoglobinaemia, CYB5R3-related CYB5R3 splicing yes B4 g.137970815G>C c.232-1G>C Jaffey et al. (2019): "a putative loss of function splice acceptor variant at c.232-1G>C in the CYB5R3-202 transcript (ENSFCAT00000056925) at position B4:137970815 that is in the acceptor site for exon 4, which likely affects downstream translation of the protein." 2019 31650629
OMIA 002131-9615 dog Pomeranian Methemoglobinaemia, CYB5R3-related CYB5R3 missense yes CanFam3.1 10 c.580A>C p.(I194L) 2018 29356095
OMIA 002131-9615 dog Mixed breed Methemoglobinaemia, CYB5R3-related CYB5R3 missense yes CanFam3.1 10 g.22832963G>A c.214G>A p.(G72S) 2017 28963729 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000017-9986 rabbit Adrenal hyperplasia, congenital CYP11A1 deletion, gross (>20) yes "a large deletion mutation in the P450scc gene" 1993 7682938
OMIA 001661-9685 domestic cat Adrenal hyperplasia, congenital, due to 11-beta hydroxylase deficiency CYP11B1 missense yes F2 G>A 2012 22827537
OMIA 000452-9031 chicken Golden Campine Sebright Bantam Henny feathering CYP19A1 insertion, gross (>20) no GRCg6a 10 The insertion is 7524bp and "contains an intact endogenous retrovirus that was not found in chickens representing 31 different breeds not showing henny feathering or in samples of the ancestral red junglefowl. The sequence shows over 99% sequence identity to the avian leukosis virus ev-1 and ev-21 strains, suggesting a recent integration. The ERV 3’LTR, containing a powerful transcriptional enhancer and core promoter with TATA box together with binding sites for EFIII and Ig/EBP inside the CYP19A1 5′ untranslated region" (Li et al., 2019) 200922: g. info removed to here (g.9683879_9683880ins) until can be standardised 1991 1939054 Genomic location and size of the insertion provided by Li et al. (2019)
OMIA 001405-9615 dog Beagle Metabolizer of a cognitive enhancer CYP1A2 nonsense (stop-gain) yes CanFam3.1 30 g.37821686C>T c.1117C>T p.(R373*) rs852922442 rs852922442 2004 15564884 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 002288-9913 cattle Hereford Mandibulofacial dysostosis CYP26C1 missense yes ARS-UCD1.2 26 g.14404993T>C p.(L188P) ss7148511443 2020 33105751
OMIA 000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) yes 5 the first of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) 2003 12915218
OMIA 000837-9823 pig Vitamin D-deficiency rickets, type I CYP27B1 deletion, gross (>20) yes 5 the second of two deletions (173 bp or 329 bp) in the gene for cytochromome P450C1 (otherwise known as CYP27B1) 2003 12915218
OMIA 000837-9685 domestic cat Vitamin D-deficiency rickets, type I CYP27B1 deletion, small (<=20) yes B4 c.731delG 2009 19138382
OMIA 000837-9685 domestic cat Vitamin D-deficiency rickets, type I CYP27B1 nonsense (stop-gain) yes Felis_catus_6.2 B4 g.86472505G>T c.637G>T p.(E213*) 2012 22553308 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001130-9615 dog Australian Cattle Dog Shetland Sheepdog Leucodystrophy CYTB missense yes CanFam3.1 M m.14474G>A c.14474G>A p.(V98M) 2006 16026996 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C splicing yes Sscrofa11.1 10 g. 46845535G>A 2015 26320255
OMIA 001986-9823 pig Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive, with sensitivity to ionizing radiation DCLRE1C nonsense (stop-gain) yes Sscrofa11.1 10 g.46851262G>A p.(Trp267*) 2015 26320255
OMIA 000735-9796 horse Belgian Haflinger Percheron Ocular squamous cell carcinoma DDB2 missense yes EquCab3.0 12 g.11726667C>T c.1013C>T p.(T338M) The EquCab2 coordinates, obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool, are g.11608667, c.1013C>T and p.T338M rs1139682898 2017 28425625 The EquCab3 g. coordinates were provided by by Meredith O’Connell, working under the guidance of Professor Ernie Bailey, 5 March 2019
OMIA 002377-8845 swan goose Lion Head Sichuan White Knob, basal DIO2 missense no AnsCyg_PRJNA183603_v1.0 NW_013185827.1 g.642923G>A p.(P265L) 2021 34193033
OMIA 002095-9615 dog Rhodesian Ridgeback Epilepsy, generalized myoclonic, with photosensitivity DIRAS1 deletion, small (<=20) yes CanFam3.1 20 c.564_567delAGAC 2017 28223533
OMIA 001484-9685 domestic cat Abyssinian Ticked DKK4 Ti^A missense no Felis_catus_9.0 B1 g.41621481G>A c.188G>A p.(C63Y) 2021 33780570 (XM_023252567.1; ENSFCAT00000034752: c.188G>A)
OMIA 001484-9685 domestic cat Abyssinian Burmese Maine Coon Oriental shorthair Ticked DKK4 Ti^CK missense no Felis_catus_9.0 B1 g.42620835C>T c.53C>T p.(A18V) 2021 33780570 ENSFCAT00000034752:c.53C>T; XM_023252567.1:c53C>T
OMIA 001354-9940 sheep Muscular hypertrophy (double muscling), Callipyge DLK1 regulatory unknown Oar_rambouillet_v1.0 18 g.66187430A>G "a single A/G polymorphism located at position 103,894 of GenBank AF354168 and position 267 of the GenBank STS AF401294" (Freking et al., 2002) "the CLPG mutation, an A to G transition in a highly conserved dodecamer motif located in the 90-Kb intergenic region separating the Delta-like 1 homologue (DLK1) and Gene trap locus 2 (GTL2) genes in the eponymous imprinted domain" (Xu et al., 2015; PubMed 26474044) In relation to the Oar_v4.0/oviAri4 genome assembly, the location of the causative SNP is OAR18:g.64294536A>G (Ross Tellam, pers. comm. to FN 5 Nov 2020) rs10721113 2002 12368241 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 002109-9913 cattle Brown Swiss Tricho-dento-osseous-like syndrome DLX3 insertion, small (<=20) yes ARS-UCD1.2 19 g.36665831_36665832insGGAGCACA c.584_585insGGAGCACAGG p.(S198Rfs*99) NM_001081622 position is g.37298375_37298376insGGAGCACA 2017 28670783 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001919-9615 dog Nova Scotia Duck Tolling retriever Cleft palate 1 DLX6 insertion, gross (>20) yes CanFam2.0 14 "2056 bp [LINE-1] insertion . . . within a highly conserved region of DLX6 intron 2 at cfa14.25016716 2014 24699068
OMIA 001081-9615 dog Rottweiler Muscular dystrophy, Duchenne type DMD nonsense (stop-gain) yes X "nonsense mutation in exon 58" 1994 Reference not in PubMed; see OMIA 001081-9615 for reference details
OMIA 001081-9615 dog Australian Labradoodle Australian Labradoodle dystrophinopathy DMD nonsense (stop-gain) yes X "a C to T transition at base pair 43 in exon 21 of the dystrophin gene" (Shrader et al., 2018) 2018 30286978
OMIA 001081-9615 dog Golden Retriever Muscular dystrophy, Duchenne type DMD splicing yes X a point mutation in the consensus splice acceptor site in exon 6 of the dystrophin gene, such that exon 7 is skipped 1992 1577476
OMIA 001081-9615 dog Cavalier King Charles Spaniel Muscular dystrophy, Duchenne type DMD splicing yes X "a missense mutation in the 5' donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein" 2010 20072625
OMIA 001081-9615 dog Cocker Spaniel Muscular dystrophy, Duchenne type DMD deletion, small (<=20) yes X deletion of four nucleotides in exon 65, with a reading frame shift predicting a premature stop codon at the site of the deletion 2012 22218699
OMIA 001081-9615 dog German Shorthaired Pointer Muscular dystrophy, Duchenne type DMD deletion, gross (>20) yes X a "deletion encompassing the entire dystrophin [DMD] gene" 1999 10407848
OMIA 001081-9615 dog Tibetan Terrier Muscular dystrophy, Duchenne type DMD deletion, gross (>20) yes X "a large deletion of exons 8-29" 2012 22218699
OMIA 001081-9685 domestic cat Domestic Shorthair Muscular dystrophy, Duchenne type DMD deletion, gross (>20) yes X A deletion of the muscle promoter and first exon and the Purkinje neuronal first exon of the DMD gene 1994 7881288
OMIA 001081-9685 domestic cat Domestic Shorthair Muscular dystrophy, Duchenne type DMD deletion, gross (>20) yes X A large deletion that "involved regions of the dystrophin gene that are poorly characterized, including the cortical neuronal promoter and its first exon and the skeletal neuronal promoter and its first exon" 2014 24446404
OMIA 001081-9615 dog Miniature Poodle Muscular dystrophy, Duchenne type DMD deletion, gross (>20) yes X "a >5 Mb deletion on the X chromosome, encompassing the entire DMD gene" 2018 29474464
OMIA 001081-9615 dog Pembroke Welsh Corgi Muscular dystrophy, Duchenne type DMD insertion, gross (>20) yes X "a long interspersed repetitive element-1 (LINE-1) insertion in intron 13, which introduced a new exon containing an in-frame stop codon" 2011 20714321
OMIA 001081-9615 dog Labrador Retriever Muscular dystrophy, Duchenne type DMD insertion, gross (>20) yes X "184 nucleotide [pseudoexon] insertion between exon 19 and exon 20, which results in a premature stop codon at the next codon downstream of the insertion" 2012 22218699
OMIA 001081-9615 dog Japanese Spitz Muscular dystrophy, Duchenne type DMD inversion yes X "an inversion of a 5.4-Mb fragment of the X chromosome, with one break point (BP1) in the DMD gene . . . and a second break point (BP2) in a gene farther toward the centromere, the RPGR gene". 2015 25644216
OMIA 001081-9615 dog Cavalier King Charles Spaniel Muscular dystrophy, Duchenne type DMD deletion, small (<=20) yes X c.6051_6057delTCTCAAT 2016 28028563
OMIA 001081-9615 dog Norfolk Terrier Muscular dystrophy, Duchenne type DMD deletion, small (<=20) yes CanFam3.1 X g.27606021delG c.3084delG p.(G1029Nfs*30) 2015 26401335
OMIA 001081-9615 dog Jack Russell Terrier Duchenne-type muscular dystrophy DMD deletion, gross (>20) yes CanFam3.1 X g.27615280_27982912del CanFam 3.1 chr X g.27,615,280_27,982,912del (Brunetti et al., 2020) 2020 33049940
OMIA 001081-9615 dog Labrador Retriever Labrador Retriever muscular dystrophy (LRMD) DMD inversion yes CanFam3.1 X g.27622834_29823788inv 2020 32767978
OMIA 001081-9615 dog Border Collie Muscular dystrophy, Duchenne DMD deletion, small (<=20) yes CanFam3.1 X g.27626466del c.2841delT 2018 29843823
OMIA 001685-9823 pig Stress syndrome DMD missense yes Sscrofa11.1 X g.28309227G>A c.5872C>T p.(R1958W) Ensembl VEP was used to identify cDNA position in transcript ENSSSCT00000089893.1, SIFT score 0.01 rs196952080 rs196952080 2012 22691118
OMIA 001542-9940 sheep Corriedale Hypophosphatemic rickets, autosomal recessive, 1 DMP1 nonsense (stop-gain) yes Oar_rambouillet_v1.0 6 g.112910614C>T c.433C>T p.(R145*) Published as g.112213795C>T / c.250C>T. Protein and cDNA positions in this table are based on XP_012035717.1 and XM_012180327.3. 2011 21747952 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001466-9615 dog Chesapeake Bay Retriever Curly-coated retriever Labrador Retriever Exercise-induced collapse DNM1 missense yes CanFam3.1 9 g.55282762G>T c.767G>T p.(R256L) 2008 18806795 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001776-9685 domestic cat Dihydropyrimidinase deficiency DPYS missense yes F2 c.1303G>A p.(G435R) 2012 23430934
OMIA 002266-9615 dog Rottweiler Hyperkeratosis, palmoplantar, DSG1-related DSG1 deletion, small (<=20) yes CanFam3.1 7 g.58163636_58163640del5 c.2541_2545delGGGCT p.(G848Wfs*2) "It is a frameshift variant, NM_001002939.1:c.2541_2545delGGGCT, predicted to truncate 207 amino acids from the C-terminus of the wildtype DSG1 protein, NP_001002939.1:p.(Gly848Trpfs*2)" (Backel et al., 2020) 2020 32344723
OMIA 002210-9823 pig Bama miniature Congenital hypothyroidosis DUOX2 missense yes Sscrofa11.1 1 g.126625620A>G c.1226A>G p.(D409G) ENU mutagenesis was used to create these pigs, the mutation is located within an exonic splicing enhancer motif and causes aberrant splicing of DUOX2 transcripts (Cao et al., 2019) 2019 30651277
OMIA 002186-9615 dog Boston Terrier Bulldog French Bulldog Screw tail DVL2 deletion, small (<=20) yes CanFam3.1 5 g.32195043_32195044del c.2044delC p.(P684Lfs*26) 2018 30521570
OMIA 000543-9913 cattle Danish Holstein Anhidrotic ectodermal dysplasia EDA insertion, gross (>20) yes X "a LINE1-derived pseudoexon between EDA exons 1 and 2. The 161-bp-long pseudoexon introduces a shift in reading frame and a premature stop codon early in EDA exon 2" 2011 22034998
OMIA 000543-9615 dog German Shepherd Dog Anhidrotic ectodermal dysplasia EDA splicing yes X c.910-1G>A 2005 16151697
OMIA 000543-9913 cattle Red Angus-Simmental cross Hypohidrotic ectodermal dysplasia EDA deletion, gross (>20) yes ARS-UCD1.2 X g.80382423_80435202del GCF_002263795.1 (O'Toole et al., 2021) 2021 33801223
OMIA 000543-9913 cattle German Holstein Anhidrotic ectodermal dysplasia EDA splicing yes ARS-UCD1.2 X g.80411671A>C c.924+2T>G c.DNA position is based on NM_001081743.2 2002 12021844 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000543-9913 cattle Holstein Friesian Anhidrotic ectodermal dysplasia EDA splicing yes ARS-UCD1.2 X g.80411795C>A "a single nucleotide polymorphism (SNP) G/A at the 9th base of exon 8 [GenBank: AJ278907.1 position 30.549] ... Sequencing of the RT-PCR products revealed that the amplified fragment of the affected animals lacked ... exon 8. At the protein level, the exon skipping leads to a frameshift and consequently to a premature stop codon." (Gargani et al., 2011) 2011 21740563
OMIA 000543-9913 cattle Red Angus-Charolais-Simmental cross Anhidrotic ectodermal dysplasia EDA nonsense (stop-gain) yes ARS-UCD1.2 X g.80415626G>A c.730C>T p.(R244*) 2007 17616058 Reference not in PubMed; see OMIA 000543-9913 for reference details The g. coordinate for the named reference genome assembly, together with the c. coordinate, were kindly provided by Tosso Leeb (22 March 2021)
OMIA 000543-9913 cattle Japanese Black Anhidrotic ectodermal dysplasia EDA insertion, small (<=20) yes ARS-UCD1.2 X g.80802800_80802801insCCCT c.280_281insAGGG p.(G94Qfs*49) 2012 22497423 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000543-9913 cattle Holstein Anhidrotic ectodermal dysplasia EDA deletion, small (<=20) yes ARS-UCD1.2 X g.80803015_80803033del c.48_66del "a 19-bp deletion at nucleotides c.48_66 in exon 1 ... . This mutation is predicted to generate a truncated 49 aa protein." 2011 21410470
OMIA 000543-9615 dog Dachshund X-linked hypohidrotic ectodermal dysplasia EDA deletion, small (<=20) yes CanFam3.1 X g.54509504delT c.842delT p.(L281Hfs*22) 2018 30276836
OMIA 000543-9913 cattle German Holstein Anhidrotic ectodermal dysplasia EDA deletion, gross (>20) yes UMD3.1 X c.397_502del a large deletion including exon 3 in the gene for ectodysplasin (ED1; now called EDA) 200922: g. info moved to here (g.85821470) until it can be standardised 2001 11591646 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000543-9913 cattle French Holstein Generalized hypohidrotic ectodermal dysplasia EDA inversion yes UMD3.1 X g.82271053_86034441inv Escouflaire et al. (2019): The "first breakpoint . . . [is] between positions 82,271,052 and 82,271,053 bp on chromosome X . . . The second breakpoint is situated at position 86,034,441 bp within the EDA intron 1" 2019 31533624
OMIA 001695-8090 Japanese medaka Reduced scale-3 edar insertion, gross (>20) yes "several kb of extra sequence in the 5' UTR that . . . contains out-of-frame start codons and stop codons, [and consequently] the mutant transcript is likely to result in premature initiation and termination of translation and, as a result, the EDAR protein is not synthesized" 2001 11516953
OMIA 002128-9913 cattle Charolais Anhidrotic ectodermal dysplasia, EDAR-related EDAR insertion, small (<=20) yes ARS-UCD1.2 11 g.44599876_44599877insC p.(P161Rfs*97) UMD3.1 position is g.44462236_44462237insC 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001671-9031 chicken Ayam Cemani Black H'Mong Silky/Silkie Svarthöna (ohuslän-Dals Svarthöna) Silky/Silkie pigmentation (Fibromelanosis) EDN3 FM complex rearrangement no 20 the FM mutation actually involves "the duplication of two genomic regions, each larger than 100 kb and separated by 417 kb on wild-type [GGA20] chromosomes" 2011 22216010
OMIA 002164-9925 goat Coat colour, white spotting, EDNRA-related EDNRA repeat variation no 17 "a 1Mb copy number variant (CNV) harboring 5 genes including EDNRA. The analysis of 358 Boer goats revealed 3 alleles with one, two, and three copies of this CNV. The copy number is correlated with the degree of white spotting in goats" 2016 27329507
OMIA 000629-9796 horse American Paint Horse Miniature Horse Pinto Horse Quarter Horse Thoroughbred Megacolon EDNRB frame overo delins, small (<=20) yes EquCab2.0 17 c.353_354delinsAG p.(I118K) 1998 9530628 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124 200922: g. info removed to here (g.50624658) until can be standardised
OMIA 001765-9940 sheep Cameroon Waardenburg syndrome, type 4A EDNRB deletion, gross (>20) yes Oar_rambouillet_v1.0 10 "a deletion of about 110 kb on sheep chromosome [OAR]10, comprising the entire EDNRB gene" 2012 23300849
OMIA 001904-9031 chicken Feather colour, recessive white EDNRB2 mo^w missense no 4 c.1008G>T p.(C244F) 2014 24466053
OMIA 001904-9031 chicken Feather colour, mottled EDNRB2 mo missense no 4 c.1272G>A p.(R332H) 2014 24466053
OMIA 000375-93934 Japanese quail Feather colour, panda/dotted white EDNRB2 missense no c.995G>A p.(R332H) 2007 17313575
OMIA 001252-8843 domestic goose Gang Feather colour, recessive white EDNRB2 insertion, small (<=20) no AnsCyg_PRJNA183603_v1.0 g.750748_750735insCACAGGTGAGCTCT "NW_013185915.1: g. 750,748-750,735 insertion. CACAGGTGAGCTCT" (Xi et al., 2020) 2020 32066369
OMIA 001805-9615 dog Italian Greyhound Amelogenesis imperfecta ENAM deletion, small (<=20) yes 13 c.1991_1995delTTTCC p.(F665Rfs*3) 2013 23638899
OMIA 001805-9615 dog Parson Russell Terrier Amelogenesis imperfecta ENAM missense yes CanFam3.1 13 c.716C>T p.(P239L) 2019 30877375
OMIA 000296-9031 chicken Duplex comb EOMES duplication no 2 "a 20 Kb tandem duplication containing several conserved putative regulatory elements located 200 Kb upstream of the eomesodermin gene (EOMES)" 2015 25789773
OMIA 000240-8932 rock pigeon Crest EPHB2 cr missense no c.???C>T p.(R758C) 2013 23371554
OMIA 001716-9913 cattle Holstein Ehlers-Danlos syndrome, Holstein variant EPYC missense yes UMD3.1 5 g.20922527G>T c.258G>T p.(S87N) 1999 10357109 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000483-9925 goat Polled intersex syndrome ERG PIS complex rearrangement yes 1 "a deletion with a total length of 10 159 bp and an inversely inserted approximately 480 kb-sized duplicated segment of a region located approximately 21 Mb further downstream on chromosome 1 containing two genes, KCNJ15 and ERG" (Simon et al., 2020) 2020 32060960
OMIA 000197-9031 chicken Cleft primary palate ESRP2 deletion, small (<=20) yes galGal5 11 g.3384959delT ss5200091912 2020 32162363
OMIA 000187-9913 cattle Japanese Brown Chondrodysplasia EVC2 splicing yes ARS-UCD1.2 6 g.103594013C>T c.1356C>T Variant creates a cryptic splice donor site in exon 11 which is leading to improper splicing at position c.1355 and resulting in the 56-base RNA deletion between 1355 and 1410. The deletion causes a frameshift and premature termination. 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000187-9913 cattle Japanese Brown Chondrodysplasia EVC2 delins, small (<=20) yes ARS-UCD1.2 6 g.103609778_103609779delinsG c.2327_2328delinsG p.(A776Gfs*22) Published as c.2054_2055delCAinsG, cDNA and protein position in this table based on ENSBTAT00000005613.6 2002 12136126 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000187-9913 cattle Tyrolean Grey Chondrodysplasia EVC2 deletion, small (<=20) yes ARS-UCD1.2 6 g.103651709_103651710del c.2993_2994del p.(D998Efs*13) 2014 24733244 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. 210909 FN: given that the variant is a 2bp del (AC), g.103651710_103651710del needs to be changed. BLASTing with AGAGGAGCAAGAAGAC from Fig.4 indicates that it is 719 and 710 that are deleted. THus the entry is changed to g.103651709_103651710del; and AC is removed from the c. entry.
OMIA 002042-9913 cattle Belgian Blue Abortion (embryonic lethality), EXOSC4 EXOSC4 nonsense (stop-gain) yes UMD3.1 14 g.1947890G>A c.190G>A p.(R64*) 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001214-9615 dog American Staffordshire Terrier Osteochondromatosis EXT2 nonsense (stop-gain) yes CanFam3.1 18 g.5101754C>A c.969C>A p.(Y323*) 2018 29485212
OMIA 000363-9615 dog Kerry Blue Terrier Factor XI deficiency F11 insertion, gross (>20) yes 16 "a short interspersed nucleotide element (SINE) insertion" 2006 Reference not in PubMed; see OMIA 000363-9615 for reference details
OMIA 000363-9913 cattle Japanese Black Factor XI deficiency F11 delins, small (<=20) yes ARS-UCD1.2 27 g.16305660delinsATATGTGCAGAATATA c.870delinsATATGTGCAGAATATA P.(F290delinsLYVQNI) 2005 16104386 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000363-9913 cattle Holstein Sahiwal Factor XI deficiency F11 insertion, gross (>20) yes UMD3.1 27 a 76-bp insertion in exon 12 of the Factor XI gene 200922: g. and c. info moved here (g.15367048; c.1406ins76) until can be standardised 2004 15566468 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000364-9685 domestic cat Factor XII deficiency F12 deletion, small (<=20) yes A1 c.1321delC p.(C441fs*119) 2015 24793828
OMIA 000364-9685 domestic cat Domestic Shorthair Factor XII deficiency F12 missense yes Felis_catus_9.0 A1 g.175382065G>C c.1631G>C p.(G544A) NM_001168212.2:c.1631G>C; Felis_catus_6.2: g.173159981G>C 2017 28392508 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000361-9783 Asiatic elephant Factor VII deficiency F7 missense yes c.202A>G p.(R68G) 2017 28118558
OMIA 000361-9615 dog Beagle Factor VII deficiency F7 missense yes CanFam3.1 22 g.60578895G>A c.407G>A p.(G136E) 2006 16961583 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000437-9615 dog Irish Setter Miniature Schnauzer Haemophilia A F8 splicing yes X intronic inversion that results in "aberrant splicing and premature termination" 2002 12008949
OMIA 000437-9615 dog Boxer Haemophilia A F8 missense yes X c.1412C>G p.(P471R) 2014 25040606
OMIA 000437-9615 dog German Shepherd Dog Haemophilia A F8 missense yes X c.1643G>A p.(C548Y) 2014 25040606
OMIA 000437-9615 dog Old English Sheepdog Haemophilia A F8 nonsense (stop-gain) yes CanFam3.1 X g.122973422C>T c.1786C>T p.(R596*) 2016 27780008 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000437-9615 dog German Shepherd Dog Haemophilia A F8 nonsense (stop-gain) yes CanFam3.1 X g.123043081G>A c.98G>A p.(W33*) 2011 21949058 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000437-9615 dog Rhodesian Ridgeback Haemophilia A F8 insertion, gross (>20) yes CanFam3.1 X g.1240738676_77ins c.4824_25ins221 NM_001003212.1:c.4824_25ins22 2021 33494213
OMIA 000437-9940 sheep Swiss Alpine Haemophilia A F8 delins, small (<=20) yes Oar_rambouillet_v1.0 X g.86301507_86301516delinsTAATTAATACC c.3108_3117delinsGGTATTAATTA The 11 bp region in exon 14 that differed between the wild-type and the hemophiliac introduced a premature stop codon 2010 19943872 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. 210906 After checking the cDNA sequence in Fig. 3 of the paper, FN concluded that the 10bp deletion starts at c.3108 and ends at c.3117 and that the 11bp inserted sequence is GGTATTAATTA. Thus the HGVS-consistent notation is c.3108_3117delinsGGTATTAATTA, instead of c.3107del10ins11.
OMIA 000437-9913 cattle German Fleckvieh Haemophilia A F8 missense yes UMD3.1 X g.38842314A>T p.(H45L) ss213751737 2018 29774585
OMIA 000437-9913 cattle Japanese Brown Haemophilia A F8 missense yes UMD3.1 X g.38971744T>A c.6458T>A p.(L2153H) 2009 19456318 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000438-9615 dog Lhasa Apso Haemophilia B F9 deletion, small (<=20) yes X "a deletion including nucleotides 772-776 and a C-->T transition at nucleotide 777" 1996 8896410
OMIA 000438-9615 dog Labrador Retriever Haemophilia B F9 deletion, gross (>20) yes X a deletion of the entire gene 1997 9394892
OMIA 000438-9615 dog Airedale Terrier Haemophilia B F9 deletion, gross (>20) yes X a deletion "spanning the entire 5' region of the factor IX gene extending to exon 6" 1999 10544912
OMIA 000438-9615 dog Airedale Terrier Haemophilia B F9 insertion, gross (>20) yes X "An approximately 5 kb insertion disrupted exon 8 of the second breed-variant. This insertion was associated with alternative splicing between a donor site 5' and acceptor site 3' to the normal exon 8 splice junction, with introduction of a new stop codon. The resultant transcript lacked most of the factor IX catalytic domain and 3' untranslated region." 1999 10544912
OMIA 000438-9685 domestic cat Haemophilia B F9 nonsense (stop-gain) yes X c.??C>T p.(R338*) 2005 15822564
OMIA 000438-9685 domestic cat Domestic Longhair Haemophilia B F9 missense yes X c.??G>A p.(C82Y) 2005 15822564
OMIA 000438-9615 dog German Wirehaired Pointer Haemophilia B F9 insertion, gross (>20) yes CanFam3.1 X A 1.5kb LINE1 insertion in exon 5. g coordinate of insertion obtained from Brenig et al. (2019) 200922: g. info moved here (g.109521130ins) until can be standardised 2003 14722728
OMIA 000438-9615 dog Hovawart Haemophilia B F9 regulatory yes CanFam3.1 X g.109501492delC Brenig et al. (2019): NC_006621.3:g.109501492delC; "The deletion is located 73 bp upstream of the F9 start codon in the conserved overlapping DNA binding sites of hepatocyte nuclear factor 4α and androgen receptor." 2019 30846504
OMIA 000438-9615 dog Rhodesian Ridgeback Haemophilia B F9 missense yes CanFam3.1 X g.109530847G>A c.731G>A p.(G244E) 2011 20303304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000438-9615 dog Cairn Terrier Haemophilia B F9 missense yes CanFam3.1 X g.109532018G>A c.1477G>A p.(G418E) Updated g. and p. coordinates obtained from Brenig et al. (2019) 1989 2481310
OMIA 002032-9615 dog Border Collie Mixed breed Neuropathy, sensory FAM134B inversion yes 4 "6.47 Mb inversion was identified with breakpoints in intron 3 of FAM134B (chr4:86,910,352) and in an upstream intergenic region (chr4:80,439,639" 2016 27527794
OMIA 002032-9615 dog Mixed breed Neuropathy, sensory FAM134B missense yes CanFam3.1 4 g.86916562C>T c.656C>T p.(P219L) cDNA information based on NM_001314111.1 2021 34387380
OMIA 001918-9615 dog Tibetan Spaniel Tibetan Terrier Progressive retinal atrophy, type 3, FAM161A-related FAM161A insertion, gross (>20) yes CanFam2.0 10 A ~230bp insertion containing a 132bp short interspersed nuclear element (SINE), near the splice acceptor site of exon 5 200922: g. info moved here (g.64974130) until can be standardised 2014 24705771
OMIA 002259-9913 cattle Montbeliarde de novo mutation in an AI sire FAM189A1 missense yes UMD3.1 21 g.28644665T>C p.(N192S) Bourneuf et al. (2017) detected FAM189A1 g.28644665T>C; p.N192S as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Montbéliarde AI bull. No information was provided on the descendants of this bull. 2017 28904385
OMIA 002015-9615 dog Border Collie Dental hypomineralization FAM20C missense yes CanFam3.1 6 g.16452327C>T c.899C>T p.(A300V) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001327-9615 dog Irish Terrier Kromfohrländer Hyperkeratosis, palmoplantar FAM83G missense yes CanFam3.1 5 g.41055619G>C c.155G>C p.(R52P) 2014 24832243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001683-9615 dog Cavalier King Charles Spaniel Congenital keratoconjunctivitis sicca and ichthyosiform dermatosis FAM83H deletion, small (<=20) yes 13 c.977delC p.(P326Hfs*258) 2012 22253609
OMIA 000366-9615 dog Basenji Fanconi syndrome FAN1 deletion, gross (>20) yes 3 "317 bp of exon 14 were deleted starting at the second exon14 nucleotide and extending into the 3' untranslated region of FAN1" 2011 Reference not in PubMed; see OMIA 000366-9615 for reference details
OMIA 000151-9913 cattle Holstein Brachyspina FANCI deletion, gross (>20) yes UMD3.1 21 g.21184870_21188198del p.(V877Lfs*27) 2012 22952632 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002064-9685 domestic cat British Shorthair Autoimmune lymphoproliferative syndrome FASLG insertion, small (<=20) yes F1 g.14607400insA c.413_414insA p.(R140Kfs*37) 2017 27770190
OMIA 000628-9913 cattle Limousin Marfan syndrome FBN1 missense yes UMD3.1 10 g.62054844G>A c.3598G>A p.(E1200K) 2005 15776436 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000628-9913 cattle Japanese Black Marfan syndrome FBN1 splicing yes UMD3.1 10 g.62141462G>A c.8227-1G>A 2012 22221020 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000836-9913 cattle Blonde d'Aquitaine Limousin Protoporphyria FECH extension (stop-lost) yes UMD3.1 24 g.57298883G>T c.1250G>T p.(*417Lext*27) 1998 9784594 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001525-9615 dog German Shepherd Dog Leukocyte adhesion deficiency, type III FERMT3 insertion, small (<=20) yes 18 "12-base pair insertion" 2010 20126836
OMIA 002382-9615 dog Miniature Wirehaired Dachshund Afibrinogenaemia FGA deletion, small (<=20) yes CanFam3.1 15 g.52240694delA c.1665delT p.(I555Mfs*33) Transcript XM_532697.6 / ENSCAFT00000043702.3 rs1152388481 rs1152388481 2021 34356081
OMIA 002374-9913 cattle Holstein Friesian Jersey Charcot Marie Tooth disease FGD4 splicing yes UMD3.1 5 g.77632752C>T c.1671+1G>A Splice donor mutation based on XM_005206883.3 2021 34045765
OMIA 001723-9940 sheep Romney Marsh Familial episodic ataxia FGF14 nonsense (stop-gain) yes Oar_rambouillet_v1.0 10 g.88095843G>A c.46C>T p.(Q16*) Oar_v3.1 position is g.77593415 2017 29253853 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000889-9031 chicken Israeli experimental line Storrs, Connecticut (low line) UC Davis lines Scaleless FGF20 nonsense (stop-gain) yes GalGal4 4 g.62878803A>T c.535A>T p.(R179*) 2012 22712610 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000272-9615 dog Rhodesian Ridgeback Thai Ridgeback Ridge & dermoid sinus FGF3 Ridge allele duplication yes 18 A large ~133,000 bp duplication on chromosome 18, encompassing three FGF genes (FGF3, FGF4, FGF19) and another gene ORAOV1 2007 17906623
OMIA 000187-9615 dog Basset Hound Cairn Terrier Cardigan Welsh Corgi Dachshund Dandie Dinmont Terrier Lancashire heeler Norwich Terrier Pekingese Pembroke Welsh Corgi Petit Basset Griffon Vendéen Shih-Tzu Skye Terrier Swedish Vallhund Tibetan Spaniel West Highland Terrier Chondrodysplasia FGF4 insertion, gross (>20) yes 18 a 5kb insertion containing a FGF4 retrogene, i.e. a processed pseudogene of FGF4: The insertion containing the FGF4 retrogene starts at 23,431,136 on CFA18, which is 25Mb away from the complete (original) FGF4 gene, which is located at CFA18 48413479-48415205 2009 19608863
OMIA 002133-9615 dog Nova Scotia Duck Tolling retriever Skeletal dysplasia, FGF4-retrogene-related FGF4 insertion, gross (>20) yes CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until can be standardised 2017 29073074
OMIA 000157-9615 dog American Cocker Spaniel Basset Hound Beagle Cardigan Welsh Corgi Chesapeake Bay Retriever Chihuahua Coton de Tulear Dachshund English Springer Spaniel French Bulldog Nova Scotia Duck Tolling retriever Intervertebral disc disease, type I FGF4 retrogene in CFA12 insertion, gross (>20) yes CanFam3.1 12 " the insertion on CFA12 is 3,209 bp long (GenBank accession no. MF040221) and includes parental FGF4 cDNA (i.e., FGF4 exons spliced without introns) . . . ." 200922: g. info moved here (g.33710178_33710179insMF040221) until it can be standardised 2017 29073074
OMIA 000439-9844 llama Long hair FGF5 complex rearrangement no A "a single base deletion (c.348delA), [and] a 12-bp insertion (c.351_352insCATATAACATAG)" that comprise a single likely causal variant 2017 29024003
OMIA 000439-9685 domestic cat Maine Coon Persian Ragdoll Somali Long hair FGF5 missense no B1 c.194C>A p.(P65H) 2007 17433015
OMIA 000439-9793 ass Hair, long FGF5 nonsense (stop-gain) no c.245G>A 2014 25927731
OMIA 000439-10141 domestic guinea pig Long hair Fgf5 nonsense (stop-gain) no c.403C>T p.(R135*) "The data were submitted to the European Variation Archive (accession no. PRJEB24997)" 2018 29603294
OMIA 000439-9793 ass Hair, long FGF5 deletion, small (<=20) no c.433_434delAT 2014 25927731
OMIA 000439-9685 domestic cat Long hair FGF5 deletion, small (<=20) no B1 c.474delT AM412646 c.474delT 2007 17433015
OMIA 000439-9844 llama Long hair FGF5 nonsense (stop-gain) no c.499C>T 2017 29024003
OMIA 000439-10036 golden hamster Hair, long Fgf5 deletion, small (<=20) no c.546delG p.(R184GfsX6) 2015 26481120
OMIA 000439-9685 domestic cat Long hair FGF5 insertion, small (<=20) no B1 c.ins356T 2007 17767004
OMIA 000439-9838 Arabian camel Long hair FGF5 missense no CamDro3 2 g.76625546C>T c.779C>T p.(P260L) cDNA and protein positions based on transcript ENSCDRT00005003721.1 2021 34432312
OMIA 000439-9615 dog Eurasier Long hair FGF5 deletion, small (<=20) no CanFam3.1 32 c.556_571del16 p.(A186Tfs*69) 2013 23384345
OMIA 000439-9615 dog Afghan Hound Eurasier Long hair FGF5 duplication no CanFam3.1 32 c.559_560dupGG p.(R188Afs*73) 2013 23384345
OMIA 000439-9615 dog Afghan Hound Border Collie Cocker Spaniel Collie Corgi Dachshund German Shepherd Dog Golden Retriever Pomeranian Samoyed Long hair FGF5 missense no CanFam3.1 32 g.4509367G>T c.284G>T p.(C95F) rs851828354 2006 16879338 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000439-9615 dog Afghan Hound Long hair FGF5 splicing no CanFam3.1 32 g.4517257T>A rs397511324 2013 23384345 30 Dec 2020: g. coordinate corrected: thanks to Angelica K Kallenberg
OMIA 000439-9615 dog Akita Samoyed Long hair FGF5 missense no CanFam3.1 32 g.4528639C>T c.578C>T p.(A193V) 2013 23384345 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000439-9685 domestic cat Long hair FGF5 missense no Felis_catus_6.2 B1 g.140077554A>C c.475A>C p.(T159P) 2007 17433015 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000439-9685 domestic cat Norwegian Forest Long hair FGF5 missense no Felis_catus_6.2 B1 g.140097052T>A c.182T>A p.(V61D) 2007 17433015 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000439-9685 domestic cat Norwegian Forest Long hair FGF5 nonsense (stop-gain) no Felis_catus_9.0 B1 g.142177919G>A c.406C>T p.(R136*) XM_019828138.2:c.406C>T; Felis_catus_6.2: g.140089230C>T 2007 17767004 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 002090-9913 cattle Holstein Facial dysplasia syndrome FGFR2 missense yes UMD3.1 26 g.41861956G>T c.927G>T p.(W309C) 2017 28768473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001703-9913 cattle Holstein Chondrodysplasia, disproportionate FGFR3 extension (stop-lost) yes ARS-UCD1.2 6 g.116767863C>A c.2408G>T p.(*803Lext*93) NM_174318.3: c.2408G>T; [XM_024992994.1: p.(Ter803Leuext*93) 2020 32239744
OMIA 001703-9940 sheep Suffolk Chondrodysplasia, Spider lamb FGFR3 missense yes Oar_rambouillet_v1.0 6 g.128784747A>T c.1719T>A p.(V700E) 2006 16441300 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001335-9615 dog German Shepherd Dog Renal cystadenocarcinoma and nodular dermatofibrosis FLCN missense yes CanFam3.1 5 g.42186445A>G c.764A>G p.(H255R) rs1152388411 2003 14532326 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001360-9031 chicken Beijing You ISA Brown Lohmann Brown Marans Rhode Island Red TETRA Transylvanian naked neck Trimethylaminuria (fishy taint) FMO3 missense yes 8 c.1034A>T p.(T329S) 2005 15916878
OMIA 001360-9913 cattle Swedish Red and White Trimethylaminuria (fishy taint) FMO3 nonsense (stop-gain) yes UMD3.1 16 g.39523051C>T c.712C>T p.(R238*) rs797790546 2002 12466292 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
OMIA 000526-9615 dog Weimaraner Hypomyelination of the central nervous system FNIP2 deletion, small (<=20) yes 15 c.880delA p.(I294fs*296) cDNA position based on XM_532705 2014 24272703
OMIA 000323-9615 dog Chinese Crested Dog Mexican Hairless Dog (Xoloitzcuintli) Peruvian Hairless Dog (Inca Hairless) Ectodermal dysplasia FOXI3 insertion, small (<=20) yes 17 a 7-bp tandem duplication in exon 1 of FOXI3 2008 18787161
OMIA 001949-9685 domestic cat Birman Hypotrichosis, with short life expectancy FOXN1 deletion, small (<=20) yes E1 c.1030_1033delCTGT The identified deletion (c.1030_1033delCTGT, exon 6) produced a frameshift leading to a premature stop codon at position 547 in the protein (Abitbol et al., 2015). cDNA position based on ENSFCAG00000008268. 2015 25781316
OMIA 000396-9615 dog English Springer Spaniel Fucosidosis, alpha FUCA1 deletion, small (<=20) yes 2 a 14-bp deletion at the 3' end of exon 1 1996 8730282
OMIA 000862-9823 pig Resistance to oedema disease (F18 receptor) FUT1 missense no Sscrofa11.1 6 g.54079560 c.304A>G p.(T103A) The variant was initially described as c.307G>A and p.A103T by Vögeli et al. 1997. VEP analysis identified the variant as c.304A>G p.T102A in transcript ENSSSCT00000051297.2 rs335979375 2000 11132149
OMIA 002318-9913 cattle Montbeliarde coat colour, dilution (milca) FZD7 missense no ARS-UCD1.2 2 g.90572569G>C c.1241G>C p.(G414A) CDS position in transcript ENSBTAT00000002946.6 based on ENSEMBL Variant Effect Predictor 2021 33686687
OMIA 000418-9615 dog Maltese Glycogen storage disease Ia G6PC missense yes 9 c.450G>C p.(M121I) 1997 9259982
OMIA 000419-9913 cattle Shorthorn Glycogen storage disease II GAA E18 deletion, small (<=20) yes ARS-UCD1.2 19 g.52484973_52484974del c.2454_2455del p.(T819R) 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000419-9913 cattle Brahman Glycogen storage disease II GAA E13 nonsense (stop-gain) yes ARS-UCD1.2 19 g.52488949G>A c1783C>T p.(R595*) UMD3.1 position is g.53105979C>T 2000 10723725 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000419-9913 cattle Brahman Droughtmaster Glycogen storage disease II GAA E7 deletion, small (<=20) yes ARS-UCD1.2 19 g.52492405_52492406del c.1057_1058del p.(Y353L) UMD3.1 position is g.53109436_53109437del 2000 10723725 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000419-9615 dog Finnish Lapphund Swedish Lapphund Glycogen storage disease II GAA nonsense (stop-gain) yes CanFam3.1 9 g1603730G>A c.2237G>A p.(W746*) 2013 23457621 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000578-9615 dog Irish Setter Krabbe disease GALC insertion, gross (>20) yes 8 "a 78 bp insertion" 2006 16490723
OMIA 000578-9544 Rhesus monkey Krabbe disease GALC deletion, small (<=20) yes c.387delAC 1997 9192853
OMIA 000578-9615 dog Cairn Terrier West Highland White Terrier Krabbe disease GALC missense yes 8 c.473A>C p.(Y158S) 1996 8661004
OMIA 002375-9913 cattle Holstein Friesian Jersey Congenital disorder of glycosylation GALNT2 splicing yes UMD3.1 28 g.1312334G>A c.1561-1G>A Splice acceptor mutation based on NM_001193103.1. 2021 34045765
OMIA 001826-9913 cattle Holstein Abortion due to haplotype HH4 GART missense yes UMD3.1 1 g.1277227A>C c.869A>C p.(N290T) rs465495560 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 000405-9940 sheep Southdown Gaucher disease, type GBA missense yes Oar_rambouillet_v1.0 1 g.111561271C>T c.1142G>A p.(C381Y) Oar_v3.1 position is g.103978212C>T rs429928390 2017 29023809 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000420-9685 domestic cat Norwegian Forest Glycogen storage disease IV GBE1 complex rearrangement yes C2 200922: g. info moved here (g. IVS11+1552_IVS12-1339 del6.) until it can be standardised 2007 17257876
OMIA 000420-9796 horse American Quarter Horse Glycogen storage disease IV GBE1 nonsense (stop-gain) yes 26 c.102C>A p.(Y34*) 2004 15366377
OMIA 001245-9031 chicken Rhode Island Red Retinal degeneration I GC1 complex rearrangement yes 26 This allele is characterised by an 81bp insertion adjacent to a 642bp deletion 1998 9448321
OMIA 000701-9031 chicken Naked neck GDF7 insertion, gross (>20) yes 3 a large insertion approximately 260kb downstream from the BMP12 gene (now known as GFD7), increasing the expression of this gene in embryonic skin 2011 21423653
OMIA 002366-9685 domestic cat Toyger Holoprosencephaly GDF7 deletion, small (<=20) yes Felis_catus_9.0 A3 g.127002233_127002239delGCCGCGC c.221_227delGCCGCGC p.(R74Pfs*17) "a 7 bp deletion in the coding region of GDF7 (c.221_227delGCCGCGC [p.Arg74Profs*17]) at the position A3:127002233 (ENSFCAT00000063603)" (Yu et al., 2020) 2020 32575532
OMIA 002362-9615 dog Entlebucher mountain dog Fecundity GDF9 missense no CanFam3.1 11 g.21147009G>A p.(P77S) 2020 31802524
OMIA 000385-9940 sheep Cheviot Fecundity, Thoka, FecG GDF9 FecG(T) missense no Oar_rambouillet_v1.0 5 g.46545130T>G c.1279A>C p.(S427R) Oar_v3.1 position is g.41841117T>G; protein and cDNA positions are based on NP_001136360.2 and NM_001142888.2, respectively 2009 19713444 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001801-9940 sheep Belclare Irish Cambridge Fecundity, High fertility, FecG GDF9 FecG(H) missense no Oar_rambouillet_v1.0 5 g.46545225G>A c.1184C>T p.(S395F) Oar_v3.1 position is g.41841212G>A; protein and cDNA position based on NP_001136360.2 and NM_001142888.2 respectively 2004 14627550 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001763-9940 sheep Norwegian White Fecundity, Norwegian White Sheep GDF9 missense no Oar_rambouillet_v1.0 5 g.46545298C>T c.1111G>A p.(V371M) Oar_v3.1 position is g.41841285C>T, protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively rs403536877 2013 23280002 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001559-9940 sheep Brazilian Santa Inês Mexican Pelibuey Fecundity, Embrapa, FecG GDF9 FecG(E) missense no Oar_rambouillet_v1.0 5 g.46545375A>C c.1034T>G p.(F345C) Oar_v3.1 position is g.41841362T>G; protein and cDNA position based on NP_001136360.2 and NM_001142888.2, respectively rs1092755620 2020 31961953 20528846 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001961-9940 sheep Ile de France Fecundity, Vacaria, FecG GDF9 FecG(V) missense no Oar_rambouillet_v1.0 5 g.46545466G>A c.943C>T p.(R315C) Oar_v3.1 position is g.41841453G>A; protein and cDNA positions based on NP_001136360.2 and NM_001142888.2, respectively 2014 25039891 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001514-9615 dog English Pointer English Springer Spaniel French Spaniel German Shorthaired Pointer Acral mutilation syndrome GDNF regulatory yes CanFam3.1 4 g.70875561C>T "This variant, located 90 kb upstream of the GDNF gene, a highly relevant neurotrophic factor candidate gene, lies in [the last exon of] a long intergenic non-coding RNAs (lincRNA), GDNF-AS." 2016 28033318
OMIA 001208-9615 dog Labrador Retriever Alexander disease GFAP missense yes CanFam3.1 9 g.18572769G>A c.719G>A p.(R240H) rs850986067 2016 26486469 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001442-9913 cattle Japanese Black Forelimb-girdle muscular anomaly GFRA1 nonsense (stop-gain) yes UMD3.1 26 g.36951312C>T c.430C>T p.(Q144*) 2013 Reference not in PubMed; see OMIA 001442-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001089-9823 pig Blood group system ABO GGTA1 O deletion, gross (>20) no 1 "the 0 allele has a large deletion between exon 7 of the A0 blood group gene and the neighbouring SURF6". 2011 21554350
OMIA 001473-9915 zebu Brahman Dwarfism, growth-hormone deficiency GH1 missense yes c.641C>T p.(T200M) Bos indicus cDNA position based on AF034386, protein position based on AAB92549 2009 19524387 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001473-9615 dog Chihuahua Dwarfism, growth-hormone deficiency GH1 deletion, small (<=20) yes CanFam3.1 9 c.573_578del 2020 32646299
OMIA 000309-9031 chicken Connecticut (CT) strain S2 line Dwarfism, sex-linked GHR deletion, gross (>20) yes Z deletion of 1773 bp in the 3' end of the coding region of the growth hormone receptor gene 1994 7964293
OMIA 001920-27706 largemouth bass Abortion due to deletion in GHRH GHRH deletion, gross (>20) yes a 66bp deletion (c.-923_-858del) in the 5' flanking region of the GHRH gene in an autosomal recessive embryonic lethal 2014 24697798
OMIA 002119-9615 dog Leonberger Polyneuropathy (LPN2) GJA9 deletion, small (<=20) yes CanFam3.1 15 g.3863524_3863525delAG c.1107_1108delAG p.(A370Nfs*12) 2017 28841859
OMIA 000402-9615 dog Shiba Gangliosidosis, GM1 GLB1 deletion, small (<=20) yes 23 a deletion of a cytosine in exon 15 that causes a premature stop codon in GLB1 2002 12555949
OMIA 000402-9615 dog Alaskan Husky Gangliosidosis, GM1 GLB1 insertion, small (<=20) yes 23 a 19 base pair duplication in exon 15 2001 11355658
OMIA 000402-9615 dog Portugese water dog Gangliosidosis, GM1 GLB1 missense yes 23 c.200G>A p.(R60H) 2000 11032334
OMIA 000402-9685 domestic cat Gangliosidosis, GM1 GLB1 missense yes Felis_catus_6.2 C2 g.155458074G>C c.1448G>C p.(R483P) 2008 18353697 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000402-9940 sheep Romney Marsh Gangliosidosis, GM1 GLB1 missense yes Oar_rambouillet_v1.0 19 g.8003247C>A c.686G>T p.(C299F) cDNA position based on ENSOART00020038844.1 2012 Reference not in PubMed; see OMIA 000402-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000689-9913 cattle Poll Hereford Myoclonus GLRA1 nonsense (stop-gain) yes UMD3.1 7 g.65080197C>A c.156C>A p.(Y52*) 2001 11178872 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001427-9685 domestic cat Gangliosidosis, GM2, GM2A deficiency GM2A deletion, small (<=20) yes A1 c.516_519delGGTC p.(V173Sfs*17) 2005 16200419
OMIA 001368-9031 chicken Retinopathy globe enlarged GNB3 deletion, small (<=20) yes 1 c.D153del 2006 17065478
OMIA 001248-9685 domestic cat Domestic Shorthair Mucolipidosis II GNPTAB nonsense (stop-gain) yes Felis_catus_6.2 B4 c.2644C>T p.(Q882*) Wang et al. (2018): "NCBI-RefSeq accession no. XM_003989173.4, Gene ID: 101100231" 2018 30591066
OMIA 000665-9925 goat Mucopolysaccharidosis IIID GNS nonsense (stop-gain) yes ARS1 5 g.48406875C>T c.304C>T p.(R102*) 1995 7623459 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries. Published as c.322C>T. Updated position based on ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000018630.1
OMIA 001985-9913 cattle Fleckvieh Dwarfism, Fleckvieh GON4L deletion, small (<=20) yes UMD3.1 3 g.15079217del c.4286del p.(G1430Kfs*66) rs723240647 2016 27036302 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: to be consistent with HGVS, FN changed g.15079217delC to g.15079217del. An examination of the information for rs723240647 indicated that c.4285_4287delCCCinsCC should be changed to c.4286del
OMIA 002207-9615 dog Cocker Spaniel Bernard-Soulier syndrome, type C GP9 deletion, gross (>20) yes CanFam3.1 20 g.3025814_3028273del2460 Gentilini et al. (2019): "The deletion truncates 104 (71%) of the 146 codons of the wildtype canine reading frame." 2019 31484196
OMIA 000821-9685 domestic cat Primary hyperoxaluria type II (Oxalosis II) GRHPR splicing yes D4 "point mutation, G to A, . . . at the 3# splice acceptor site of intron 4" 2009 Reference not in PubMed; see OMIA 000821-9685 for reference details
OMIA 000078-9615 dog Coton de Tulear Ataxia, cerebellar GRM1 insertion, gross (>20) yes 1 "a 62-bp truncated retrotransposon insert in exon 8" 2011 21281350
OMIA 002268-9823 pig Danish Landrace Vitamin C deficiency GULO od deletion, gross (>20) yes 14 "This deletion includes 77 bp of exon VIII, 398 bp of intron 7 and 3.7 kbp of intron 8, which leads to a frame shift. The mutant protein is truncated to 356 amino acids, but only the first 236 amino acids are identical to the wild-type GULO protein." (Hasan et al., 2004) 2004 15112110
OMIA 000667-9685 domestic cat Mucopolysaccharidosis VII GUSB missense yes E3 c.1421T>G and c.1424C>T p.(S475A) and p.(R476W) 2015 26118695
OMIA 000667-9615 dog Brazilian Terrier Mucopolysaccharidosis VII GUSB missense yes CanFam3.1 6 g.740428C>T c.866C>T p.(P289L) 2012 22815736 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000667-9615 dog German Shepherd Dog Mucopolysaccharidosis VII GUSB missense yes CanFam3.1 6 g.741429G>A c.497G>A p.(R166H) 1998 9521879 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000667-9685 domestic cat Mucopolysaccharidosis VII GUSB missense yes Felis_catus_6.2 E3 g.15661641G>A c.1051G>A p.(E351K) 1999 10366443 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001158-9796 horse American Paint Horse Appaloosa Draft Quarter Horse Warmblood Polysaccharide storage myopathy/Exertional rhabdomyolysis GYS1 missense yes EquCab2.0 10 g.18940324G>A c.926G>A p.(R309H) 2008 18358695 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001374-9615 dog Labrador Myopathy, centronuclear HACD1 insertion, gross (>20) yes 2 200922: g. info moved here (g.9459_9460ins236) until it can be standardised 2005 15829503
OMIA 001561-9615 dog Shar-Pei Periodic Fever Syndrome HAS2 insertion, gross (>20) yes 13 "several copies of a the "meatmouth" (CNV-E) duplication upstream of the HAS2 gene" 2011 21437276
OMIA 000703-9615 dog Labrador Retriever Narcolepsy HCRTR2 splicing yes 12 a deletion of exon 6 due to a "G to A transition in the 5′ splice junction consensus sequence (position +5, exon 6–intron 6)" 1999 10458611
OMIA 000703-9615 dog Doberman Pinscher Narcolepsy HCRTR2 splicing yes 12 a "SINE insertion mutation [in the HCRTR2 gene] is the cause of narcolepsy in Dobermans" 1999 10458611
OMIA 000703-9615 dog Dachshund Narcolepsy HCRTR2 missense yes CanFam3.1 12 g.22517939G>A c.160G>A p.(E54K) 2001 11282968 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002230-9913 cattle Belted Galloway Hypotrichosis HEPHL1 nonsense (stop-gain) yes ARS-UCD1.2 29 g.721234A>T c.1684A>T p.(K562*) NC_037356.1 (ARS-UCD1.2 assembly, chromosome 29): g.721234A>T; NM_001192511.2 c.1684A>T; NP_001179440.1: p.Lys562* (Kuca et al., 2021) 2021 33926013
OMIA 001944-9615 dog Miniature Schnauzer Spondylocostal dysostosis, autosomal recessive HES7 deletion, small (<=20) yes CanFam3.1 5 g.32945846delG c.126delG p.(T43Pfs*24) 2015 25659135
OMIA 001987-9685 domestic cat Japanese domestic Bobtail HES7 JBT missense yes Felis_catus_9.0 E1 g.2918735A>G c.5A>G p.(V2A) XM_003996191.4:c.5T>C; Felis_catus_6.2: g.2819475A>G 2016 27030474 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001461-9217 American flamingo Tay-Sachs disease HEXA missense yes c.1406C>T p.(P469L) 2008 18693054
OMIA 001461-9615 dog Japanese Chin dog Gangliosidosis, GM2, type I HEXA missense yes CanFam3.1 30 g.35841247G>A c.967G>A p.(E323K) 2013 23266199 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001461-9940 sheep Jacob Gangliosidosis, GM2, type I (B variant) HEXA splicing yes Oar_rambouillet_v1.0 7 g.20584348C>G c.1330G>C The variant [c.1330G>C; G444R] at the end of exon 11 effects splicing and results in skipping of exon 11. 2010 20817517 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001461-9823 pig Wild boar Gangliosidosis, GM2, type I HEXA missense yes Sscrofa11.1 7 g.60910365C>T c.1495C>T p.(R499C) cDNA positions based on NM_001123221.1 2021 34119419
OMIA 001462-9685 domestic cat Burmese Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB splicing yes A1 c.1244-8_1250del15 2009 19231264
OMIA 001462-9685 domestic cat Domestic Shorthair Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB complex rearrangement yes A1 c.1467_1491inv25 p.(F488Lfs*4) or p.F488Lfs*4 2004 15081585
OMIA 001462-9615 dog Toy Poodle Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) yes 2 c.283delG p.(V59fs) 2012 22766310
OMIA 001462-9685 domestic cat Korat Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) yes A1 c.39delC p.(L14Sfs*82) 1994 8178934
OMIA 001462-9685 domestic cat Japanese domestic Gangliosidosis, GM2, type II (Sandoff or variant 0) HEXB nonsense (stop-gain) yes A1 c.667C>T p.(R223*) 2007 16872651
OMIA 001462-9615 dog Shiba-Inu Gangliosidosis, GM2, type II (Sandhoff or variant 0) HEXB deletion, small (<=20) yes CanFam3.1 2 g.57243656_57243658delCCT c.618_620delCCT p.(L317del) Wang et al. (2018) list the c. coordinate as p.Leu207del, but describe their variant as the same reported by Kolicheski et al. (2017) 2017 28833537
OMIA 002252-9615 dog Miniature Schnauzer Progressive retinal atrophy, Miniature Schnauzer, type 1 HIVEP3 regulatory yes CanFam3.1 15 g.1432293G>A "intronic variant in HIVEP3/ENSCAFG00000035604" (Kaukonen et al., 2020) 2020 32150541
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS deletion, small (<=20) yes D1 c.107_110delACAG p.(D36Vfs*6) 2013 24239138
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS insertion, small (<=20) yes D1 c.189dupT 2010 19934113
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS deletion, small (<=20) yes D1 c.842_844delGAG 2013 24239138
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS missense yes Felis_catus_6.2 D1 g.16391905G>A c.250G>A p.(A84T) 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS missense yes Felis_catus_6.2 D1 g.16392832C>T c.445C>T p.(R149W) 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001493-9685 domestic cat Porphyria, acute intermittent HMBS splicing yes Felis_catus_6.2 D1 g.16394866G>A c.826-1G>A 2013 24239138 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000299-9986 rabbit Dwarfism HMGA2 deletion, gross (>20) yes 4 "that the dwarf allele constitutes a ~12.1 kb deletion overlapping the promoter region and first three exons of the HMGA2 gene leading to inactivation of this gene." 2017 27986804
OMIA 000317-9913 cattle Highland Ears, crop HMX1 insertion, gross (>20) no 6 76bp duplication of 106,720058 to 106,720,133 on BTA6; UMD3 reference assembly 2013 24194898
OMIA 001952-9940 sheep Altay Microtia HMX1 duplication yes Oar_rambouillet_v1.0 6 He et al. (2020): "a 76 bp duplication of HMX1" (duplication of 76bp segment 6:126893417-126893492) 2020 31691317
OMIA 001952-9823 pig Microtia HOXA1 delins, small (<=20) yes Sscrofa11.1 18 g.45478109delinsTC c.451delinsTC p.(L151fs) 2015 26035869 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: XM_003134844.5 by Stephanie Shields (27/05/2020)
OMIA 000668-9031 chicken Huiyang Bearded Muffs and beard HOXB8 complex rearrangement no 27 "The Mb allele differs from the wild-type mb allele by three duplications, one in tandem and two that are translocated to that of the tandem repeat around 1.70 Mb on GGA27 2016 27253709
OMIA 000240-9031 chicken crested Polish Silky/Silkie Crest HOXC10 duplication no GRCg6a 33 g.7587588_7587784dup "a 197 bp duplication of an evolutionarily conserved sequence located in the intron of HOXC10 on chromosome 33" (Li et al., 2021) 2021 33704432
OMIA 000806-9925 goat Polyceraty HOXD1 delins, gross (>20) no ARS1 2 g.115652290_116155699delins137kb 2021 33528505
OMIA 000806-9940 sheep Polyceraty HOXD1 deletion, small (<=20) no Oar_rambouillet_v1.0 2 g.144548739_144548742del "a four-nucleotide deletion located at position +4 to +7 bp after exon 1 of the HOXD1 gene ([Oar_v4.0] g.132,832,249_132,832,252del; . . . ), i.e. encompassing three nucleotides (+4, +5, +6) of the consensus splice donor site" (Allais-Bonnet et al., 2021) 2021 33528505
OMIA 000081-9796 horse Arabian Atlanto occipital fusion HOXD3 deletion, gross (>20) yes 18 "a 2.7-kb deletion located 4.4 kb downstream of the end of HOXD4 and 8.2 kb upstream of the start of HOXD3." 2017 28111759
OMIA 002275-9615 dog French Bulldog Cocoa HPS3 HPS3^co nonsense (stop-gain) no CanFam3.1 23 g43969695G>A c.2420G>A p.(T807*) XM_542830.6:c.2420G>A; XP_542830.3:p.(Trp807*) 2020 32526956
OMIA 002116-69293 three-spined stickleback Coat colour, albinism, oculocutaneous, HPS5-related Hps5 casper insertion, small (<=20) yes "casper mutants have an insertion of a single nucleotide in the 6th exon of Hsp5, predicted to generate an early frameshift" 2017 28739598
OMIA 001348-9544 Rhesus monkey Atrichia with papular lesions HR nonsense (stop-gain) yes MMUL_1 8 g.22046679C>T c.1831C>T p.(R611*) 2002 11831740 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002229-9940 sheep Valle del Belice Hypotrichosis HR nonsense (stop-gain) yes Oar_rambouillet_v1.0 2 g.45703202C>T c.1312C>T p.(Q438*) Oar_v3.1 position is g.43224867C>T rs423413166 2003 12927087 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^TN duplication yes Felis_catus_9.0 B1 g.36040783dupGT c.1255_1256dupGT p.(Q420Sfs*100) 2020 32580512
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^Fr splicing yes Felis_catus_9.0 B1 g.36040933delTinsGT c.1404+2delTinsGT "This variant should extend and change the reading frame, including an additional 24 amino acids in the aberrant protein before a stop codon is recognized. Alternatively, a cryptic splice site may be used from within intron 4." (Buckley et al., 2020) 2020 32580512
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^TX splicing yes Felis_catus_9.0 B1 g.36045776G>A c.2112G>A "This variant likely disrupts the splice donor allowing read-through for an additional 12 amino acids until a stop codon is encountered and is designated hrTX allele. Alternatively, a cryptic splice site may be used from within intron 8." (Buckley et al., 2020) 2020 32580512
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^NC nonsense (stop-gain) yes Felis_catus_9.0 B1 g.36047047C>T c.2243C>T p.(R748*) 2020 32580512
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^Ca nonsense (stop-gain) yes Felis_catus_9.0 B1 g.36047518C>T c.2593C>T p.(Q865*) 2020 32580512
OMIA 002229-9685 domestic cat Lykoi Hypotrichia and Roaning HRhairless hr^VA insertion, small (<=20) yes Felis_catus_9.0 B1 g.36051556insGACA c.3389insGACA p.(S1130Rfs*29) 2020 32580512
OMIA 001601-9615 dog Dachshund Disorder of sexual development, 78,XY, SRY-positive HSD17B3 deletion, small (<=20) yes CanFam3.1 1 g.70554301_70554302delCA 2019 31476086
OMIA 001758-9615 dog Australian Shepherd Cataract, early onset HSF4 deletion, small (<=20) yes 5 g.85286582delC 2006 16939467
OMIA 001758-9615 dog Staffordshire Bull Terrier Cataract, early onset HSF4 insertion, small (<=20) yes 5 g.85286582_85286583insC 2006 16939467
OMIA 001319-9913 cattle Holstein-Friesian Myopathy of the diaphragmatic muscles HSPA1A deletion, gross (>20) yes 23 Deletion of one of two HSP70 (heat-shock protein) genes in the bovine major histocompatibility complex 2003 12755819
OMIA 001817-9913 cattle Japanese Black Perinatal weak calf syndrome IARS missense yes UMD3.1 8 g.85341291G>C c.235G>C p.(V79L) 2013 23700453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000664-9685 domestic cat Mucopolysaccharidosis I IDUA deletion, small (<=20) yes B1 a 3 bp deletion in the IDUA gene 1999 10356309
OMIA 000664-9615 dog Golden Retriever Mucopolysaccharidosis I IDUA deletion, gross (>20) yes CanFam3.1 3 g.91523238_91523524del c.1400-76_1521+89del p.(G467_E507del) "NC_006585.3(NM_001313883.1):c.1400-76_1521+89del; NC_006585.3:g.91523238_91523524del . . . NP_001300812.1:p.(Gly467_Glu507del)" (Faller et al., 2020) 2020 32785987
OMIA 000664-9615 dog Plott Hound Mucopolysaccharidosis I IDUA splicing yes CanFam3.1 3 g.91534420G>A c.155+1G>A 1992 1339393 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000664-9615 dog Boston Terrier Mucopolysaccharidosis I IDUA insertion, small (<=20) yes CanFam3.1 3 g.91534556_91534557insGGGGGCCG 2020 32300136
OMIA 002320-9615 dog Lapponian Herder Progressive retinal atrophy IFT122 missense yes CanFam3.1 20 g.5648046C>T c.3176G>A p.(R1059H) Protein and CDS positions based on XP_533734.2 and XM_533734.6 2021 33606121
OMIA 000006-9031 chicken Chinese Xingyi Achondroplasia, creeper IHH deletion, gross (>20) yes 7 g.21798705_21810600del "a 11,896bp large deletion region (chr7: 21,798,705-21,810,600) covering the entire Indian hedgehog (IHH) gene" 2016 27439785
OMIA 001899-9796 horse Quarter Horse Warmblood Incontinentia pigmenti IKBKG nonsense (stop-gain) yes EquCab2.0 X g.122833887C>T c.202C>T p.(R68*) 2013 24324710 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002271-9913 cattle Holstein Immunodeficiency, IL17Ra-related IL17RA deletion, small (<=20) yes ARS-UCD1.2 5 g.108813251del c.180del p.(C61Afs*62) XM_015460734.2: c.180delC; XP_015316220.2: p.(Cys61AlafsTer62) (Häfliger et al., 2020) 2020 32448141
OMIA 000899-9615 dog Basset Hound Severe combined immunodeficiency disease, X-linked IL2RG deletion, small (<=20) yes X a four nucleotide deletion causing a frame shift and subsequent premature termination of the gene coding for the gamma chain of the IL-2 receptor 1994 7829104
OMIA 000899-9615 dog Cardigan Welsh Corgi Severe combined immunodeficiency disease, X-linked IL2RG insertion, small (<=20) yes X a single nucleotide insertion causing a frameshift 1995 8571541
OMIA 002289-9615 dog Lhasa Apso Progressive retinal atrophy 4 (PRA4) IMPG2 insertion, gross (>20) yes CanFam3.1 33 " LINE-1 insertion was identified within the critical region in this PRA-affected LA, situated within 200 bp upstream of the interphotoreceptor matrix proteoglycan 2 (IMPG2) gene within the following coordinates: CANFA33: 7,785,475-7,785,491" (Hitti-Malin et al., 2020) 2020 32894063
OMIA 002173-9615 dog Norwich Terrier Diffuse cystic renal dysplasia and hepatic fibrosis INPP5E splicing yes CanFam3.1 9 g.49069064G>A c.1572+5G>A Dillard et al. (2018): "the identified variant introduces a novel splice site in INPP5E causing a frameshift and formation of a premature stop codon." 2018 30235266
OMIA 001675-61379 black-footed cat Cone-rod dystrophy 2 IQCB1 deletion, small (<=20) yes c.1282delCT p.(L428*) 2017 28322220
OMIA 001675-9615 dog American Pit Bull Terrier Cone-rod dystrophy 2 IQCB1 insertion, small (<=20) yes CanFam2.0 33 g.28120686_28120687insC c.952_53insC p.(S319Ifs*12) 2013 24045995
OMIA 001528-9940 sheep Romane Fleece variation, woolly IRF2BP2 insertion, gross (>20) no Oar_rambouillet_v1.0 25 insertion of an antisense EIF2S2 retrogene (called asEIF2S2) into the 3' UTR of the IRF2BP2 gene 2017 28379502
OMIA 001886-9615 dog Karelian bear dog Norwegian Elkhound Chondrodysplasia, disproportionate short-limbed ITGA10 nonsense (stop-gain) yes 17 c.2083C>T p.(R695*) 2013 24086591
OMIA 001000-9615 dog Great Pyrenees Thrombasthenia ITGA2B splicing yes 9 "a 14-base insertion in exon 13 and defective splicing of intron 13" 2000 11105947
OMIA 001000-9615 dog Scottish Deerhound Thrombasthenia ITGA2B missense yes 9 c.1100G>C p.(D367H) 2001 11703027
OMIA 001000-9796 horse Quarter Horse Thoroughbred Thrombasthenia ITGA2B missense yes 11 c.122G>C p.(R41P) 2006 16407493 c. coordinates obtained from Leite et al. (2019)
OMIA 001000-9796 horse Peruvian Paso Quarter Horse Thrombasthenia ITGA2B deletion, small (<=20) yes EquCab3.0 11 g.19247983_19247992delCAGGTGAGGA 2007 17338169 g. coordinates obtained from Dahlgren et al. (2020)
OMIA 001000-9685 domestic cat Domestic Shorthair Glanzmann's thrombasthenia ITGA2B deletion, small (<=20) yes Felis_catus_9.0 E1 g.44416063del c.1986delC p.(P662fs) ENSFCAT00000003056.6:c.1986delC; p.Pro662fs (Li et al., 2020) 2020 32935881
OMIA 002261-9913 cattle Holstein de novo mutation in an AI sire ITGA3 missense yes UMD3.1 19 g.37219021G>A p.(T252M) Bourneuf et al. (2017) detected ITGA3 g.37219021G>A; p.T252M as a de novo recessive potentially lethal mutation from an analysis of whole-genome-sequence of a Holstein AI bull. No information was provided on the descendants of this bull. 2017 28904385
OMIA 000595-9913 cattle Fleckvieh Holstein-Friesian Jersey Leukocyte adhesion deficiency, type I ITGB2 BLAD missense yes ARS-UCD1.2 1 g.144770078T>C c.383A>G p.(D128G) rs445709131 1992 1384046 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 000595-9615 dog Irish Setter Leukocyte adhesion deficiency, type I ITGB2 missense yes CanFam3.1 31 g.38537012G>C c.107G>C p.(C36S) 1999 10512685 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000595-9685 domestic cat Leukocyte adhesion deficiency, type I ITGB2 ITGB-2 missing exon 2 deletion, gross (>20) yes Felis_catus_8.0 C2 g.1715627_1715650delGCCCTCTGGT c.46_58 + 11del 2017 28750142
OMIA 001948-9913 cattle Charolais Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, gross (>20) yes 19 "a 4.4 kb deletion involving exons 17 to 22" of the ITGB4 gene 2015 25890340
OMIA 001948-9940 sheep Mouton Vendeen Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 nonsense (stop-gain) yes Oar_rambouillet_v1.0 11 g.7412626C>T c.2653C>T p.(R885*) c.2653C>T position is based on mRNA XM_015098951.1; Oar_v4.0 position is g.54799925 2020 33225458
OMIA 001948-9940 sheep Churra Epidermolysis bullosa, junctionalis, ITGB4 ITGB4 deletion, small (<=20) yes Oar_rambouillet_v1.0 11 g.7425460_7425463del c.4412_4415del Oar_v3.1: g.54849767_54849770del 2015 25955497 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002097-9615 dog Italian Spinone Ataxia, spinocerebellar ITPR1 complex rearrangement yes 20 Forman et al. (2015) identified an expanded GAA-repeat in intron 35 of the ITPR1 gene in affected dogs. The wildtype sequence contains 8 GAA repeats. The expanded disease-associated alleles carry an estimated 318-651 GAA repeats. 2015 25354648
OMIA 000809-9615 dog Polycythemia JAK2 complex rearrangement yes 1 c.[1849G>T;1852T>C;1853G>T] p.(V617_C618delinsFL) a three-base change in codons 617 and 618 of JAK2 giving rise to V617F and C618L 2011 21320566
OMIA 002240-9615 dog Norwegian Buhund Ataxia, cerebellar, KCNIP4-related KCNIP4 missense yes CanFam3.1 3 g.88890674T>C p.(T?R) NC_006585.3:g.88890674T>C (Jenkins et al., 2020) 2020 31999692
OMIA 002089-9615 dog Jack Russell Terrier Parson Russell Terrier Smooth-Haired Fox Terrier Ataxia, cerebellar, KCNJ10-related KCNJ10 missense yes 38 c.627C>G p.(I209M) 2014 24708069
OMIA 002089-9615 dog Malinois Spongy degeneration with cerebellar ataxia 1 (SDCA1) KCNJ10 missense yes 38 c.986T>C p.(L329P) 2017 27966545 28007838
OMIA 002089-9615 dog Jack Russell Terrier Ataxia, cerebellar, KCNJ10-related KCNJ10 insertion, small (<=20) yes 38 g.22141027insC 2016 27724896
OMIA 001722-9913 cattle Marchigiana Romagnola Lethal multi-organ developmental dysplasia KDM2B missense yes UMD3.1 17 g.56010031G>A c.2503G>A p.(D835N) 2012 23029151 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002390-9913 cattle Braunvieh Spinal muscular atrophy KDSR missense yes UMD3.1 24 g.62138763G>A c.562G>A p.(A188T) 2007 17420465 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000979-9031 chicken Talpid-3 KIAA0586 insertion, small (<=20) yes 5 insT 2006 16702409
OMIA 000527-9913 cattle Charolais Uckermärker Progressive ataxia KIF1C missense yes UMD3.1 19 g.27041449C>T c.608G>A p.(R203Q); p.(R203_T204delinsQ*) Duchesne et al. (2018): "Using a combination of next generation sequencing and whole genome SNP analysis, we determined that in the majority of cases with this phenotype, the disease is caused by a single substitution, c.608G>A, in the KIF1C gene. This substitution has two effects: firstly, it modifies a conserved amino acid (p.R203Q). Secondly, it causes an alternative splicing event, resulting in exon 5 skipping in most of the transcripts (p.RT203-204QStop) associated with a drastic reduction of overall mRNA expression and leading to the absence of detectable KIF1C protein in brain extracts from affected cattle." 2018 30067756
OMIA 002283-9823 pig Swiss Large White Arthrogryposis multiplex congenita, KIF21A-related KIF21A insertion, gross (>20) yes Sscrofa11.1 5 g.70964237_70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT p.(V41_F42ins*) (NC_010447.5:g70964237_ g70964238insAAGATAGAGGTTCTTTCCTCTAGACTTGAGGTTCTCCTGGTGTGACAGATGGTTCTTTCCTCT; p.Val41_Phe42insTer) (Fang et al., 2020) 2020 32686171
OMIA 002267-9685 domestic cat Bengal Progressive retinal atrophy KIF3B missense yes Felis_catus_9.0 A3 g.26784019C>T c.1000G>A p.(A334T) ENSFCAT00000022266; c.1000G>A (p.Ala334Thr) 2020 32386558 The genomic location on Felis_catus_9.0 is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001216-9823 pig Coat colour, roan KIT splicing no 8 a U(26) repeat in intron 5 of the KIT gene, which is likely to mediate skipping of exon 5 of the gene in some tissues including skin 2011 21749430
OMIA 001737-9615 dog Coat colour, white spotting, KIT-related KIT insertion, small (<=20) no 13 "a 1-bp insertion of an adenine 70 bases downstream of the beginning of exon 2." 2013 23134432
OMIA 001737-9685 domestic cat Coat colour, white spotting, KIT-related KIT insertion, gross (>20) no B1 "an insertion of an entire feline endogenous retrovirus (FERV1) into intron 1 of the KIT gene." 2014 25085922
OMIA 000209-9685 domestic cat Domestic Longhair Coat colour, dominant white KIT insertion, gross (>20) yes B1 "a FERV1 long terminal repeat (LTR) is associated with all Dominant White individuals" 2014 25085922
OMIA 001745-9823 pig Bavarian Landschwein Essex Hampshire Wessex Saddleback White belt KIT complex rearrangement no 8 Hampshire pigs (belted phenotype) have "a 4.3-kb duplication (DUP2) located ~¼100 kb upstream of KIT and a 23-kb duplication (DUP3) ~100 kb downstream of KIT, which in turn contained a fourth ~4.3-kb duplication (DUP4) not present on wild-type chromosomes". Across four breeds, belted pigs always had DUP2 and DUP4, but some lacked DUP3. 2012 23151514
OMIA 000426-9913 cattle Northern Finncattle Swedish Mountain Gonadal hypoplasia KIT cs(29) complex rearrangement yes 6 "gonadal hypoplasia in Northern Finncattle and Swedish Mountain cattle is associated with a complex chromosomal rearrangement including a ~500kb duplicated segment from BTA6 which is translocated to BTA29. This duplicated segment includes the entire coding sequence of the KIT gene" 2013 24086604
OMIA 001576-9913 cattle Belgian Blue British White Park Brown Swiss Galloway Coat colour, colour-sided KIT Cs(29) complex rearrangement no 6 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974
OMIA 000209-9823 pig Dominant white KIT I complex rearrangement no 8 This dominant white allele carries at least three causal polymorphisms, namely a 450 kb duplication (originally reported by Johansson Moller (1996); also present in Patch - see OMIA 001743-9825), the splice mutation reported by Marklund et al. (1998) (unique to Dominant white) and smaller duplication(s) (that occur within the 450kb duplication) causing Belt (see OMIA 001745-9825).(with thanks to Leif Andersson). To emphasise the original discovery of the duplication, the ref cited here is Johansson Moller (1996) 1996 8875890
OMIA 001576-9913 cattle Belgian Blue Brown Swiss Coat colour, colour-sided KIT Cs(6) complex rearrangement no 6 Durkin et al. (2012): "colour sidedness is determined by a first allele on chromosome 29 (Cs(29)), which results from the translocation of a 492-kilobase chromosome 6 segment encompassing KIT to chromosome 29, and a second allele on chromosome 6 (Cs(6)), derived from the first by repatriation of fused 575-kilobase chromosome 6 and 29 sequences to the KIT locus. We provide evidence that both translocation events involved circular intermediates. This is the first example, to our knowledge, of a phenotype determined by homologous yet non-syntenic alleles that result from a novel copy-number-variant-generating mechanism." 2012 22297974
OMIA 001743-9823 pig Coat colour, patch KIT duplication no 8 the patch allele comprises a 450kb duplication that includes KIT (roughly in the middle) 1998 9724328
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W27 missense unknown 3 c.1473T>G p.(C491W) 2018 29333746
OMIA 001737-9838 Arabian camel Coat colour, white spotting, KIT-related KIT deletion, small (<=20) no c.1842delG p.(M614Ifs*5) 2017 28282952
OMIA 000209-494514 Arctic fox Coat colour, dominant white KIT splicing no c.1867+1G>T 2013 24308634
OMIA 001737-9615 dog Coat colour, white spotting, KIT-related KIT deletion, small (<=20) no 13 c.1960_1962delCTC p.(L654del) 2013 23659249
OMIA 001737-9793 ass Coat colour, white spotting, due to KIT KIT Ws splicing no c.1978+2T>A 2015 25818843
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W26 deletion, small (<=20) unknown 3 c.2536delA p.(S846Vfs*15) 2018 29333746
OMIA 000209-30538 alpaca Classic grey coat colour KIT missense no c.376G>A p.(G126R) 2019 31297861
OMIA 000209-9793 ass Coat colour, dominant white KIT W missense no c.662A>C p.(Y221S) 2015 25818843
OMIA 001576-9913 OMIA 001737-9913 cattle British Gloucester Eringer Evolèner Pinzgauer Slovenian Cika Spanish Berrenda en negro Tux-Zillertaler Pinzgauer spotting KIT KIT^PINZ complex rearrangement no ARS-UCD1.2 6 Briefly: the KIT^PINZ variant is "characterized by the fusion of a duplicated chromosome 4 segment into a deleted part of chromosome 6." (Küttel et al., 2019) In more detail: "a complex structural variant characterized by a ~9.4-kb deletion . . . and in silico evidence for a duplication of ~1.5 kb about 34 kb farther downstream . . . . Apparently, the duplicated copy of the ~1.5-kb segment appears inversely inserted at the upstream breakpoint of the ~9.4-kb deletion . . . . Furthermore, we noticed at the upstream breakpoint of the inversely inserted segment chimeric read pairs in which both ends mapped to chromosome 6 and 4 . . . . The inspection of the sequence coverage of the involved genome region on chromosome 4 indicated a ~310-kb duplication from 84 864 544 to ~85 174 000 bp". (Küttel et al., 2019) 2019 31294880
OMIA 001737-9913 cattle Brown Swiss White spotting KIT deletion, gross (>20) no ARS-UCD1.2 6 g.70239551_70239590del c.1390_1429del p.(N464Afs*50) "NC_037333.1:g.70239551_70239590del; NM_001166484.1:c.1390_1429del; NP_001159956.1:p.(Asn464AlafsTer50)" (Häfliger et al., 2020) 2020 32065668
OMIA 001737-9925 goat Bezoar Wild type or Bezoar KIT wild type (i.e. normal) no ARS1 6 "The coverage plot of bezoars (BEZ) does not show any copy number variation and represents the wildtype allele." (Henkel et al., 2019) 2019 31841508
OMIA 001737-9925 goat Barbari White-spotted KIT KIT^BAR repeat variation no ARS1 6 g.70859258_70959918 (2 copies) The CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al., 2019) "70'911'301-70'927'581: deleted; 89'210'545-89'233'246: 3 copies of which 2 are inserted at 70'911'302" (Table S5; Henkel et al., 2019) 2019 31841508
OMIA 000209-9925 goat Pak angora White KIT KIT^ANG repeat variation no ARS1 6 g.70859258_70959918 (3 copies) This CNV "started ~63 kb downstream of KIT and covered ~100 kb of the genome reference sequence without known coding DNA. The short read-aligments of read-pairs spanning the amplification breakpoints confirmed that the individual copies of the CNV were arranged in tandem in a head to tail orientation" (Henkel et al.,2019) 2019 31841508
OMIA 001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) yes CanFam2.0 13 g.50110838_50110843delAGTGGA 2010 20950418
OMIA 001516-9615 dog Gastrointestinal stromal tumor KIT deletion, small (<=20) yes CanFam2.0 13 g.50110841_50110846delGGAAGG 2010 20950418
OMIA 000209-9796 horse Icelandic Coat colour, dominant white KIT W8 splicing no EquCab2.0 3 200922: g. and c. infom moved here (g.77736688; c.2222-1) until can be standardised 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse South German Draft Coat colour, dominant white KIT W11 splicing no EquCab2.0 3 g.77731743G>A c.2684+1G>A 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Oldenburg Coat colour, dominant white KIT W16 missense no EquCab2.0 3 g.77732055A>T c.2489A>T p.(K830I) 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Miniature Horse Quarter Horse Coat colour, dominant white KIT W13 splicing no EquCab2.0 3 g.77735380G>C c.2472+5G>C 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W14 deletion, gross (>20) no EquCab2.0 3 g.77735465_77735518del c.2392_2445del p.(H798_N815del) 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Icelandic White spotting KIT W21 deletion, small (<=20) no EquCab2.0 3 g.77735488delG c.2369delC p.(A790Efs*20) 2015 26059442 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Appaloosa Haflinger Lipizzan Noriker Quarter Horse Coat colour, dominant white KIT sabino 1 (SB1) splicing no EquCab2.0 3 g.77735520A>T "SNP AX-103727726 (ECA3:77735520; SB1, SNP KI16+1037A)" (Druml et al., 2018) 2005 16284805 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Italian Trotter Coat colour, dominant white KIT W24 splicing no EquCab2.0 3 g.77736559C>T 2017 28856698
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W5 deletion, small (<=20) no EquCab2.0 3 g.77737214delG c.2193delG p.(T732Qfs*9) 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Franches-Montagnes Coat colour, dominant white KIT W1 nonsense (stop-gain) no EquCab2.0 3 g.77737256C>G c.2151C>G p.(Y717*) 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse American Paint Horse Appaloosa German Riding Pony Gipsy Noriker Old-Tori Oldenberg Quarter Horse Thoroughbred Warmblood Welsh Pony Coat colour, dominant white KIT W20 missense unknown EquCab2.0 3 g.77739534G>A c.2045G>A p.(R682H) 2013 23659293 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Japanese Draft Coat colour, dominant white KIT W17b missense no EquCab2.0 3 g.77739558T>C c.2021T>C p.(L674P) 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Japanese Draft Coat colour, dominant white KIT w17a missense no EquCab2.0 3 g.77739579A>T c.2001A>T p.(E667D) 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Thoroughbred White spotting KIT W22 deletion, gross (>20) no EquCab2.0 3 g.77740239_77742136del1898 2017 28444912
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W2 missense no EquCab2.0 3 g.77740854G>A c.1960G>A p.(G654R) 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Camarillo White Horse Coat colour, dominant white KIT W4 missense no EquCab2.0 3 g.77741094C>T c.1805C>T p.(A602V) 2007 17997609 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Holstein Coat colour, dominant white KIT W9 missense no EquCab2.0 3 g.77741111G>A c.1789G>A p.(G597R) 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Arabian Coat colour, dominant white KIT W15 missense no EquCab2.0 3 g.77741665T>C c.1597T>C p.(C533R) 2011 21554354 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Swiss Warmblood Coat colour, dominant white KIT W18 splicing no EquCab2.0 3 g.77745065G>A c.1346 + 1G>A 2013 23659293 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Arabian Coat colour, dominant white KIT W19 missense no EquCab2.0 3 g.77745090A>G c.1322A>G p.(Y441C) 2013 23659293 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Quarter Horse Coat colour, dominant white KIT W10 deletion, small (<=20) no EquCab2.0 3 g.77758240_77758243del c.1126_1129delGAAC p.(E376Ffs*3) 2009 19456317 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W6 missense no EquCab2.0 3 g.77765059G>A c.856G>A p.(G286R) 2009 19456317 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Arabian White spotting KIT W23 splicing unknown EquCab2.0 3 g.77769789C>G c.756+1G>C ss2137493881 rs1095048836 2017 28378922
OMIA 000209-9796 horse Arabian Coat colour, dominant white KIT W3 nonsense (stop-gain) no EquCab2.0 3 g.77769840A>T c.706A>T p.(K236*) 2007 17997609 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W25 missense unknown EquCab2.0 3 g.77769878A>G c.668T>C p.(L223P) rs3103992630 2018 29333746
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W12 deletion, small (<=20) unknown EquCab2.0 3 g.77771079_77771083delTCTGC c.559_563delTCTGC p.(S187Rfs*10) 2010 Reference not in PubMed; see OMIA 000209-9796 for reference details Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse Thoroughbred Coat colour, dominant white KIT W7 splicing no EquCab2.0 3 g.77771305G>C c.338-1G>C 2009 19456317 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000209-9796 horse American Paint Horse Quarter Horse White spotting KIT W32 missense unknown EquCab3.0 3 g.79538738C>T c.3214G>A p.(A1072T) cDNA position based on transcript ENSECAT00000014037.3 rs1141982296 2021 34223905
OMIA 000209-9796 horse Berber Extensive coat white patterning KIT W30 missense no EquCab3.0 3 g.79548244T>A c.2020T>A p.(L674H) g.79548244, c.2020T>A; p.L674H (Martin et al., 2020) 2020 33111383
OMIA 000209-9796 horse German Riding Pony White spotting KIT W28 deletion, gross (>20) no EquCab3.0 3 g.79579925_79581197del 2019 31463981
OMIA 000209-9796 horse Quarter Horse White spotting KIT W31 insertion, small (<=20) unknown EquCab3.0 3 g.79618532_79618533insA c.30_31insT p.(L11Sfs*115) 2021 34223905
OMIA 001580-9685 domestic cat Birman Gloving KIT g delins, small (<=20) no FelCat5 B1 c.1035_1036delinsCA p.(E345_H346delinsDN) Montague et al. (2014) describe this variant as "two adjacent missense mutations". 2010 21147473
OMIA 002287-9823 pig Bama miniature Hypopigmentation (piebald) and deafness KIT missense yes Sscrofa11.1 8 g.41485957T>A c.2418T>A p.(D806E) ENU mutagenesis was used to create these pigs, NM_001044525.1; c.2418T>A; NP_001037990.1; p.(D806E) (Xu et al., 2020) 2020 33042408
OMIA 001745-9823 pig Cinta Senese White belt KIT not known no Sscrofa11.1 8 g.41488472C>T Sscrofa10.2 g.43,597,545C>T; Ensembl VEP analysis suggests that this can be a synonymous or 3_prime_UTR_variant depending on the transcript analysed rs328592739 rs328592739 2016 Reference not in PubMed; see OMIA 001745-9823 for reference details Ogorevc et al. (2017) reported the EVA ID of this variant as rs328592739
OMIA 001787-9615 dog Standard Poodle Squamous cell carcinoma of the digit KITLG repeat variation yes 15 a copy number variant (CNV) of KITLG 2013 23555311
OMIA 002228-9615 dog Nova Scotia Duck Tolling retriever Poodle Pigment intensity KITLG repeat variation no CanFam3.1 15 Weich et al. (2020): "the reference genome shows two tandem copies of the CNV spanning a region of approximately 12 kb. The CNV is located in an intergenic region about 152 kb upstream from the closest gene, KITLG." 200922: g. info moved here (g.29821450_29832950) until it can be standardised 2020 31936656
OMIA 001216-9913 cattle Belgian Blue Shorthorn Roan KITLG missense no UMD3.1 5 g.18339001C>A c.572C>A p.(A191N) 1999 10384045 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 002237-8090 Japanese medaka Few melanophore kitlga insertion, gross (>20) no Otsuki et al. (2020): "the phenotype of fm medaka is attributable to insertion of a Tcb1-like transposon at the kitlga locus" 2020 31757930
OMIA 000819-9615 dog Shih-Tzu Prekallikrein deficiency KLKB1 missense yes CanFam3.1 16 g.44501415T>A c.988T>A p.(F330I) 2011 20736516 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001415-9615 dog Norfolk Terrier Hyperkeratosis, epidermolytic KRT10 splicing yes 9 "a single base GT>TT change in the consensus donor splice site of intron 5" 2005 16029326
OMIA 002281-9685 domestic cat Domestic Shorthair Epidermolysis bullosa, simplex, KRT14-related KRT14 nonsense (stop-gain) yes E1 c.979C>T p.(Q327*) XM_003996860.5:c.979C>T or XP_003996909.2:p.(Gln327*) (Dettwiler et al., 2020) 2020 32657488
OMIA 002088-9615 dog Dogue de Bordeaux Palmoplantar keratoderma, nonepidermolytic, focal 1 KRT16 complex rearrangement yes 9 p.(E392*) 2015 25521457
OMIA 000245-9796 horse Bashkir Curly Horse Curly Curly coat KRT25 Crd missense no EquCab3.0 11 g.21962991G>A c.266G>A p.(R89H) rs1095048844 2018 29686323 29141579 Variant coordinates obtained from and/or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000246-9913 cattle Ayrshire Fleckvieh German Angus Montbeliarde Curly hair, karakul-type KRT27 missense no UMD3.1 19 g.41636961C>G c.276C>G p.(N92K) rs384881761 2014 25017103 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 002081-9913 cattle Belgian Blue‐Holstein cross Epidermolysis bullosa, simplex, KRT5-related` KRT5 deletion, small (<=20) yes ARS-UCD1.2 5 g.27367604_27367606del c.534_536del p.(N178del) "27367604delCAA (NM_001008663.1:c.534_536delCAA), leading to a loss of an asparagine amino acid at residue 178 of the encoded KRT5 protein (NP_001008663.1:p.Asn178del)" (Jacinto et al., 2020). 2020 33135329 In an email dated 5 November 2020, Cord Drögemüller confirmed that the genomic specification for this variant is g.27367604_27367606delCAA
OMIA 002081-9913 cattle Friesian-Jersey mosaic Epidermolysis bullosa KRT5 missense yes UMD3.1 5 g.27545478G>A c.1432G>A p.(E478K) 2005 15955091 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001581-9685 domestic cat Curly coat, Devon rex KRT71 complex rearrangement no B4 c.1108-4_1184del;c.1184_1185in This complex variant causes a slicing variation 2010 20953787
OMIA 000245-9615 dog Bichon Frise Chesapeake Bay Retriever Curly-coated retriever Irish Terrier Lagotto Romagnolo Spanish water dog Curly coat KRT71 c^2 delins, small (<=20) no 27 c.1266_1273delinsACA p.(S422Rfs) Bauer et al. (2019) and Salmela et al. (2019): NM_001197029.1:c.1266_1273delinsACA; NP_001183958.1:p.Ser422ArgfsTer? 2019 30444027 30456859
OMIA 001712-9685 domestic cat Curly coat, Selkirk rex KRT71 splicing no B4 c.445-1G>C 2013 23770706
OMIA 000245-9615 dog Portugese water dog Curly coat KRT71 c^1 missense no 27 c.451C>T p.(R151W) 2009 19713490
OMIA 002114-9913 cattle Hereford Hypotrichosis, KRT71-related KRT71 deletion, small (<=20) yes ARS-UCD1.2 5 g.27331221_27331228del c.281_288del p.(M94Nfs*14) cDNA and protein positions based on NM_001075970.1 and NP_001069438.1, respectively 2021 34356054 210909: FN checked the ARS-UCD1.2 assembly, and discovered that the deletion spans 27331221 to 27331228. Thus g.27331221delTGTGCCCA was changed to g.27331221_27331228del. From NCBI's genome browser, worked out that the c. notation needs to be changed from c.281delTGTGCCCA to c.281_288del.
OMIA 001583-9685 domestic cat Sphynx hairless KRT71 splicing yes Felis_catus_6.2 B4 g.81502136G>A c.816+1G>A 2010 20953787 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000394-9031 chicken Frizzle KRT75 deletion, gross (>20) no 34 a 69 bp in-frame deletion in a conserved region of KRT75 2012 22829773
OMIA 001371-9615 dog Yorkshire Terrier L-2-hydroxyglutaricacidemia L2HGDH regulatory yes 8 c.1A>G p.(Met1?) 2012 22843824
OMIA 001371-9615 dog Staffordshire Bull Terrier L-2-hydroxyglutaricacidemia L2HGDH complex rearrangement yes 8 c.[1297T>C; 1299C>T] p.(L433_H434delinsPY)] "two single-nucleotide substitutions separated by a single invariant T nucleotide in exon 10 (c[1297T>C; 1299c>t]; p[Leu433Pro; His434Tyr])" 2007 17475916
OMIA 001371-9685 domestic cat Domestic Longhair L-2-hydroxyglutaric aciduria L2HGDH missense yes Felis_catus_9.0 B3 g.100207200T>C c.1301A>G p.(H434R) Coding and protein locations are based on XM_023255678.1 and XP_023111446.1, respectively 2021 34062805
OMIA 001677-9796 horse American Saddlebred Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 deletion, gross (>20) yes 8 "6589-bp deletion spanning exons 24-27 . . . in the LAMA3 gene in American Saddlebred foals" 2009 19016681
OMIA 001677-9615 dog German Pointer Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 insertion, gross (>20) yes 7 "insertion (4818+207ins6.5 kb) of repetitive satellite DNA within intron 35 of the gene (LAMA3)" 2005 15737193
OMIA 001677-9615 dog Australian Cattle Dog X Epidermolysis bullosa, junctionalis, LAMA3 LAMA3 missense yes CanFam3.1 7 g.64427161T>A c.8615T>A p.(D2867V) cDNA and protein positions based on XM_537297.6 and XP_537297.2, respectively 2021 34250689
OMIA 001677-9913 cattle Belgian Blue Epidermolysis bullosa, junctionalis, LAMA3-related LAMA3 nonsense (stop-gain) unknown UMD3.1 24 g.33111473C>T c.7549C>T p.(R2517*) 2015 26370913 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002269-9615 dog Australian Shepherd Epidermolysis bullosa, junctionalis, LAMB3-related LAMB3 JEB missense yes CanFam3.1 7 g.8286613A>G c.1174T>C p.(C392R) NC_006589.3:g.8286613A>G; XM_014115071.2:c.1174T>C; XP_013970546.1:p.Cys392Arg 2020 32906717
OMIA 001678-9913 cattle Hereford Epidermolysis bullosa, junctionalis, LAMC2 LAMC2 deletion, gross (>20) yes 16 "2.4 kb deletion encompassing the first exon of the LAMC2 gene" 2015 25888738
OMIA 001678-9796 horse Belgian Italian draft horse Trait Breton Trait Comtois Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 insertion, small (<=20) yes 5 c.1368insC 2002 12230513
OMIA 001678-9940 sheep German Blackheaded Mutton Epidermolysis bullosa, junctionalis, LAMC2-related LAMC2 deletion, small (<=20) yes Oar_rambouillet_v1.0 12 g.68856318_68856319del c.2746_2747del p.(A928*) FM872310 c.2746delCA 2011 21573221 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002251-9615 dog Airedale Terrier Surfactant metabolism dysfunction, pulmonary LAMP3 missense yes CanFam3.1 34 g.16092728C>T c.1159G>A p.(E387K) 2020 32150563
OMIA 001160-9986 rabbit Hyperlipidaemia LDLR deletion, small (<=20) yes "an in-frame deletion of 12 nucleotides that eliminates four amino acids from the cysteine-rich ligand binding domain of the LDL receptor" 1986 3010466
OMIA 000499-9823 pig FH-r strain Hypercholesterolaemia LDLR missense yes Sscrofa11.1 2 g.69841413C>T c.250C>T p.(R84C) rs701604154 rs701604154 1998 9556295 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcripts: XM_021080444.1, XM_021080449.1, XM_021080452.1, XM_021080457.1 by Stephanie Shields (27/05/2020)
OMIA 002031-9615 dog Lundehund Lundehund syndrome LEPREL1 missense yes 34 g.139212C>G 2016 27485430
OMIA 001596-9615 dog Lagotto Romagnolo Epilepsy, benign familial juvenile LGI2 nonsense (stop-gain) yes 3 c.1552A>T p.(K518*) 2011 21829378
OMIA 002314-9615 dog Czechoslovakian wolfdog German Shepherd Dog Saarloo Tibetan Terrier Pituitary dwarfism LHX3 splicing yes 9 "a deletion of one of six 7 bp repeats in intron 5 of LHX3" 2011 22132174
OMIA 002314-9615 dog German Shepherd Dog Pituitary dwarfism LHX3 insertion, small (<=20) yes 9 c.545_547dupACA p.(N182dup) NM_001197187; c.545_547dupACA; p.N182dup 2011 22132174
OMIA 001566-9986 rabbit Rex coat LIPH deletion, small (<=20) no 14 c.1362delA 2011 21552526
OMIA 002273-9685 domestic cat Ural Rex Curly coat, Ural Rex LIPH deletion, small (<=20) no Felis_catus_9.0 C2 g.84136342_84136347del c.478_483del p.(S160_G161del) 2020 32463158
OMIA 002389-9685 domestic cat Maine Coon Spinal muscular atrophy LIX1 deletion, gross (>20) yes A1 a ~140 kb deletion removing exons 4-6 of LIX1 and all except exon 1 of LNPEP 2006 16899656
OMIA 001612-9031 chicken Silky/Silkie Oligozeugodactyly LMBR1 deletion, gross (>20) yes 2 "a large deletion in LMBR1-intron 5, eliminating most of the limb-specific enhancer conserved sequence." 2011 21509895
OMIA 000810-9685 domestic cat Polydactyly LMBR1 regulatory yes A2 c.257G>C CC(G-C)GTG 2008 18156157
OMIA 000810-9685 domestic cat Polydactyly LMBR1 regulatory yes A2 c.479A>G AGACAC(A-G)GAAATGAG 2008 18156157
OMIA 000810-9685 domestic cat Polydactyly LMBR1 regulatory yes A2 c.481A>T AGACACAG(A-T)AATGAG 2008 18156157
OMIA 000810-9031 chicken Polydactyly LMBR1 regulatory yes GalGal5 2 g.8500245G>T rs80659072 2010 20064842
OMIA 001715-9796 horse Numerous breeds Gaitedness LOC100147177 nonsense (stop-gain) no 23 g.22999655C>A p.(S301*) 2012 22932389
OMIA 001040-9615 dog Rhodesian Ridgeback Ventricular arrhythmias and sudden death LOC100683626 missense yes CanFam3.1 17 g.54343438G>A ENSCAFG00000018796: g.54343438 G>A. 2019 30795627
OMIA 002221-9685 domestic cat Domestic Shorthair Vitamin D-deficiency rickets, type Ib LOC101093889 deletion, small (<=20) yes D1 c.1386del p.(F462Lfs*20) 2019 30777056
OMIA 001701-13146 budgerigar Feater colour, blue LOC101880715 missense no 1 p.(R644W) 2017 28985565
OMIA 001694-9940 sheep Polypay Resistance to lentivirus LOC105603932 regulatory no Oar_rambouillet_v1.0 20 g.32931861_32931862del Published as ZNF389 deletion(NC_019477.1:g.29500068_29500069delAT ovine chromosome 20, NCBI dbSNP ss748775100). rs397514112 2013 24303974 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000344-9031 chicken Fayoumi eplipeptic strain Epilepsy LOC430486 splicing yes 25 c581-4CC>TG 2011 22046416
OMIA 001505-9940 sheep Swedish Landrace Neuronal ceroid lipofuscinosis, 10 LOC443060 missense yes Oar_rambouillet_v1.0 21 g.51583020G>A c.883G>A p.(D295N) published as c.934G>A; protein and cDNA positions in this table based on XP_027815055.1 and XM_027959254.1, respectively 2000 10856224 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002071-9615 dog Labrador Retriever Macular corneal dystrophy LOC489707 missense yes CanFam3.1 5 g.75279699C>A c.814C>A p.(R272S) 2016 26585178 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001451-9913 cattle Belgian Blue Congenital muscular dystonia 2 LOC528050 missense yes UMD3.1 29 g.24610495T>C c.809T>C p.(L270P) 2008 18344998 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001928-9615 dog Labrador Retriever Myasthenic syndrome, congenital LOC608697 missense yes 23 c.1010T>C p.(I337T) 2014 25166616
OMIA 001928-9615 dog Golden Retriever Myasthenic syndrome, congenital, COLQ-related LOC608697 missense yes CanFam3.1 23 g.27175559G>A c.880G>A p.(G294R) 2020 31769119
OMIA 002336-9615 dog Rottweiler Nonsyndromic hearing loss LOXHD1 missense yes CanFam3.1 7 g.44,806,821G>C c.5747G>C p.(G1914A) XM_022421426.1, c.5747G>C; J9PAE4, p.(G1914A) (Hytönen et al., 2021) 2021 33983508
OMIA 001684-9685 domestic cat Cornish Rex German Rex Curly/woolly coat, Cornish Rex and German Rex LPAR6 deletion, small (<=20) no Felis_catus_9.0 A1 g.22919307_22919310del c.250_253del p.(F84Efs*9) NM_001309049.1:c.250_253delTTTG 2013 23826204 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001210-9685 domestic cat Hyperlipoproteinaemia LPL missense yes B1 c.1234G>A p.(G412R) 1996 8636438
OMIA 001486-9615 dog Beagle Night blindness, congenital stationary, LRIT3-related LRIT3 deletion, small (<=20) yes CanFam3.1 32 g.30038863delG c.763delG p.(K245Nfs*5) 2019 31578364
OMIA 000963-9913 cattle Angus Syndactyly (mule foot) LRP4 splicing yes ARS-UCD1.2 15 g.76792588C>T c.5385+1G>A "a G to A transition at the first nucleotide in the splice donor site of intron 37" 2006 16963222 Variant information was initially kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
OMIA 000963-9913 cattle Holstein Syndactyly (mule foot) LRP4 delins, small (<=20) yes ARS-UCD1.2 15 g.76800972_76800973delinsAT c.4863_4864delinsAT p.(N1621_G1622delinsKC) 2006 16859890 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
OMIA 000963-9913 cattle German Simmental Syndactyly (mule foot) LRP4 missense yes ARS-UCD1.2 15 g.76807508C>T c.3595G>A p.(G1199S) 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
OMIA 000963-9913 cattle Simmental Charolais Cross Syndactyly (mule foot) LRP4 missense yes ARS-UCD1.2 15 g.76812187C>T c.2719G>A p.(G907R) 2007 17319939 Variant information updated to ARS-UCD1.2 and variant effect predicted using Ensembl Variant Effect Predictor (VEP) based on transcript ENSBTAT00000043997.4
OMIA 002017-9685 domestic cat Glaucoma 3, primary congenita LTBP2 insertion, small (<=20) yes B3 "a 4-bp insertion in exon 8 located at chrB3: 120995236" 200922: g. info moved here (g.120995236) until it can be standardised 2016 27149523
OMIA 001429-9685 domestic cat Blotched tabby LVRN missense no A1 p.(D228N) 2012 22997338
OMIA 001721-32536 cheetah Coat colour, king LVRN insertion, small (<=20) no p.(N977Kfs*110) 2012 22997338
OMIA 001429-9685 domestic cat Blotched tabby LVRN nonsense (stop-gain) no A1 p.(S59*) 2012 22997338
OMIA 001429-9685 domestic cat Blotched tabby LVRN nonsense (stop-gain) no A1 p.(W841*) 2012 22997338
OMIA 000185-452646 American mink Chediak-Higashi syndrome LYST deletion, small (<=20) yes c.9468delC 2013 22762706
OMIA 000185-9685 domestic cat Persian Chediak-Higashi disease LYST repeat variation yes Felis_catus_9.0 D2 g.13289500_13308861dup c.8347-2422_9548+1749dup Buckley et al. (2020): "a tandem segmental duplication encompassing exons 30 through to 38 (NM_001290242.1:c.8347-2422_9548 + 1749dup) (NC_018733.3:g.13289500_13308861dup)" 2020 31919397
OMIA 000185-9913 cattle Japanese Black Chediak-Higashi syndrome LYST missense yes UMD3.1 28 g.8508619A>G c.6044A>G p.(H2015R) 1999 10594238 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 000625-9685 domestic cat Mannosidosis, alpha MAN2B1 deletion, small (<=20) yes A2 c.1749_1752delCCAG p.(Q584Afs*179) 1997 9396732
OMIA 000625-10141 domestic guinea pig Mannosidosis, alpha Man2b1 missense yes c.679C>T p.(R227W) 2002 11959458
OMIA 000625-9913 cattle Galloway Mannosidosis, alpha MAN2B1 missense yes UMD3.1 7 g.13956640G>A c.662G>A p.(R221H) 1997 9208932 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000625-9913 cattle Angus Murray Grey Mannosidosis, alpha MAN2B1 missense yes UMD3.1 7 g.13957949T>C c.961T>C p.(F321L) 1997 9208932 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 000626-9925 goat Mannosidosis, beta MANBA deletion, small (<=20) yes ARS1 6 g.22409150del c.1398del 1996 8921369 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000626-9615 dog Mixed breed Beta mannosidosis MANBA duplication yes CanFam3.1 32 c.2377_2381dupTATCA 2019 31439511
OMIA 000626-9615 dog German Shepherd Dog Beta mannosidosis MANBA missense yes CanFam3.1 32 g.24147500T>A c.560T>A p.(I187N) 2019 30983534
OMIA 000626-9913 cattle Salers Mannosidosis, beta MANBA nonsense (stop-gain) yes UMD3.1 6 g.23540228G>A c.2574G>A p.(W858*) 1999 10594236 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001432-9615 dog Miniature Long-haired Dachsund Cone-rod dystrophy 4 MAP9 deletion, gross (>20) yes 15 An approximately 22kb deletion "approximately 30 Mb upstream of RPGRIP1 . . . The deletion breakpoints were identified in MAP9 intron 10 and in a downstream partial MAP9 pseudogene." 2016 27017229
OMIA 002021-9796 horse Quarter Horse Coat colour, brindle 1 MBTPS2 splicing no X c.1437+4T>C 2016 27449517
OMIA 001199-30640 gray squirrel Melanism (black) MC1R E^B deletion, gross (>20) no MC1RΔ24 allele E^B ["at amino acid positions 87-94"] 2009 19643815
OMIA 001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*4) deletion, gross (>20) no Vidal (2018): "a deletion of 2760 bp, including the entire MC1R coding region" 2018 30101449
OMIA 001199-9627 red fox Coat colour, extension MC1R missense no p.(C125R) 1997 9054949
OMIA 001199-46844 Geoffroy's cat Melanism (black coat) MC1R missense no p.(C125R) 2015 25695801
OMIA 002156-46218 Chinese painted quail Feather colour, Blue Face MC1R missense no p.(E92K) 2018 29974967
OMIA 000374-495946 Eleonora's falcon Feather colour, extended black MC1R deletion, small (<=20) no p.(M114_V117del) 2011 21696477
OMIA 000374-57662 red-footed booby White plumage MC1R haplotype no p.(M85V) + p.(R207H) 2007 17602182
OMIA 002155-46218 Chinese painted quail Feather colour, Red Breasted MC1R missense no p.(P292L) 2018 29974967
OMIA 001199-37349 woolly mammoth Light hair colour MC1R missense no p.(R67C) 2006 16825562
OMIA 000374-70340 Lesser snow goose Blue plumage MC1R missense no p.(V85M) 2004 15031505
OMIA 001199-494514 Arctic fox Blue coat colour MC1R Ed missense no p.[(G5C);(F280C)] The blue (Ed) allele is a haplotype comprising two missense variants (p.Gly5Cys and p.Phe280Cys) (Våge et al., 2005) 2005 15982782
OMIA 000374-9031 chicken Feather colour, extended black MC1R regulatory no 11 c.-37C>T 5 prime UTR variant rs733919322 2017 28699279
OMIA 001199-9986 rabbit Dominant black or Steel MC1R E(D) or E(S) deletion, small (<=20) no c.124G>A;125_130del6 2006 16978179
OMIA 001199-30532 fallow deer white coat colour MC1R missense no c.143T>C p.(L48P) NM_174108.2:c.143T>C; NP_776533.1:p.(L48P) 2020 33213385
OMIA 000374-9031 chicken Feather colour, extended black MC1R E missense no 11 c.212T>C p.(M71T) rs312264213 2017 28699279
OMIA 001199-9870 reindeer Coat colour, extension MC1R missense no c.218T>C p.(M73T) 2014 25039753
OMIA 001495-9615 dog Afghan Hound Saluki Grizzle MC1R E^G missense no 5 c.233G>T p.(G78V) 2010 20525767
OMIA 000374-9031 chicken Feather colour, extended black MC1R E missense no 11 c.274G>A p.(E92K) rs314881228 2003 12873211
OMIA 001199-9986 rabbit Red/fawn/yellow MC1R e deletion, gross (>20) no c.304_333del30 2006 16978179
OMIA 001494-9103 turkey Feather colour, dominant black MC1R missense no c.364A>T p.(I122F) 2010 20634512
OMIA 001199-9627 red fox Coat colour, extension MC1R missense no c.373C>T p.(C125R) 2016 27072328
OMIA 000374-120794 gyrfalcon Feather colour, extended black MC1R missense no c.376A>G p.(I126V) 2012 22497627
OMIA 001199-9685 domestic cat Burmese Coat colour, russet MC1R e^r deletion, small (<=20) no E2 c.439_441del p.(F146del) 2017 27671997
OMIA 001199-9793 ass Miniature Donkey Normand Red coat colour MC1R e missense no c.629T>C p.(M210T) 2014 25155046
OMIA 000374-9031 chicken Feather colour, buttercup MC1R missense no 11 c.644A>C p.(H215P) rs735789743 2003 12873211
OMIA 000374-9031 chicken Mie-Jidori Feather colour, wheaten-like MC1R e^m missense no 11 c.644A>C p.(H215P) rs735789743 2020 31977074
OMIA 001199-10141 domestic guinea pig Brown coat colour MC1R e (MC1R*2) missense no c.749T>C p.(L250Q) 2018 30101449
OMIA 001199-9870 reindeer Coat colour, extension MC1R missense no c.839T>G p.(F280C) 2014 25039753
OMIA 001199-37190 antarctic fur seal Hypopigmentation (blond) MC1R missense unknown c.872C>T p.(S291F) 2016 27547348
OMIA 001494-9103 turkey Feather colour, black-wing bronze MC1R missense no c.887C>T p.(A296V) 2010 20634512
OMIA 001199-9838 Arabian camel White coat colour MC1R missense no c.901C>T p.(R301C) KU179867; c.901C>T; p.R301C 2018 29893870
OMIA 001494-9103 turkey Bronze feathers MC1R nonsense (stop-gain) no c.96G>A 2010 20634512
OMIA 001435-93934 Japanese quail Feather colour, extended brown MC1R missense no c.?G>A p.(E92K) 2006 16734695
OMIA 001199-9986 rabbit Japanese brindling MC1R eJ complex rearrangement no c.[124G>A;125_130del6] "6 bp-in frame deletion flanked by a G > A transition in 5' (c.[124G>A;125_130del6]) that was present in all animals with Japanese brindling coat colour and pattern." (Fontanesi et al., 2010) 2010 20594318
OMIA 001199-9925 goat Murciana Granadina black coat colour MC1R missense no ARS1 18 g.16105786C>G c.801C>G p.(C267W) cDNA position based on transcript ENSCHIT00000014455.1 34196982 2009 19706191
OMIA 001199-9615 dog Alaskan Husky Siberian Husky White coat colour MC1R e^3 deletion, small (<=20) no CanFam3.1 5 c.816_817delCT 2018 29932470
OMIA 001199-9615 dog Irish Setter Labrador Retriever Red/yellow coat MC1R e^1 nonsense (stop-gain) no CanFam3.1 5 g.63694334G>A c.916C>T p.(R306*) rs851563576 2000 10602988 Genomic location provided by Professor Claire Wade
OMIA 001590-9615 dog Leonberger Malinois Black melanistic mask MC1R E^M missense no CanFam3.1 5 g.63694460C>T c.790A>G p.(M264V) rs24201590 rs24201590 2003 12692165 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. Correction to genomic details provided by Professor Claire Wade.
OMIA 001199-9615 dog Australian Cattle Dog Crean coat colour MC1R e^2 regulatory no CanFam3.1 5 g.63695679C>G 2018 29932470
OMIA 001199-9796 horse Coat colour, chesnut MC1R missense no EquCab2.0 3 g.36259552C>T c.248C>T p.(S83F) rs68458866 1996 8995760 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001199-9796 horse Coat colour, chesnut MC1R missense no EquCab2.0 3 g.36259554G>A c.250G>A p.(D84N) 2000 11086549 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001199-9685 domestic cat Norwegian Forest Coat colour, amber MC1R e missense no Felis_catus_6.2 E2 g.63721093G>A c.250G>A p.(D84N) 2009 19422360 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001199-9685 domestic cat Kurilian Bobtail Coat colour, copal MC1R e^c deletion, small (<=20) no Felis_catus_8.0 E2 c.640_669del p.(A214_A223del) Genbank accession no. MK890105 2019 31361350
OMIA 002108-9031 chicken Fayoumi barring, autosomal MC1R E*R(Fay), Pg missense no GalGal5.0 11 g.19084979T>A c.398T>A p.(L133Q) rs737523889 2021 33793042
OMIA 001199-9940 sheep Valle del Belice Recessive pheomelanism MC1R e missense no Oar_rambouillet_v1.0 14 g.15487353C>T c.199C>T p.(R67C) 2010 Reference not in PubMed; see OMIA 001199-9940 for reference details The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Corriedale Dala Damara Merino Dominant black MC1R E^D missense no Oar_rambouillet_v1.0 14 g.15487372T>A c.218T>A p.(M73K) 1999 9892731 c.218T>A obtained from Fontanesi et al. (2010); breeds obtained from Rochus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Massese Dominant black MC1R E^D missense no Oar_rambouillet_v1.0 14 g.15487515G>A c.361G>A p.(D121N) 1999 9892731 c.361G>A obtained from Fontanesi et al. (2010); breed obtained from Ruchus et al. (2019); the genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9940 sheep Gotland Gute Värmland Dominant black MC1R missense no Oar_rambouillet_v1.0 14 g.15487606G>A c.452G>A p.(R151Q) 2019 31475378 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001199-9823 pig Duroc Red MC1R e missense no Sscrofa11.1 6 g.181461C>T c.727G>A p.(A243T) Variant is called p.(A240T) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2 rs321432333 1998 9799269
OMIA 001199-9823 pig Duroc Red MC1R e missense no Sscrofa11.1 6 g.181697G>A c.491C>T p.(A164V) Variant is called p.(A161V) in original paper (Kijas et al., 1998). Two substitutions were found in recessive red (e/e) animals p.(A161V) and p.(A240T) - the p.(A240T) was considered as causative (Kijas et al., 1998). cDNA and protein location based in this table are based on transcript ENSSSCT00000022534.2 rs45435032 1998 9799269
OMIA 001199-9823 pig Hampshire Dominant black MC1R E^D2 missense no Sscrofa11.1 6 g.181818C>T c.370G>A p.(D124N) Variant is called p.(D121N) in original paper (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs326921593 rs326921593 2016 27703696 9799269
OMIA 001199-9823 pig Large Black Meishan Dominant black MC1R E^D1 missense no Sscrofa11.1 6 g.181883A>G c.305T>C p.(L102P) Variant is called p.(L99P) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs45434630 rs45434630 1998 9799269
OMIA 001199-9823 pig Large Black Meishan Dominant black MC1R E^D1 missense no Sscrofa11.1 6 g.181905C>T c.283G>A p.(V95M) Variant is called p.(V92M) in original paper (Kijas et al., 1998). Two silent (p.(A240A), p.(N118N)) and two missense substitutions p.(V92M) and p.(L99P) were found in dominant black Asian pigs (E^D1/E^D1) (Kijas et al., 1998). cDNA and protein location in this table are based on transcript ENSSSCT00000022534.2. rs45434629 rs45434629 1998 9799269
OMIA 001199-9823 pig Bama miniature Pietrain Coat colour, black spotting on red or white background MC1R E^P, E^qy insertion, small (<=20) no Sscrofa11.1 6 g.182126_182127insGG c.67_68insCC p.(R23Pfs*33) Variant was published as nt67insCC (Kijas et al., 2001), g.462-463CC (Wu et al., 2017), c.67_68insCC (Jia et al. 2017) rs1113295336 2017 28002929 28411032 11404341
OMIA 001199-9913 cattle Angus Holstein-Friesian Icelandic Dominant black MC1R E^D missense no UMD3.1 18 g.14757910T>C c.296T>C p.(L99P) rs109688013 1995 8535072 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001544-9913 cattle Rat-tail syndrome MC1R E^D missense no UMD3.1 18 g.14757910T>C c.296T>C p.(L99P) rs109688013 2016 27037038
OMIA 001199-9913 cattle Angus Fleckvieh Red Friesian Recessive red MC1R e deletion, small (<=20) no UMD3.1 18 g.14757924del c.310del p.(G104Vfs*53) rs110710422 1995 8535072 Variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002217-9823 pig fatness, growth, feed intake MC4R missense unknown Sscrofa11.1 1 g.160773437G>A p.(D298N) rs81219178 rs81219178 2000 10656927 Variant coordinates updated based on Johnsson and Jungnickel (2021)
OMIA 002043-9913 cattle Belgian Blue Abortion (embryonic lethality), MED22-related MED22 deletion, small (<=20) yes ARS-UCD1.2 11 p.(L38Rfs*25) 2016 27646536
OMIA 001932-9615 dog Swedish Vallhund Progressive retinal atrophy, MERTK-related MERTK insertion, gross (>20) yes CanFam3.1 17 An insertion of "a full-length [6.401 kb] LINE-1 element comprising the 15 bp target site duplication [indicated by 'ins' in the g. notation], a 5’UTR, 900 bp 5’ ORF1, a 49 bp intergenic spacer, a 3,828 bp 3’ ORF2, a 3’UTR and poly(A) tail. The LINE-1 element has been inserted in the same orientation as the MERTK gene.". 200922: g. info has been moved to here (g.36338043-36338057ins) until it can be standardised 2017 28813472 Genomic location provided by Sally Ricketts
OMIA 002153-9615 dog Schnauzer-Beagle cross Neuroaxonal dystrophy MFN2 deletion, small (<=20) yes 2 c.1617_1619delGGA p.(Q539del) 2011 21643798
OMIA 001106-9913 cattle Tyrolean Grey Axonopathy MFN2 splicing yes UMD3.1 16 g.42562057C>T c.2229C>T "This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript" 2011 21526202 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002197-9796 horse Shetland Pony Mushroom MFSD12 not known no 7 p.(D201fs) 2019 Reference not in PubMed; see OMIA 002197-9796 for reference details
OMIA 002197-9615 dog White or cream MFSD12 missense no CanFam3.1 20 g.55850145C>T c.151C>T p.(R51C) rs22915955 2019 31117290 The cDNA coordinate kindly provided by Tosso Leeb 190523
OMIA 001962-9615 dog Chihuahua Chinese Crested Dog Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) yes 19 c.843delT p.(F282Lfs*13) 2015 25551667 Breed and p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
OMIA 001962-9685 domestic cat Domestic Shorthair Neuronal ceroid lipofuscinosis, 7 MFSD8 deletion, small (<=20) yes Felis_catus_9.0 B1 c.780delT p.(Q262LKfs*33) Guevar et al. (2019): "XM_019828986.2:c.780delT or XP_019684545.1:p.(Gln262Lysfs*33)" 2020 31860737
OMIA 001565-9913 cattle Finnish Ayrshire Abortion and stillbirth due to mutation in MIMT1 MIMT1 deletion, gross (>20) yes 18 a 110 kb deletion in the MIMT1 gene 2010 21152099
OMIA 002309-9646 giant panda Cataract MIP missense yes c.686G>A p.(S229N) 2021 33530927
OMIA 001401-10036 golden hamster Waardenburg syndrome, type 2A MITF splicing yes A T>A base substitution in intron 6 of MITF leads to the skipping of exon 7 and a premature termination. 2003 12871913
OMIA 000915-93934 Japanese quail Feather colour, silver MITF deletion, small (<=20) no "a two-base deletion resulting in premature termination of the polypeptide in the region following the zipper region" = 2 bp deletion in exon 11 1998 9576828
OMIA 000755-93934 Japanese quail Osteopetrosis MITF deletion, small (<=20) yes same MITF variant as for silver, as reported in 1998 2001 11169846
OMIA 001931-9913 cattle Holstein Depigmentation associated with microphthalmia MITF deletion, gross (>20) yes 22 a de novo deletion of a 19.1 Mb region of BTA22 from 28 835 247-47 983 179 2014 25199536
OMIA 000214-89462 water buffalo Swamp White spotting MITF nonsense (stop-gain) no c.328C>T p.(R110*) 2015 26417640
OMIA 000214-89462 water buffalo Swamp White spotting MITF splicing no c.840+2T>A 2015 26417640
OMIA 000214-9796 horse American Paint Horse White spotting, blue eyes and deafness MITF SW5 deletion, gross (>20) yes 16 g.21503211_21566617del 2019 30644113
OMIA 001680-9913 cattle Holstein Glass-eyed albino MITF deletion, small (<=20) yes ARS-UCD1.2 22 g.31628127_31628129del p.(R211del) UMD3.1 position g.31746506_31746508del 2017 28904385 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001680-9913 cattle German Fleckvieh Dominant white with bilateral deafness MITF missense yes ARS-UCD1.2 22 g.31628131C>A c.629G>T p.(R210I) UMD3.1 position is g.31746502 2011 22174915 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000214-9913 cattle Holstein Simmental White spotting MITF regulatory no ARS-UCD1.2 22 g.31650821T>A c.33+112A>T UMD3.1 position is g.31769189 rs210634530 2012 22486495 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000214-9913 cattle Brown Swiss White spotting MITF regulatory no ARS-UCD1.2 22 g.31790063G>A c.104+53185C>T FN 190425: The Ensembl entry for rs722765315 lists two transcripts: ENSBTAT00000067269.1:c.104+53185C>T and ENSBTAT00000076082.1:c.-53+31498C>T rs722765315 2019 30506810 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000214-9615 dog Coat colour, white spotting MITF regulatory no CanFam3.1 20 g.21836232_21836427ins>del 2007 17906626 This SINE-insertion variant is the first of three possible regulatory variants described by Karlsson et al. (2007). Its genomic location and description were kindly provided by Professor Claire Wade in August 2018.
OMIA 000214-9796 horse Quarter Horse Splashed white MITF SW3 deletion, small (<=20) no EquCab2.0 16 c.519_523delGTGTC p.(C174Sfs*20) 200922: g. info moved to here (g.20105348) until it can be standardised 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000214-9796 horse American Standardbred White MITF MITF^244Glu missense no EquCab2.0 16 g.20094630C>T c.731G>A p.(G244E) 2017 27592871 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; breed and allele information obtained from Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000214-9796 horse Franches-Montagnes Macchiato MITF macchiato missense no EquCab2.0 16 g.20103081A>G c.629A>G p.(N210S) 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000214-9796 horse American Miniature Horse American Paint Horse Appaloosa Icelandic Morgan Old-Tori Quarter Horse Shetland Pony Trakehner Splashed white MITF SW1 delins, small (<=20) no EquCab2.0 16 g.20117302Tdelins11 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 000214-9796 horse Menorca White splashing MITF regulatory no EquCab2.0 16 g.20147039C>T 2017 28084638
OMIA 000214-9796 horse American Paint Horse Splashed white MITF SW6 deletion, gross (>20) no EquCab3.0 16 g.21551060_21559770del NC_009159.3:g.21551060-21559770del (Magdesian et al., 2020) 2020 32242630
OMIA 001680-452646 American mink Hedlund MITF h splicing yes MusPutFur1.0.86 c.33+1G>A GL896899.1:18635719 G/A (MITF-M C.33 + 1 G > A (Manakhov et al., 2017) 2019 30872653
OMIA 001401-9823 pig Rongchang Waardenburg syndrome, type 2A MITF insertion, small (<=20) yes Sscrofa11.1 13 g.51377987_51377988insTTTAGTTTAAAAAA a 14 bp insertion "in the non-regulatory region of the melanocyte-specific promoter of microphthalmia-associated transcription factor (MITF) gene generated a novel silencer" 2016 27349893
OMIA 002146-9615 dog Bull Terrier Miniature Bull Terrier Lethal acrodermatitis MKLN1 splicing yes CanFam3.1 14 g.5731405T>G c.400+3A>C p.(G105Sfs*10) This variant is "located within the 5’-splice site of intron 4 of the MKLN1 gene" 2018 29565995
OMIA 001654-8932 rock pigeon Almond MLANA st repeat variation yes "The CNV captures a 77-kb segment of the reference genome (ScoHet5_227: 5,181,467–5,259,256), with an additional increase in coverage in a nested 25-kb segment (ScoHet5_227: 5,201,091–5,226,635). Read-depth analysis confirmed 7 copies of the outer 77-kb segment and 14 copies of the inner 25-kb segment in the genomes of female (ZStW) Almond pigeons, which have an St locus on only one chromosome. We used PCR to amplify across the outer and inner CNV breakpoints of Almond pigeons and determined that the CNV consists of tandem repeats of the 77-kb and nested 25-kb segments (Fig 3)." (Bruders et al., 2020) 2020 32433666
OMIA 002145-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MLH1-related MLH1 nonsense (stop-gain) yes 2 Bray et al. (2018): "a de novo stop codon in the coding region of MLH1. This de novo stop codon occurs in exon 11 out of 19 in the MLH1 gene, and thus would produce a dramatically truncated and possibly non-functional protein" 2018 30108684
OMIA 002145-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MLH1-related MLH1 deletion, small (<=20) yes 2 g.99561829_99561830del Brammer et al. (2018): "a heterozygous deletion in the putative promoter region of the MLH1 gene (rheMac2: 2:99,561,829– 99,561,830; hg19: ∼3:37,034,780; c.−258_259)" 2018 29490919
OMIA 001445-93934 Japanese quail Feather colour, lavender MLPH deletion, gross (>20) no a large deletion in the region of the quail MLPH gene 2002 12011184
OMIA 000031-452646 American mink Coat colour, silver-blue MLPH deletion, gross (>20) no deletion of exon 8 2013 23747352
OMIA 001445-9031 chicken Five gray MLPH missense no 7 g.4727070A>G c.1909A>G 2016 27173258
OMIA 000031-9986 rabbit Lionhead Dwarf Loh Netherland Dwarf Coat colour, dilute MLPH deletion, small (<=20) no g.549853delG c.585delG p.(L195Lfs*123) 2013 24376820
OMIA 000031-9913 cattle Belgian Blue Coat colour, cool gray MLPH deletion, small (<=20) no ARS-UCD1.2 3 g.116966611_116966620del c.87_96del p.(E32Dfs*1) 2016 26582259 The genomic location on ARS-UCD1.2 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries.
OMIA 000031-9615 dog American Staffordshire Terrier Beagle Doberman Pinscher German Pinscher Large Munsterlander Miniature Pinscher Rhodesian Ridgeback Dilute MLPH d^1 splicing yes CanFam3.1 25 g.48121642G>A c.-22G>A 2007 17519392 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 000031-9615 dog Chihuahua Hungarian mudi Hungarian pumi Italian Greyhound Pekingese Shetland Sheepdog Shih-Tzu Tibetan Mastiff Yorkshire Terrier Dilute MLPH d^3 insertion, small (<=20) no CanFam3.1 25 g.48150749_50insC c.667_668insC p.(H223Pfs*41) "(NM_001103219.2: c.667_668insC or chr25: g.48150749_50insC" (van Buren et al. (2020) 2020 32531980
OMIA 000031-9615 dog Chow Chow Sloughi Thai Ridgeback Dilute MLPH d^2 missense yes CanFam3.1 25 g.48150787G>C c.705G>C p.(Q235H) 2018 29349785
OMIA 000031-9685 domestic cat Coat colour, dilute MLPH d deletion, small (<=20) no Felis_catus_9.0 C1 g.219396820del c.83del p.(L28Rfs*12) XM_023257818.1:c.83delT 2006 16860533 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001445-9031 chicken Feather colour, lavender MLPH missense no GalGal5 7 g.4795061C>T c.103C>T p.(R35W) 2008 18197963 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000031-452646 American mink Silverblue MLPH p splicing no MusPutFur1.0.86 g.662639G>A c.901+1G>A GL896909.1:662639 G/A (MLPH C.901 + 1 G > A) (Manakhov et al., 2019) 2019 30872653
OMIA 000031-9940 sheep Jacob Lilac MLPH nonsense (stop-gain) no Oar_rambouillet_v1.0 1 g.3580535C>A p.(E14*) Oar_v4.0 position is NC_019458.2:g.3451931C>A; NP_001139743.1:p.Glu14* (Posbergh et al., 2020) 2020 32512769
OMIA 000884-9031 chicken Rose comb MNR2 inversion no 7 a 7.38 Mb inversion 2012 22761584
OMIA 001819-9913 cattle Tyrolean Grey Xanthinuria, type II MOCOS deletion, small (<=20) yes ARS-UCD1.2 24 g.20911933del c.1881del p.(S628Vfs9*) Published using UMD3.1 position: g.21222030delC; cDNA and protein positions are given transcript: ENSBTAT00000048768. Positions for a second transcript (ENSBTAT00000065375) were given in the paper: c.1782del and p.(S595Vfs9*). 2016 27919260 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001819-9913 cattle Japanese Black Xanthinuria, type II MOCOS deletion, small (<=20) yes ARS-UCD1.2 24 g.20936257_20936259del c.769_771del p.(Y257del) published as c.769_771delTAC 2000 10801779 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001541-9913 cattle Fleckvieh Simmental Arachnomelia, BTA23 MOCS1 deletion, small (<=20) yes ARS-UCD1.2 23 g.13837654_13837655del c.1224_1225del UMD3.1 position is g.13833868_13833869del rs383500843 2011 21255426 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001366-9031 chicken Retinal dysplasia and degeneration MPDZ nonsense (stop-gain) yes GalGal4 Z g.30882785C>T c.1372C>T p.(R458*) 2011 21862650 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002028-9615 dog Italian hound Myeloperoxidase deficiency MPO nonsense (stop-gain) yes 9 c.1987C>T p.(R663*) 2016 27296514
OMIA 001452-9913 cattle Belgian Blue Tail, crooked MRC2 missense yes UMD3.1 19 g.47734925T>G c.1906T>G p.(C636G) rs466131011 2012 22497452 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001452-9913 cattle Belgian Blue Tail, crooked MRC2 deletion, small (<=20) yes UMD3.1 19 g.47740474_47740475del c.2904_2905del p.(G934*) 2009 19779552 Breed and some variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170) 210908 the entry g.47740473delAG can't be correct because if two bases have been deleted, the g. notation must include the two relevant base positions. FN BLASTED the sequence CCAGACCTGCCGCCCACAG obtained from Fig 3 against UMD3.1.1, and determined that the entry should be g.47740474_47740475del
OMIA 002160-9544 Rhesus monkey Colorectal cancer, hereditary nonpolyposis, MSH6-related MSH6 missense unknown Dray et al. (2018): "a heterozygous missense mutation in MSH6 that has a CADD score of 22.8, indicating that it would be among the <1% most deleterious mutations possible in the human genome (if that variant occurred in the human MSH6 gene" 2018 30108684
OMIA 000319-9823 pig Ear size MSRB3 repeat variation no Sscrofa11.1 5 "the 38.7-kb CNV . . . starts at 349,577 bp and ends at 388,246 bp of the corrected contig (MK028166) . . . , covering the last two exons 6 and 7 of the MSRB3 gene" (Chen et al., 2018) 2018 30587124
OMIA 001538-9796 horse Racing distance MSTN insertion, gross (>20) no 18 A "227 bp SINE insertion positioned upstream of exon 1" 2018 30379863
OMIA 000683-9615 dog Whippet Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) yes 37 c.939_940delTG p.(C313*) a two-base-pair deletion in the third exon of MSTN leading to a premature stop codon at amino acid 313 2007 17530926
OMIA 000683-9913 cattle Gelbvieh Muscular hypertrophy (double muscling) MSTN missense yes ARS-UCD1.2 2 g.6279187T>C c.191T>C p.(L64P) UMD3.1 position is g.6213889T>C rs449270213 2015 25515003 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Angus Limousin Muscular hypertrophy (double muscling) MSTN missense yes ARS-UCD1.2 2 g.6279278C>A c.282C>A p.(F94L) UMD3.1 position is g.6213980A>C rs110065568 1998 9501304 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Parthenaise Muscular hypertrophy (double muscling) MSTN missense yes ARS-UCD1.2 2 g.6279310C>G c.314C>G p.(S105C) UMD3.1 position is g.6214012C>G 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Maine Anjou Muscular hypertrophy (double muscling) MSTN nt419(del7-ins10) delins, small (<=20) yes ARS-UCD1.2 2 g.6281243_6281249delinsAAGCATACAA c.419_425delinsAAGCATACAA p.(F140*) cDNA and protein positions based on NM_001001525.3 and NP_001001525.1, retrospectively 1998 9501304 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Variant coordinates updated based on Johnsson and Jungnickel (2021)
OMIA 000683-9913 cattle Maine Anjou Muscular hypertrophy (double muscling) MSTN D182N missense yes ARS-UCD1.2 2 g.6281368G>A c.544G>A p.(D182N) 2002 Reference not in PubMed; see OMIA 000683-9913 for reference details The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Blonde d'Aquitaine Charolais Limousin Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) yes ARS-UCD1.2 2 g.6281434 C>T c.610C>T p.(Q204*) UMD3.1 position is g.6216138C>T rs110344317 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Maine Anjou Marchigiana Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) yes ARS-UCD1.2 2 g.6281500G>T c.676G>T p.(E226*) UMD3.1 position is g.6216204G>T 1998 9501304 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Angus Asturiana Belgian Blue Blonde d'Aquitaine Braford Limousin Murray Grey Parthenaise Santa Gertrudis South Devon Muscular hypertrophy (double muscling) MSTN deletion, small (<=20) yes ARS-UCD1.2 2 g.6283674_6283684del c.821_831del p.(D273RfsX14) UMD3.1 position is g.6218379delATGAACACTCC rs382669990 1997 9288100 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries. Protein coordinates updated based on Johnsson and Jungnickel (2021).
OMIA 000683-9913 cattle Maine Anjou Marchigiana Muscular hypertrophy (double muscling) MSTN nonsense (stop-gain) yes ARS-UCD1.2 2 g.6283727G>T c.1004G>T p.(E291*) UMD3.1 position is g.6218432G>T 2013 22497537 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 000683-9913 cattle Gasconne Parthenaise Piedmontese Muscular hypertrophy (double muscling) MSTN missense yes ARS-UCD1.2 2 g.6283794G>A c.938G>A p.(C313Y) UMD3.1 position is g.6218499G>A 1997 9314496 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170). The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 001426-9940 sheep Texel Muscular hypertrophy (double muscling), Texel MSTN regulatory yes Oar_rambouillet_v1.0 2 g.129065977G>A c.*1232G>A "G to A transition in the 3' UTR that creates a target site for mir1 and mir206, microRNAs (miRNAs)" rs408469734 2006 16751773 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002161-9823 pig Large White Leg weakness, MSTN-related MSTN nonsense (stop-gain) yes Sscrofa11.1 15 g.94623834C>A c.820G>T p.(E274*) 2019 30699111
OMIA 000683-9823 pig Pietrain Muscular hypertrophy (double muscling) MSTN regulatory yes Sscrofa11.1 15 g.94629236T>C Stinckens et al. (2008) describe polymorphism located at position 447 of the porcine MSTN promoter, EF490986 EF490990 g.447A>G rs332188828 rs332188828 2008 18822098
OMIA 001561-9615 dog Shar-Pei Periodic Fever Syndrome MTBP missense yes CanFam3.1 13 g.19383758G>A c.2623G>A p.(E875K) ss2136554981 rs1152388482 2017 28472921 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001508-9615 dog Rottweiler Myotubular myopathy 1 MTM1 missense yes X c.1151A>C p.(Q384P) 2015 25664165
OMIA 001508-9615 dog Labrador Retriever Myotubular myopathy 1 MTM1 missense yes X c.465C>A p.(N155K) 2010 20682747
OMIA 000175-9796 horse Arabian Bashkir Curly Horse Trakehner Welsh Pony Cerebellar abiotrophy MUTYH not known yes EquCab3.0 2 g.13122415G>A A SNP "located in exon 4 of TOE1 and approximately 1200 base pairs upstream of MUTYH, adjacent to a possible binding site for the transcription factor GATA2" (Brault et al., 2011). EquCab3.1 coordinate provided by Meredith O’Connell, working under the supervision of Professor E. Bailey. 2011 21126570
OMIA 001534-9031 chicken Resistance to myxovirus MX1 missense no GalGal5 1 g.108941567G>A c.1892G>A p.(S631N) rs313590198 2002 11932243 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001978-9913 cattle Swiss Holstein Arthrogryposis, distal, type 1B MYBPC1 missense yes UMD3.1 5 g.65787153T>G c.884T>G p.(L295R) 2015 26289121 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000515-9685 domestic cat Maine Coon Cardiomyopathy, hypertrophic MYBPC3 missense yes D1 c.91G>C p.(A31P) 2005 16236761
OMIA 000515-9685 domestic cat Ragdoll Cardiomyopathy, hypertrophic MYBPC3 missense yes D1 c.??C>T p.(R820W) 2007 17521870
OMIA 002141-9796 horse Quarter Horse Immune-mediated myositis MYH1 missense yes EquCab3.0 11 g.53345548T>C p.(E321G) The location of this likely causal variant was given as chr11:52,993,878T>C by Finno et al. (2018) in relation to the EquCab2.0 assembly. Applying NCBI's remap gives the EquCab3.0 coordinate as chr11:53,345,548 2018 29510741
OMIA 002039-9913 cattle Belgian Blue Abortion (embryonic lethality), MYH6-related MYH6 deletion, small (<=20) yes ARS-UCD1.2 10 g.21538917_21538919del p.(K1730del) 2016 27646536 The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 002212-9685 domestic cat Domestic Shorthair Cardiomyopathy, hypertrophic, MYH7-related MYH7 missense yes B3 c.5647G>A p.(E1883K) NM_000257.3:c.5647G>A (p.(Glu1883Lys)) 2019 31164718
OMIA 001200-9823 pig Tremor, high-frequency (Campus syndrome) MYH7 insertion, small (<=20) yes Sscrofa11.1 7 g.75668349_75668350insGGCGGG c.4320_4321insCCCGCC p.(A1440_A1441insPA) 2012 23153285 The genomic location on Sscrofa10.2 was determined by Stephanie Shields (27/05/2020) and updated to the genomic Sscrofa11.1 location by Imke Tammen
OMIA 001608-9615 dog Pug May-Hegglin anomaly MYH9 missense yes 10 p.(Q1841L) 2011 21554370
OMIA 001501-9796 horse Arabian Lavender foal syndrome MYO5A deletion, small (<=20) yes 1 g.138235715delC 2010 20419149
OMIA 002148-9615 dog Doberman Pinscher Deafness, bilateral, and vestibular dysfunction MYO7A missense yes CanFam3.1 21 g.21563111G>A c.3719G>A p.(R1240Q) 2019 31097876
OMIA 002148-9823 pig Duroc vestibular dysfunction MYO7A nonsense (stop-gain) yes Sscrofa11.1 9 g.11280403C>T c.541C>T p.(Q181*) cDNA position is based on transcript NM_001099928.1 2021 33955556
OMIA 001342-8790 emu Mucopolysaccharidosis IIIB NAGLU deletion, small (<=20) yes c.1098_1099delGG 2001 11414757
OMIA 001342-9615 dog Schipperke Mucopolysaccharidosis IIIB NAGLU insertion, gross (>20) yes CanFam3.1 9 c.2110_2111ins[A(40_70);2100_2110] "an insertion (XM_548088.6:c.2110_2111ins[A(40_70);2100_2110]) comprised of a homopolymer of A residues (poly-A) and an 11 bp duplication of the sequence directly upstream of the poly-A" (Raj et al. (2020) 2020 32081995
OMIA 001342-9913 cattle Mucopolysaccharidosis IIIB NAGLU missense yes UMD3.1 19 g.43264699G>A c.1354G>A p.(E452K) 2007 17458708 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001788-9615 dog Great Dane Rottweiler Leukoencephalomyelopathy NAPEPLD insertion, small (<=20) yes CanFam3.1 18 g.16987327_16987328insC c.345_346insC p.(E116Rfs*186) 2018 29643404
OMIA 001788-9615 dog Leonberger Leukoencephalomyelopathy NAPEPLD missense yes CanFam3.1 18 g.16987520G>C c.538G>C p.(A180P) 2018 29643404
OMIA 002348-9615 dog English Cocker Spaniel retinal dysplasia NDP insertion, small (<=20) yes CanFam3.1 X g.37950668_37950668insC c.653_654insC p.(M114Hfs*16) 2021 33945575
OMIA 002189-8932 rock pigeon Barless NDP c start-lost no Cliv_1.0 Vickrey et al. (2018): "a nonsynonymous protein-coding change at the start codon of NDP". 2018 30014848
OMIA 002120-9615 dog Greyhound Polyneuropathy NDRG1 deletion, small (<=20) yes 13 c.1080_1089del10 2010 20582309
OMIA 002120-9615 dog Alaskan Malamute Polyneuropathy NDRG1 missense yes CanFam3.1 13 g.29714606G>T c.293G>T p.(G98V) 2013 23393557 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002137-9615 dog American Bulldog Nemaline myopathy, NEB-related NEB nonsense (stop-gain) unknown CanFam3.1 19 g.52734272C>A p.(S8042*) 2016 27215641
OMIA 002198-9615 dog Giant Schnauzer Progressive retinal atrophy, NECAP1-related NECAP1 missense yes CanFam3.1 27 g.37468611G>A c.544G>A p.(G182R) 2019 31117272
OMIA 000545-93934 Japanese quail Quv (quiver) strain Hypotrophic axonopathy NEFL nonsense (stop-gain) yes c.352C>T p.(Q114*) 1993 8468353
OMIA 001771-7091 domestic silkworm "Ming" lethal egg NEWENTRY complex rearrangement yes an ~1.9 kb region from the 3' untranslated region of BmVMP23 to the forepart of BmEP80 was replaced by a >100 kb DNA fragment 2013 23262333
OMIA 000218-9615 dog Collie eye anomaly NHEJ1 deletion, gross (>20) yes CanFam2.0 37 g.28697542_28705340del7799 a deletion of 7.8kb in the NHEJ1 gene 2007 17916641
OMIA 000690-9615 dog Beagle Chihuahua Miniature Wirehaired Dachshund Newfoundland Pembroke Welsh Corgi Myoclonus epilepsy of Lafora NHLRC1 repeat variation yes 35 19 to 26 copies of a sequence of 12 nucleotides (12-mer; dodecamer) in the canine EPM2B gene (now called NHLRC1) 2005 15637270
OMIA 002103-9913 cattle Angus Developmental duplications NHLRC2 missense yes UMD3.1 26 g.34618072T>C c.932T>C p.(V311A) 2014 Reference not in PubMed; see OMIA 002103-9913 for reference details Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001936-9913 cattle Romagnola Cataract, recessive, Romagnola NID1 deletion, gross (>20) yes 28 "an 855 bp deletion across the exon 19/intron 19 border of the bovine nidogen 1 (NID1) gene (c.3579_3604+829del)" 2014 25347398
OMIA 001980-9615 dog American Bulldog American Bully Ichthyosis, NIPAL4-related NIPAL4 deletion, small (<=20) yes CanFam3.1 4 g.52737379delC c.744delC p.(I249*) 2017 28122049
OMIA 000938-9615 dog Weimaraner Spinal dysraphism NKX2-8 delins, small (<=20) yes 8 p.(A150Vfs*2) 2013 23874236
OMIA 002206-9615 dog Alaskan Malamute Ciliary dyskinesia, primary, NME5-related NME5 deletion, small (<=20) yes CanFam3.1 11 g.25792084del c.43delA p.(T15Lfs*56) XM_003639378.4:c.43delA; XP_003639426.1:p.(Thr15LeufsTer56) 2019 31479451
OMIA 001101-9031 chicken Polymorphic Nucleolar (PNU) strain Ribosomal RNA deficiency NOR deletion, gross (>20) yes "Embryos exhibiting a nucleolar phenotype of one large and one very small nucleolus (Pp) are heterozygous for a reduced rDNA cluster (+/p1) and were shown in the present study to contain about 66% of the complement of rRNA genes in normal individuals (+/+) that show two large equal-sized nucleoli (PP)" 1994 8014461
OMIA 000725-9913 cattle Angus Niemann-Pick type C1 NPC1 missense yes ARS-UCD1.2 24 g.33099467C>G c.2969C>G p.(P990R) NM_174758.2:c.2969C>G ss7148491913 2020 32970694
OMIA 000725-9685 domestic cat Niemann-Pick disease, type C1 NPC1 missense yes Felis_catus_6.2 D3 g.47439721G>C c.2864G>C p.(C955S) 2003 12809639 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000725-9685 domestic cat Domestic Shorthair Niemann-Pick disease, type C1 NPC1 missense yes Felis_catus_6.2 D3 g.47455793A>C c.1322A>C p.(H441P) 2017 28233346 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002065-9685 domestic cat Niemann-Pick disease, type C2 NPC2 splicing yes Felis_catus_6.2 B3 g.120939103G>A c.82+5G>A p.(G28_S29ins35) 2014 25396745 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001455-9615 dog Miniature Wirehaired Dachshund Standard wire-haired dachshund Cone-rod dystrophy, Standard Wire-haired Dachshund NPHP4 deletion, gross (>20) yes 5 "a 180-bp deletion in exon/intron 5 of NPHP4 (nephronophthisis 4, also known as nephroretinin)" 2008 18687878
OMIA 002254-9615 dog Mixed breed Glucocorticoid resistance NR3C1 insertion, gross (>20) yes 2 c.2032_2033ins69 An insertion of "69 nucleotides between nucleotides 2032 and 2033 compared with dog wild type GR [i.e. NR3C1]. These extra 69 nucleotides matched a part of the nucleotide sequence of dog genomic DNA corresponding to intron 6 . . . . Insertion of these extra 69 nucleotides between exons 6 and 7 introduced a frameshift and a premature termination codon (TGA) 15 bp downstream of the insertion. This insertion is thus predicted to result in a truncated protein of 682 amino acids, compared to the normal (wild type) 780 amino acids" (Yamanaka et al., 2019) 2019 31651346
OMIA 002296-9615 dog Yorkshire Terrier XY DSD (Disorder of Sexual Development), NR5A1-related NR5A1 deletion, gross (>20) yes 9 "a large deletion consisting of four exons of the NR5A1 gene" (Nowacka-Woszuk et al., 2020) 2020 33128907
OMIA 002117-9615 dog Labrador Retriever CHILD-like syndrome NSDHL deletion, gross (>20) yes CanFam3.1 X g.120749179_120763577del14 2017 28739597
OMIA 002117-9615 dog Chihuahua verrucous epidermal keratinocytic nevi NSDHL missense yes CanFam3.1 X g.120752468G>A c.700G>A p.(G234R) CanFam3.1 ChrX:120,752,468G>A; XM_014111859.2:c.700G>A; XP_013967334.1: p.Gly234Arg 2019 31571289
OMIA 002117-9615 dog Chihuahua Verrucous epidermal keratinocytic nevi NSDHL deletion, small (<=20) yes CanFam3.1 X g.120752486_120752490delGAACA c.718_722delGAACA p.(E240Pfs*17) NC_006621.3: g.120,752,486_120,752,490delGAACA; XM_014111859.2:c.718_722delGAACA; XP_013967334.1:p.(Glu240Profs*17) (Christen et al., 2020) 2020 33143176
OMIA 002117-9685 domestic cat Domestic Shorthair Inflammatory linear verrucous epidermal nevi NSDHL missense yes Felis_catus_9.0 X c.397A>G p.(S133G) De Lucia et al. (2019): XM_004000985.5:c.397A>G; XP_004001034.1:p.(Ser133Gly) 2019 30474267
OMIA 002035-9913 cattle Jersey Abortion (embryonic lethality), OBFC1-related OBFC1 deletion, small (<=20) yes UMD_3.1.1 26 g.24720155_24720156del c.379_380del p.(K127Vfs*28) 2016 27646536 210909: FN changed c.379_380delAA to c.379_380del. He also added the ref sequence, based on the words in the text "Sequence reads were aligned to the bosTau6 reference genome". FN also checked the g. location against Suppl Material S2, which lists the location as 24720154. However, a search of the UMD assembly confirms that the AA del is actually as given, i.e. g.24720155_24720156del
OMIA 001595-9940 sheep Merino Brachygnathia, cardiomegaly and renal hypoplasia syndrome OBSL1 deletion, small (<=20) yes Oar_rambouillet_v1.0 2 g.236304072del c.1716del p.(V573Wfs*119) XM_027965226.1:c.1716delC 2020 32933480 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager & Shernae Woolley, EMAI, NSW Department of Primary Industries. 210906 To conform with HGVS notation, FN removed the nucleotide from g.236304072delG and c.1716delC
OMIA 002130-94885 corn snake Coat colour, oculocutaneous albinism, OCA2-related OCA2 insertion, gross (>20) yes LTR retrotransposon in the 11th intron 2015 26597053
OMIA 002130-9615 dog German Spitz Coat colour, oculocutaneous albinism, OCA2-related OCA2 splicing yes CanFam3.1 3 g.31715704A>C "LOC100855460 (XM_005618224.1:c.377+2T>G LT844587.1:c.-45+2T>G) . . . Comparative sequence analyses revealed that LOC100855460 actually represents the 5'-end of the canine OCA2 gene. The CanFam 3.1 reference genome assembly is incorrect and separates the first two exons from the remaining exons of the OCA2 gene. We amplified a canine OCA2 cDNA fragment by RT-PCR and determined the correct full-length mRNA sequence (LT844587.1)." 2017 28973042
OMIA 000162-9913 cattle Red Holstein Cardiomyopathy, dilated OPA3 nonsense (stop-gain) yes ARS-UCD1.2 18 g.53152213G>A c.343C>T p.(Q115*) UMD3.1 position is g.53546443C>T; cDNA position based on ENSBTAT00000064088.2 rs479222100 2011 20923700 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 002227-9940 sheep Istrian Pramenka Otocephaly OTX2 nonsense (stop-gain) yes Oar_rambouillet_v1.0 7 g.71478714G>A c.265C>T p.(R89*) Paris et al. (2020): XM_015097088.2:c.265C > T 2020 31969185
OMIA 001564-9615 dog Greater Swiss Mountain Bleeding disorder, P2RY12-related P2RY12 deletion, small (<=20) yes 23 "a 3 base-pair deletion predicted to result in elimination of a serine from the extracellular domain was identified in the gene encoding P2RY12" 2011 21554368
OMIA 001437-9913 cattle Brown Swiss Beta-lactoglobulin, aberrant low expression PAEP regulatory yes UMD3.1 11 g.103301704C>A c.-215C>A "C to A transversion at position 215 bp upstream of the translation initiation site" 2006 17033029 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 001688-9796 horse Lipizzan Noriker Quarter Horse Splashed white PAX3 SW2 missense no EquCab2.0 6 g.11429753G>A c.209G>A p.(C70Y) 2012 22511888 Variant coordinates gleaned from or confirmed by Table S1 of Durig et al. (2017) Anim Genet 48:123-124
OMIA 001688-9796 horse Appaloosa Splashed white PAX3 SW4 missense no EquCab2.0 6 g.11429867G>C c.95C>G p.(P32R) 2013 23659293
OMIA 001314-9615 dog Cardigan Welsh Corgi Rod-cone dysplasia 3 PDE6A deletion, small (<=20) yes 4 c.1940delA p.(N616fs) "deletion of a single base in codon 616 of the gene for the alpha subunit of cyclic guanosine monophosphate (cGMP) phosphodiesterase (PDE6A), which is "predicted to lead to a frame shift resulting in a string of 28 altered codons followed by a premature stop codon" 1999 10393029 Variant information gleaned from or confirmed by Donner et al. (2016) PLoS One 11:e0161005
OMIA 001669-9615 dog Sloughi Rod-cone dysplasia 1a PDE6B insertion, small (<=20) yes 3 "an 8-bp insertion after codon 816" of the PDE6B gene 2000 11124530
OMIA 001674-9615 dog American Staffordshire Terrier Cone-rod dystrophy 1 PDE6B deletion, small (<=20) yes CanFam2.0 3 g.94574289_94574291del c.2404_2406del p.(802del) 2013 24045995
OMIA 000882-9615 dog Irish Setter Rod-cone dysplasia 1 PDE6B nonsense (stop-gain) yes CanFam3.1 3 g.91747713G>A c.2421G>A p.(W807*) 1993 8387203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002282-9615 dog Spanish water dog PRA, PDE6B-related PDE6B deletion, small (<=20) yes CanFam3.1 3 g.91749865_91749870del c.2218-2223del p.(F740_F741del) "CanFam3.1; chr3:91,749,865-91,749,870; GCA_000002285.2:c.2218-2223del; p.Phe740_Phe741del" Winkler et al. (2020) 2020 32639685
OMIA 002163-9544 Rhesus monkey Cone dystrophy 4, PDE6C-related PDE6C missense yes Mmul_8.0.1 9 p.(R565Q) 2019 30667376
OMIA 001406-9615 dog Clumber Spaniel Sussex Spaniel Pyruvate dehydrogenase deficiency PDP1 nonsense (stop-gain) yes 29 c.754C>T p.(Q252*) 2007 17095275
OMIA 000913-9031 chicken Silky/Silkie Silky/Silkie feathering PDSS2 PDSS2(-103C-G) regulatory unknown GalGal5 3 g.68009144C>G c.-103C>G Feng et al. (2014): "a C to G transversion at 70,486,623 bp (ss666793747)" "The ss666793747 mutation is 103 bp upstream of the initiator codon ATG of PDSS2". The reported location was with respect to the galGal2 assembly. In the intervening years, ss666793747 has become rs316090093, from which the present location is taken. rs316090093 2014 25166907
OMIA 002303-9685 domestic cat Cerebral dysgenesis PEA15 deletion, small (<=20) yes Felis_catus_9.0 F1 g.66768324delT c.176delA p.(N59fs) Genomic position described by Graff et al. (2020) as felCat9 chrF1:66768323 GT -> G. cDNA and protein positions are based on XM_023247767.1 and XP_023103535.1, respectively. 2020 33290415
OMIA 001827-9913 cattle Montbeliarde Vorderwald Abortion due to haplotype MH1 PFAS missense yes UMD3.1 19 g.28511199C>T c.3613C>T p.(R1205C) rs455876205 2017 28803020 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000421-9615 dog American Cocker Spaniel English Springer Spaniel Whippet Glycogen storage disease VII PFKM nonsense (stop-gain) yes 27 c.2228G>A p.(W???*) 1996 8702726
OMIA 000421-9615 dog Wachtelhund Glycogen storage disease VII PFKM missense yes 27 c.550C>T p.(R184W) 2012 22446493
OMIA 001128-9823 pig Duroc Pale soft exudative meat PHKG1 splicing yes Sscrofa11.1 3 g.16830320C>A Ma et al. 2014: "a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon" rs330928088 rs330928088 2014 25340394
OMIA 001953-9913 cattle Belgian Blue Arthrogryposis, lethal syndrome PIGH splicing yes UMD3.1 10 g.79814520C>G c.211-10C>G rs451004237 2015 25895751 Variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
OMIA 002084-9615 dog Soft Coated Wheaten Terrier Dyskinesia, paroxysmal, PIGN PIGN missense yes CanFam3.1 1 g.14705240C>T c.398C>T p.(T133I) 2016 27891564 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002324-9615 dog Parson Russell Terrier epilepsy, mitochondrial dysfunction and neurodegeneration PITRM1 deletion, small (<=20) unknown CanFam3.1 2 g.32188565_32188570del c.175_180del p.(L59_S60del) ENSCAFT00000008673 c.175_180del 2021 33835239
OMIA 002270-8932 rock pigeon Feathered shank PITX1 deletion, gross (>20) no "a 44-kb deletion (from 6.719–6.763 Mb)" (Domyan et al., 2016) 2016 26977633
OMIA 002270-9031 chicken Feathered shanks PITX1 deletion, gross (>20) no GRCg6a 13 g.16089993_16107660del a 17.7kb deletion upstream of PITX1. 2020 32344431 32344429
OMIA 000649-9940 sheep Texel Microphthalmia PITX3 missense yes Oar_rambouillet_v1.0 22 g.25497953C>G c.338G>C p.(R113P) Oar_v3.1 position is g.22045744C>G 2010 20084168 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000807-9685 domestic cat Persian Polycystic kidney disease PKD1 nonsense (stop-gain) yes E3 c.10063C>A p.(?3284*) 2004 15466259
OMIA 000807-9615 dog Bull Terrier Polycystic kidney disease PKD1 missense yes CanFam3.1 6 g.38856816G>A c.9559G>A p.(E3187K) rs397509460 rs397509460 2011 21818326 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000844-9615 dog Basenji Pyruvate kinase deficiency of erythrocyte PKLR deletion, small (<=20) yes 7 a single base-pair deletion in exon 5 of the gene encoding R-type pyruvate kinase (PKLR) 1994 7520391
OMIA 000844-9615 dog West Highland White Terrier Pyruvate kinase deficiency of erythrocyte PKLR insertion, small (<=20) unknown 7 a 6 base pair insertion in exon 10 1999 10490091
OMIA 000844-9615 dog Pug Pyruvate kinase deficiency of erythrocyte PKLR missense yes 7 c.848T>C p.(V283A) 2012 22805166
OMIA 000844-9615 dog Beagle Pyruvate kinase deficiency of erythrocyte PKLR missense yes 7 c.994G>A p.(G332S) 2012 22805166
OMIA 000844-9615 dog Labrador Retriever Pyruvate kinase deficiency of erythrocyte PKLR nonsense (stop-gain) yes 7 g.42268632C>T c.799C>T p.(Q267*) 2012 22805166 20181218 Thanks to Maarten de Groot for advising FN of the genomic location
OMIA 000844-9685 domestic cat Abyssinian Brazilian Somali Pyruvate kinase deficiency of erythrocyte PKLR splicing yes Felis_catus_9.0 F1 g.70310110G>A c.707-53G>A XM_023247386.1:c.707-53G>A; published as c.693+304G>A 2012 23110753 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 001864-9615 dog Chesapeake Bay Retriever Golden Retriever Ectodermal dysplasia/skin fragility syndrome PKP1 splicing yes CanFam3.1 7 g.1966531G>C c.202+1G>C 2012 22384142 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002105-9615 dog Papillon Neuroaxonal dystrophy, PLA2G6-related PLA2G6 missense yes CanFam3.1 10 g.26544820G>A c.1579G>A p.(T527A) 2017 28107443 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002105-9940 sheep Swaledale Neuroaxonal dystrophy, PLA2G6-related PLA2G6 nonsense (stop-gain) yes Oar_rambouillet_v1.0 3 g.230750869G>A c.1186C>T p.(Q396*) Oar_rambouillet_v1.0: g.230750869G>A; XM_027968104.1 [shorter transcript] and XM_012175630.3 [longer transcript]: c.1186C>T; XP_027823905.1: p.Gln396* in the shorter transcript; XP_012031020.2: p.Leu396Phe in the longer transcript (Letko et al., 2020). Only the former variant peptide is tabulated here. 2021 33159255
OMIA 002105-9940 sheep Swaledale Neuroaxonal dystrophy, PLA2G6-related PLA2G6 splicing unknown Oar_rambouillet_v1.0 3 g.230766713T>C c.336-2A>G p.(L71Wfs*3) Oar_rambouillet_v1.0: g.230766713T>C; XM_012175630.3: c.336-2A>G; XP_012031020.2: p.Leu71TrpfsTer3 (Letko et al., 2020) 2021 33159255
OMIA 001935-9913 cattle Fleckvieh Zinc deficiency-like syndrome PLD4 nonsense (stop-gain) yes ARS-UCD1.2 21 g.69352995G>A c.702G>A p.(W234*) UMD3.1 position is g.71001232G>A rs378824791 2014 25052073 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; rsID gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370. The genomic location on ARS-UCD1.2 was determined by Katie Eager and Shernae Woolley, EMAI, NSW. Department of Primary Industries.
OMIA 002080-9615 dog Eurasier Epidermolysis bullosa, simplex, PLEC PLEC nonsense (stop-gain) yes CanFam3.1 13 g.37461941G>A c.3947G>A p.(W1316*) CanFam3 chr13: g.37461941G>A; XM_539204.6:c.3947G>A; XP_539204.2:p.Trp1316Stop: 2016 27878870 Updated variant coordinates kindly provided by Tosso Leeb on 8 May 2020
OMIA 002020-9615 dog Scottish Terrier Ligneous membranitis PLG splicing yes 1 c.1256+2T>A 2015 26360520
OMIA 002020-9615 dog Maltese Ligneous membranitis PLG deletion, gross (>20) yes CanFam3.1 1 g. 49,534,880–49,540,865del a deletion of 5986 bp involving exon 1 and the flanking region 2021 34370320
OMIA 002195-9615 dog Welsh springer spaniel Cardiomyopathy, dilated, PLN-related PLN missense yes 1 g.58588129G>A c.26G>A p.(R9H) 2019 30794913 c. coordinate kindly provided by Tosso Leeb
OMIA 001982-9796 horse Warmblood Fragile Foal Syndrome PLOD1 missense yes EquCab3.0 2 g.39927817C>T c.2032G>A p.(G678R) rs1136065234 2015 25637337 rsID and Variant coordinates obtained from Zhang et al. (2020): "g.39927817C>T (rs1136065234; NC_009145.3, Equ-Cab3.0)" c. and p. coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000770-9986 rabbit Tremor, X-linked PLP1 missense yes X T>A 1994 7525875
OMIA 000770-9615 dog Springer Spaniel Tremor, X-linked PLP1 missense yes CanFam3.1 X g.77200833A>C c.110A>C p.(H37P) 1990 1723945 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000373-9031 chicken Feather colour, Dun PMEL deletion, small (<=20) no 34 "a deletion of five amino acids in the transmembrane region" 2004 15579702
OMIA 000373-9031 chicken Feather colour, Smoky PMEL deletion, small (<=20) no 34 “The Smoky allele shared the 9-bp insertion in exon 10 with Dominant white, as expected from its origin, but also had a deletion of 12 nucleotides in exon 6, eliminating four amino acids from the mature protein” 2004 15579702
OMIA 000373-9031 chicken Feather colour, dominant white PMEL I insertion, small (<=20) no 34 a 9-bp (3aa) insertion (WAP) after amino acid 610 in exon 10 2004 15579702
OMIA 000211-9615 dog Numerous breeds Classic Merle PMEL M insertion, gross (>20) yes 10 "an insertion of a tRNA-derived SINE . . . . The insertion occurs at the boundary of intron 10 and exon 11 and is flanked by a 15-bp target site duplication . . . . The SINE insertion is in reverse orientation, with the 5' end closer to exon 11." Allele M (265-269bp); phenotype = Classic Merle = "standard" of Murphy et al. (2018) 2006 16407134
OMIA 000211-9615 dog Numerous breeds No Merle pattern - solid coat PMEL Mc insertion, gross (>20) no 10 Mc (208-230bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
OMIA 000211-9615 dog Numerous breeds No Merle pattern - solid coat PMEL Mc+ insertion, gross (>20) no 10 Mc+ (231-245bp); phenotype = No Merle pattern – solid coat; = "cryptic" of Murphy et al. (2018) 2018 30235206
OMIA 000211-9615 dog Numerous breeds No Merle pattern - diluted - brownish hue PMEL Ma insertion, gross (>20) no 10 Ma (247-254bp); phenotype = No Merle pattern – diluted–brownish hue; = "cryptic" of Murphy et al. (2018) 2018 30235206
OMIA 000211-9615 dog Numerous breeds Muted, undefined, diluted - brownish hue PMEL Ma+ insertion, gross (>20) no 10 Ma+ (255-264bp); phenotype = Muted, undefined, diluted–brownish hue = "dilute" of Murphy et al. (2018) 2018 30235206
OMIA 000211-9615 dog Numerous breeds Minimal Merle, areas deleted to white, tweed PMEL Mh insertion, gross (>20) yes 10 Mh (269-277bp); phenotype = Minimal Merle, areas deleted to white, tweed = "harlequin" of Murphy et al. (2018) 2018 30235206
OMIA 001545-30521 domestic yak Coat colour, dilution PMEL deletion, small (<=20) no c.50_52del p.(L18del) 2014 24989079
OMIA 001438-9796 OMIA 000733-9796 horse American Miniature Horse Icelandic Rocky Mountain Coat colour, silver AND Multiple congenital ocular anomalies PMEL missense no 6 g.73665304C>T p.(R625C) 2006 17029645
OMIA 002191-93934 Japanese quail Yellowish plumage PMEL nonsense (stop-gain) no g.811370G>A p.(W149*) Ishishita et al. (2018): g.811370G>A (NC_029544.1); Trp149* 2018 30425278
OMIA 001545-9913 cattle Charolais Galloway Hereford Highland Simmental Coat colour, dilution PMEL deletion, small (<=20) no UMD3.1 5 g.57669913_57669915del c.50_52del p.(L19del) rs385468954 2008 18408794 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001544-9913 cattle Rat-tail syndrome PMEL deletion, small (<=20) unknown UMD3.1 5 g.57669913_57669915del c.50_52del p.(L19del) rs385468954 2016 27037038
OMIA 001545-9913 cattle Charolais Coat colour, dilution PMEL missense no UMD3.1 5 g.57669926G>A c.64G>A p.(G22R) rs718553050 2007 17705851 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002183-9823 pig Landrace Embryonic lethality PNKP missense yes Sscrofa11.1 6 g.54880241G>T p.(Q96R) Derks et al. (2019): "deleterious missense mutation in the PNKP gene (6:g.54880241G>T), predicted to be strongly deleterious by SIFT (0.02) and PROVEAN (-2.9). The missense mutation causes a glutamine to arginine amino acid substitution (ENSSSCP00000003467:p.Gln96Arg)" 2019 30875370
OMIA 001588-9615 dog Golden Retriever Ichthyosis, PNPLA1-related PNPLA1 delins, small (<=20) yes 12 c.1445_1447delinsTACTACTA p.(N482Ifs*11) 2012 22246504
OMIA 000827-9913 cattle Brown Swiss Carora Progressive degenerative myeloencephalopathy (Weaver syndrome) PNPLA8 missense yes UMD3.1 4 g.49878773G>A c.1703G>A p.(S568N) rs800397662 2016 26992691 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 000483-30521 domestic yak Polled, Mongolian allele POLLED P[sub]M or P[sub]219ID complex rearrangement no "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" 2017 28135247
OMIA 000483-9913 cattle Nellore Polled, Guarani POLLED P[sub]G duplication no ARS-UCD1.2 1 g.2614828_2724315dup "a novel duplication variant" in the region BTA1:1,893,790–2,004,553 (Utsunomiya et al., (2019) 2019 30644114 Randhawa et al. (2019): ARS-UCD1.2 g.2614828_2724315dup
OMIA 000483-9913 cattle Friesian Polled, Friesian POLLED P[sub]F OR P(sub)80kbID duplication no ARS-UCD1.2 1 g.2629113_2709240dup 2013 23717440 In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a duplication of CHR1:1,909,352–1,989,480". Randhawa et al. (2019): ARS-UCD1.2 g.2629113_2709240dup
OMIA 000483-9913 cattle Brahman Polled, Celtic POLLED P[sub]C OR P[sub]202ID complex rearrangement no ARS-UCD1.2 1 g.[22429326_2429335del;2429109_2429320dupins] UMD3.1: g.1706051_1706060 delins170583 2012 22737241 Randhawa et al. (2019) ARS-UCD1.2 g.[22429326_2429335del;2429109_2429320dupins]
OMIA 000483-9913 cattle Mongolian Turano Polled, Mongolian POLLED P[sub]M OR P[sub]219ID complex rearrangement no ARS-UCD1.2 1 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins] "a complex 219-bp duplication-insertion (P219ID) beginning at 1,976,128 bp and a 7-bp deletion and 6-bp insertion (P1ID) located 621 bp upstream of this position . . . . This rearrangement results in duplication of an 11-bp motif (5'-AAAGAAGCAAA-3') that is entirely conserved among Bovidae . . . and that is also duplicated in the 80-kb duplication responsible for Friesian polledness" In relation to assembly UMD v3.1.1, Utsunomiya et al. (2019) described this variant as "a complex duplication starting at CHR1:1,976,128". 2017 28135247 Randhawa et al. (2019): ARS-UCD1.2 g.[2695261_2695267delinsTCTGAA;2695889_2696047dupins]
OMIA 002181-9823 pig Landrace Embryonic lethality POLR1B splicing yes Sscrofa11.1 3 g.43952776T>G Derks et al. (2019): "Skipping of exon 14 introduces a glutamic acid and a premature stop codon in the second codon of the terminal exon, lacking the final 370 amino acids located in the conserved subunit 2, hybrid-binding domain (binding to the DNA strand)" 2019 30875370
OMIA 001258-9615 dog Labrador Retriever Obesity POMC deletion, small (<=20) yes CanFam3.1 17 g.19431807_19431821del p.(E188fs) 2016 27157046
OMIA 002315-9615 dog Karelian bear dog Pituitary dwarfism POU1F1 splicing yes CanFam3.1 31 g.784534C>A c.605-3C>A Kyöstilä et al. (2021) "the NNSPLICE 0.9 splice prediction tool (Reese et al. 1997) predicted this variant to weaken the splice acceptor of POU1F1 intron 4 from a score of 0.97 to 0.67." 2021 33550451
OMIA 001579-9823 pig Chinese Erhualian Large floppy ears PPARD missense no Sscrofa11.1 7 g.31281804G>A c.95G>A p.(G32E) rs80909573 2011 21573137 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcripts: XM_005665910.3, XM_013977808.2 by Stephanie Shields (27/05/2020)
OMIA 000327-9796 horse American Quarter Horse Ehlers-Danlos syndrome PPIB missense yes EquCab2.0 1 g.128056148G>A c.115G>A p.(G39R) rs396329681 2007 17498917 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000161-9913 cattle Poll Hereford Cardiomyopathy and woolly haircoat syndrome PPP1R13L duplication yes UMD3.1 18 g.53440861_53440867dupACAGGCG c.956-962dupACAGGCG p.(G335Efs*36) 2009 19016676 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001504-9615 dog Dachshund Neuronal ceroid lipofuscinosis, 1 PPT1 insertion, small (<=20) yes 15 c.736_737insC p.(F246Lfs*29) 2010 20494602 p. information obtained from Katz et al. (2017) Neurobiol Dis. doi: 10.1016/j.nbd.2017.08.017
OMIA 001504-9615 dog Italian Cane Corso Neuronal ceroid lipofuscinosis, 1 PPT1 splicing yes CanFam3.1 15 g.2860424G>A c.124+1G>A 2017 28008682
OMIA 001311-9615 dog Miniature Schnauzer Photoreceptor dysplasia PPT1 PPT1^dci complex rearrangement yes CanFam3.1 15 g.2874661_2875048con2877563_2877607inv 2019 30541930
OMIA 001298-9615 dog American Cocker Spaniel Australian Cattle Dog Australian Shepherd Australian Stumpy Tail Cattle Dog Chesapeake Bay Retriever Chinese Crested Dog English Cocker Spaniel Entlebucher mountain dog Finnish Lapphund Golden Retriever Karelian bear dog Kuvasz Labrador Retriever Lapponian Herder Miniature Poodle Norwegian Elkhound Nova Scotia Duck Tolling retriever Portugese water dog Spanish water dog Swedish Lapphund Toy Poodle Yorkshire Terrier Progressive rod-cone degeneration PRCD missense yes CanFam3.1 9 g.4188663G>A c.5G>A p.(C2Y) 2006 16938425 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- missense yes Sscrofa11.1 15 g.120863533C>T c.749G>A p.(R250Q) The paper by Milan et al. (2000) reported this variant as c.599G>A and p.R200Q rs1109104772 rs1109104772 2000 10818001 The genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
OMIA 001085-9823 pig Meat quality (Rendement Napole) PRKAG3 RN- missense yes Sscrofa11.1 15 g.120863537C>T c.745G>A p.(I249V) rs1108399077 rs1108399077 2001 11729159 he genomic location on Sscrofa11.1 was determined and the effect was confirmed with Ensembl VEP in the following transcript: ENSSSCT00000017641.4 by Stephanie Shields (27/05/2020)
OMIA 000220-9615 dog Jack Russell Terrier Severe combined immunodeficiency disease, autosomal PRKDC nonsense (stop-gain) yes 29 c.10879G>T p.(E3627*) 2002 11867233
OMIA 000220-9796 horse Arabian Severe combined immunodeficiency disease, autosomal PRKDC deletion, small (<=20) yes EquCab3.0 9 g.36395752_36395759del c.9478_9482del p.(N3160fs*3) A 5bp deletion giving rise to a frameshift in PRKDC The following details (from which the coordinate fields were populated) were provided by Meredith O’Connell, Tanya German, Isabella Pisani and Karalie Andrews, under the supervision of Professor Ernie Bailey. 20 Feb 2019 NC_009152.3 g.36395752-36395976del; NM_001163858 c.9478_9482del; NP_001157330 p.N3160fs*3 1997 9103416
OMIA 001485-9913 cattle Angus Dwarfism, Angus PRKG2 nonsense (stop-gain) yes UMD3.1 6 g.97667351C>T c.1573C>T p.(R525*) rs109639251 2009 19887637 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001485-9913 cattle Angus Dwarfism, Angus PRKG2 nonsense (stop-gain) yes UMD3.1 6 g.97667351C>T c.2032C>T p.(R678*) 2009 19887637 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000441-9913 cattle Fleckvieh Holstein-Friesian Jersey Hairy PRL missense no UMD3.1 23 g.35105313A>C c.661A>C p.(C221G) 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000380-9031 chicken Feathering, Z-linked PRLR duplication no Z The tandem duplication of this region results in the partial duplication of two genes; the prolactin receptor and the gene encoding sperm flagellar protein 2. 2008 18713476
OMIA 001372-9913 cattle Carora Romosinuano Senepol Slick hair PRLR deletion, small (<=20) no ARS-UCD1.2 20 g.39099214del c.1382del p.(A461Vfs*2) rs517047387 2014 25519203 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; some variant information gleaned from or confirmed by Table 1 of  Sharma et al. (2017) Animal Genetics 48(3):369-370
OMIA 001372-9913 cattle Limonero Slick hair PRLR nonsense (stop-gain) no ARS-UCD1.2 20 g.39099226C>A p.(S465*) 2018 29527221
OMIA 001372-9913 cattle Carora Limonero Slick hair PRLR nonsense (stop-gain) no ARS-UCD1.2 20 g.39099321C>T p.(R497*) 2018 29527221
OMIA 000380-9103 turkey Commercial lines Feathering, Z-linked PRLR deletion, small (<=20) unknown Turkey_5.1 Z g.9426018_9426022delTTGGT p.(E726Dfs*7) 2018 29566646
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 p.(H143R) 2002 11842266
OMIA 000944-9925 goat Norwegian Dairy Goat Complete resistance to scrapie PRNP Ter nonsense (stop-gain) no ARS1 13 g.46469788G>T c.94G>T p.(G32*) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 2012 23249298 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 g.46470073G>A c.379G>A p.(G127S) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 rs268292978 2011 22040234 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 g.46470120A>G c.426A>G p.(I142M) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 rs268292980 1996 8922485 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense no ARS1 13 g.46470130A>G c.436A>G p.(N146D) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 2007 16314132 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense no ARS1 13 g.46470131A>G c.437A>G p.(N146S) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 2007 16314132 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 g.46470155G>A c.461G>A p.(R154H) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 rs268292981 2009 19218225 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 g.46470326G>A c.632G>A p.(R211Q) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 rs268292982 2009 19218225 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9925 goat Resistance to scrapie PRNP missense yes ARS1 13 g.46470358C>A c.664C>A p.(Q222K) ENSEMBL Variant Effect Predictor: transcript ENSCHIT00000020215.1 rs268292983 2006 16603543 The genomic location on ARS1 was determined by Katie Eager, EMAI, NSW Department of Primary Industries
OMIA 000944-9940 sheep Ile de France Romanov Resistance to scrapie PRNP V missense yes Oar_rambouillet_v1.0 13 g.48675389C>T c.407C>T p.(A136V) Oar_v3.1 position is g.46225660C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs591379086 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Norwegian breeds Resistance to scrapie, Nor98 type PRNP F missense yes Oar_rambouillet_v1.0 13 g.48675403C>T c.421C>T p.(L141F) Oar_v3.1 position is g.46225674C>T; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs598580733 2005 15604451 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Ile de France Romanov Resistance to scrapie PRNP H missense yes Oar_rambouillet_v1.0 13 g.48675443G>A c.461G>A p.(R154H) Oar_v3.1 position is g.46225714G>A; protein and cDNA positions are based on NP_001009481.1 and NM_001009481.1, respectively rs605048948 1993 8094373 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9940 sheep Suffolk Resistance to scrapie PRNP Q missense yes Oar_rambouillet_v1.0 13 g.48675494G>A c.512G>A p.(R171Q) Oar_v3.1 position is g.46225765G>A; protein and cDNA positions based on NP_001009481.1 and NM_001009481.1, respectively rs160575103 1990 1969635 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool. The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 000944-9913 cattle Numerous breeds Spongiform encephalopathy (mad cow disease) PRNP missense yes UMD3.1 13 g.47415059G>A c.631G>A p.(E211K) 2008 18787697 Genomic coordinates obtained from EBI's VEP
OMIA 001454-9615 dog Great Dane Harlequin PSMB7 missense no 9 c.146T>G p.(V6G) 2011 21256207
OMIA 001515-9615 dog Great Dane Colorectal hamartomatous polyposis and ganglioneuromatosis PTEN insertion, gross (>20) yes 26 "Duplication of PTEN" 2011 20952721
OMIA 002196-9615 dog Doberman Pinscher Deafness, unilateral and vestibular dysfunction PTPRQ insertion, small (<=20) yes CanFam3.1 15 g.22989894insA p.(N2032Kfs*24) 2018 29460419
OMIA 001139-9940 sheep Glycogen storage disease V PYGM splicing yes Oar_rambouillet_v1.0 21 g.44787090C>T c.2380-1G>A a G>A substitution at the 3' splice site of intron 19, cDNA position based on NM_001009192.2 rs402505013 1997 9267848 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 001139-9913 cattle Charolais Glycogen storage disease V PYGM missense yes UMD3.1 29 g.43611783C>T c.1468C>T p.(R490W) 1996 8845714 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 001913-9615 dog Gordon Setter Old English Sheepdog Ataxia, cerebellar, in Old English Sheepdogs and Gordon Setters RAB24 missense yes CanFam3.1 4 g.36055678A>C c.113A>C p.(Q38P) 2014 24516392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002292-452646 American mink Moyle coat colour RAB38 deletion, small (<=20) no NNQGG.v01 1 g.16075438_16075453del c.574-589del "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
OMIA 002292-452646 American mink Moyle coat colour RAB38 duplication no NNQGG.v01 1 g.16132224_16132225dupCT c.20-21dup "We identified a homozygous 16-bp deletion [FNWR01000007.1:16075438–16075453del (RAB38:c.574-589del)], hereinafter referred to as RAB383del, in the Moyle sample, at the third exon of RAB38 gene. We found a homozygous 2-bp duplication NWR01000007.1:16132224_16132225dupCT (RAB38:c.20-21dup)], hereinafter referred to as RAB381dup, in the Violet sample, at the first exon of the RAB38 gene. Both mutations potentially resulted in the loss of function of RAB38 protein" (Manakhov et al., 2020) 2020 32985525
OMIA 001970-9615 dog Alaskan Husky Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 insertion, gross (>20) yes 19 a 218 bp SINE insertion into exon 7 of the RAB3GAP1 gene (RAB3GAP1:c.614_615insLN864704:g.123_340) 2015 26596647
OMIA 001970-9615 dog Black Russian Terrier Rottweiler Polyneuropathy, ocular abnormalities and neuronal vacuolation RAB3GAP1 deletion, small (<=20) yes 19 c.743delC 2016 26607784
OMIA 002037-9913 cattle Holstein-Friesian Abortion (embryonic lethality), RABGGTB RABGGTB missense yes UMD3.1 3 g.69318970A>G c.584A>G p.(Y195C) 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001547-9031 chicken Wingless-2 RAF1 nonsense (stop-gain) yes galGal6a 12 g.5374854G>A c.175C>T p.(R59*) NC_006099.5:g.5374854G>A ENSGALT00000033956.3:c.175C>T ENSGALP00000033314.3:p.Arg59Ter rs314452077 2019 31075853
OMIA 001574-9615 dog Frisian Water Dog Severe combined immunodeficiency disease, autosomal, T cell-negative, B cell-negative, NK cell-positive RAG1 nonsense (stop-gain) yes CanFam3.1 18 g.31631772G>T c.2893G>T p.(E965*) 2011 21293384 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001806-9615 dog Coat colour, black-and-tan RALY duplication no CanFam3.1 24 g.23252754_23252770dupCCCCAGGTCAGAGTTT 2013 23519866 Genomic location and details kindly provided by Professor Claire Wade in August 2018
OMIA 002222-9615 dog Miniature Bull Terrier Laryngeal paralysis, RAPGEF6-related RAPGEF6 insertion, gross (>20) yes CanFam3.1 11 g.19841331ins c.1793_1794ins36 p.(I587Pfs*5) Hadji Rasouliha et al. (2019): XM_846793.5:c.1793_1794insTTTTTTTTTTTTTTTTTTTTTAGCCCTTGAAATTTT; XP_851886.2:p.(Ile578ProfsTer5) 2019 31647804
OMIA 001003-9615 dog Eskimo Spitz Thrombopathia RASGRP1 insertion, small (<=20) yes 30 c.452-453insA 2007 17656327
OMIA 001003-9615 dog Landseer Thrombopathia RASGRP1 nonsense (stop-gain) yes 30 c.982C>T p.(R328*) 2007 17656327
OMIA 001003-9615 dog Basset Hound Thrombopathia RASGRP1 deletion, small (<=20) yes 30 g.509510511delTCT 2008 18922051
OMIA 001003-9913 cattle Fleckvieh Simmental Thrombopathia RASGRP2 missense yes UMD3.1 29 g.43599204T>C c.701T>C p.(L234P) rs385444696 2007 18039909 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002365-9615 dog Giant Schnauzer Standard Schnauzer Cardiomyopathy, dilated RBM20 deletion, gross (>20) unknown 28 22 bp deletion and frame shift in exon 11 of RBM20 2014 Reference not in PubMed; see OMIA 002365-9615 for reference details
OMIA 000876-9031 chicken Riboflavinuria RBP splicing yes 8 A "deletion in the rd ribBP cDNA correspond[ing] precisely to an exon. The splice site following this exon contains a G-->A mutation at position 1 of the downstream 5'-splice donor sequence. 1993 8226844
OMIA 002151-9615 dog Irish soft-coated wheaten terrier Microphthalmia, isolated, with coloboma RBP4 deletion, small (<=20) yes CanFam3.1 28 c.282_284del p.(K30del) 2018 29847795
OMIA 001260-9615 dog Collie Rod-cone dysplasia 2 RD3 insertion, gross (>20) yes 7 "22 bp insertion changes the last 61 amino acids of the encoded protein" 2009 19130129
OMIA 001867-9940 sheep Churra Lissencephaly and cerebellar hypoplasia RELN deletion, gross (>20) yes Oar_rambouillet_v1.0 4 g.50313243_50313273del c.5410_5440del A deletion of 31 bp (GATGTAAGTTCCCATTGAAATCATCTTTAAG) in predicted exon 36 of RELN would lead to a truncated protein of 1817 amino acids (1803 amino acids of normal reelin followed by 14 missense amino acids and a premature termination codon) 2013 24260534 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries.
OMIA 002209-7950 Atlantic herring Adaptation to a red-shifted light environment rho missense no p.(F261Y) 2019 31451650
OMIA 001346-9615 dog English Mastiff Autosomal dominant PRA RHO missense yes CanFam3.1 20 g.5637394C>G c.11C>G p.(T4R) 2002 11972042 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001901-9913 cattle Nordic Red Abortion due to deletion of RNASEH2B RNASEH2B deletion, gross (>20) yes 12 A 662kb deletion encompases the gene RNASEH2B, lack of which creates embryonic lethality 2014 24391517
OMIA 001686-9913 cattle Belgian Blue Dwarfism, proportionate, with inflammatory lesions RNF11 splicing yes UMD3.1 3 g.95601696A>G c.124-2A>G 2012 22438830 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 002038-9913 cattle Holstein-Friesian Abortion (embryonic lethality), RNF20 RNF20 nonsense (stop-gain) yes UMD3.1 8 g.92930920A>T c.2077A>T p.(K693*) 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002223-9913 cattle Holstein Interdigital hyperplasia ROR2 missense yes ARS-UCD1.2 8 g.85905534T>A p.(W9R) Zhang et al. (2019): "NC_037335.1:g.85,905,534T>A, ARS-UCD1.2; ENSBTAP00000053765.2:p.Trp9Arg; rs377953295" rs377953295 2019 31798639
OMIA 002317-9986 rabbit Sauteur d'Alfort sauteur RORB s^am splicing yes OryCun2.0 1 g.61103503G>A This variant corresponds to a change from GT to AT in the 5’ donor site of intron 9 (Carneiro et al., 2021) 2021 33764968
OMIA 002029-9913 cattle Angus Beef Booster Composite Belgian Blue Charolais Gelbvieh Holstein Maine Anjou Normande Red Angus Retinitis pigmentosa 1 RP1 insertion, small (<=20) yes UMD3.1 14 g.23995411_23995412insA p.(R791Kfs*13) 2016 27510606
OMIA 002134-9913 cattle Ayrshire Abortion due to haplotype AH2 RPAP2 splicing yes 3 a splice acceptor variant at 51,267,548 bp [reference sequence not specified] in RPAP2 2017 Reference not in PubMed; see OMIA 002134-9913 for reference details
OMIA 001222-9615 dog Briard Leber congenital amaurosis (congenital stationary night blindness) RPE65 deletion, small (<=20) yes 6 4bp deletion in RPE65 1998 9808841
OMIA 000831-9615 dog Weimaraner Progressive retinal atrophy, X-linked, type 1 RPGR deletion, gross (>20) yes X "a large deletion [maximum size 5,006 bp] comprising the first four exons of the X-linked retinitis pigmentosa GTPase regulator (RPGR) gene" 2016 27398221
OMIA 000831-9615 dog Samoyed Siberian Husky Progressive retinal atrophy, X-linked, type 1 RPGR deletion, small (<=20) yes X c.1028_1032delGAGAA a "five-nucleotide deletion (delGAGAA) between 1028 and 1032" in the canine RPGR gene 2002 11978759
OMIA 001518-9615 dog Mongrel Progressive retinal atrophy, X-linked, type 2 RPGR deletion, small (<=20) yes X c.1084-1085delGA "a two-nucleotide deletion (delGA) in 1084-1085" in the canine RPGR gene 2002 11978759
OMIA 001432-9615 dog Miniature Long-haired Dachsund Cone-rod dystrophy 4 RPGRIP1 insertion, gross (>20) yes 15 a 44-bp insertion in exon 2 of the RPGRIP1 gene 2006 16806805
OMIA 002041-9913 cattle Belgian Blue Abortion (embryonic lethality), RPIA-related RPIA splicing yes UMD3.1 11 g.47223666G>A c.826+1G>A 2016 27646536 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001531-9615 dog Furnishings (moustache and eyebrows) RSPO2 insertion, gross (>20) no 13 a 167bp insertion "within the 3'UTR at position 11,634,766", which leads to a threefold increase in transcription of RSPO2 in muzzle skin of dogs with furnishings 2009 19713490
OMIA 001498-9615 dog Portugese water dog Improper coat RSPO2 insertion, gross (>20) yes 13 "167 bp 3' UTR insertion in RSPO2" 2010 20562213
OMIA 002297-9913 cattle Holstein Friesian Tetradysmelia RSPO2 delins, gross (>20) yes ARS-UCD1.2 14 g.56451029–56501201delinsTGACAA a 50-kb deletion spanning three exons of the R-spondin 2 (RSPO2) gene 2020 33176673
OMIA 000483-9940 sheep Numerous breeds Polled RXFP2 insertion, gross (>20) no Oar_rambouillet_v1.0 10 "1833-bp genomic insertion located in the 30-UTR region of RXFP2 present in polled animals only" 2015 26103004
OMIA 000621-9615 dog Collie Doberman Pinscher German Shepherd Dog Labrador Retriever Malignant hyperthermia RYR1 missense yes 1 c.1640T>C p.(V547A) "The nucleotide sequences of canine regions I and II have been submitted to GenBank (accession No. A302128 and AF302129, respectively)" (Roberts et al., 2001) 2001 11575546
OMIA 000621-9796 horse American Quarter Horse Malignant hyperthermia RYR1 missense yes 10 c.7360C>G p.(R2454G) 2004 15318347
OMIA 000621-9823 pig Malignant hyperthermia RYR1 missense yes Sscrofa11.1 6 g.47357966T>C c.1843C>T p.(R615C) NM_001001534.1: c.1843C>T; p.(R615C) Interestingly, the reference allele in the Sscrofa11.1 assembly is T rather than C, meaning that the Duroc animal that is the basis of this reference genome assembly has the causal variant for malignant hyperthermia! rs344435545 rs344435545 1991 1862346 Effect was confirmed with Ensembl VEP in the following transcript: NM_001001534.1 by Stephanie Shields (27/05/2020)
OMIA 001876-9615 dog Basenji Progressive retinal atrophy, Basenji SAG extension (stop-lost) yes CanFam3.1 25 g.44843440T>C c.1216T>C p.(*405Rext*25) 2013 24019744 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002284-9615 dog Miniature Schnauzer Polyneuropathy, SBF2-related SBF2 splicing yes CanFam3.1 21 g.33080022C>A c.2363+1G>T p.(G775Vfs*5) 2019 31772832
OMIA 002016-9615 dog Wirehaired Fox Terrier Van den Ende-Gupta syndrome SCARF2 deletion, small (<=20) yes 26 c.865_866delTC p.(S289Gfs*15) 2016 27187611
OMIA 000785-9796 horse Quarter Horse HYPP SCN4A H missense yes EquCab3.0 11 g.15474228C>G c.4248C>G p.(F1416L) ECA11 (NC_009154.3) g.15474228C>G; NM_001081761.1: c.4248C>G; NP_001075230.1: F1416L; Sift Score 0.01. The above information (from which the coordinate fields were populated) was provided by Tatyana German and Meredith O’Connell, working under the supervision of Professor Ernie Bailey. rs1148998534 1992 1338908
OMIA 002194-9615 dog Alpine Dachsbracke Ataxia, spinocerebellar, SCN8A-related SCN8A missense yes CanFam3.1 27 g.3179029C>A c.4898G>T p.(G1633V) 2019 31083464
OMIA 002149-9913 cattle Holstein Abortion due to haplotype HH6 SDE2 start-lost yes UMD3.1 16 g.29773628A>G "This A-to-G transition changes the initiator ATG (methionine) codon to ACG because the gene is transcribed on the reverse strand. . . . Initiation of translation at the closest in-frame Met codon would truncate SDE2 by 83 amino acids, including an 8-amino acid motif conserved among eukaryotes" rs434666183 2018 29680649
OMIA 001692-9615 dog Finnish Hound Ataxia, cerebellar, progressive early-onset SEL1L missense yes CanFam3.1 8 g.53778458T>C c.1972T>C p.(S658P) 2012 22719266 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002367-9615 dog Belgian Shepherd CNS atrophy with cerebellar ataxia SEPP1 deletion, gross (>20) unknown CanFam3.1 4 g.66946539_66963863del17,325 deletion includes the entire protein coding sequence of SELENOP (also called SEPP1) 2021 34339417
OMIA 001897-9796 horse Connemara pony Hoof wall separation syndrome SERPINB11 insertion, small (<=20) yes EquCab3.0 8 g.83600643_83600644insC c.504_505insC p.(T169Hfs*3) 2015 25875171 FN thanks Daniel J. Schmidt, working under the supervision of Professor Ernie Bailey, for updating the coordinates to EquCab3.0.
OMIA 001483-9615 dog Dachshund Osteogenesis imperfecta_Dachshund SERPINH1 missense yes CanFam3.1 21 g.23033735T>C c.977T>C p.(L326P) 2009 19629171 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002305-9615 dog Miniature dachshund Muscular dystrophy, limb-girdle, type R3 SGCA nonsense (stop-gain) yes CanFam3.1 9 g.26166312G>A c.G224A p.(W75*) 2021 33407862
OMIA 000162-10036 golden hamster Cardiomyopathy, dilated SGCD deletion, gross (>20) yes genomic deletion was found to be located at 6.1 kb 5' upstream of the second exon of δ-SG gene, and its 5' upstream region of more than 27.4 kb, including the authentic first exon of δ-SG gene, was deleted 1997 9391120
OMIA 002211-10036 golden hamster Cardiomyopathy, hypertrophic SGCD deletion, gross (>20) yes a large deletion in the delta-SG gene 1997 9097966
OMIA 002122-9615 dog Boston Terrier Muscular dystrophy, limb-girdle, type 2F SGCD deletion, small (<=20) yes CanFam3.1 4 c.534_535delGA 2017 28702169
OMIA 002122-9615 dog Boston Terrier Muscular dystrophy, limb-girdle, type 2F SGCD delins, gross (>20) yes CanFam3.1 4 g.53262018_53262020delinsCC; g g.53262018_53262020delinsCC; g.53262030_53281432del 2017 28702169
OMIA 001279-9615 dog Scottish Deerhound Hypotrichosis, recessive SGK3 insertion, small (<=20) yes CanFam3.1 29 c.137_138insT p.(E47Gfs*3) Hytönen and Lohi (2019) Supplementary material 3: ENSCAFT00000011773.3:c.137_138insT; p.Q47fs 200922: g. info moved to here (g.16,351,976) until it can be standardised 2019 30927068
OMIA 001279-9615 dog American Hairless Hypotrichosis, recessive SGK3 deletion, small (<=20) yes CanFam3.1 29 g.16366702_16366705delTTAG c.287_290delTTAG p.(V96Gfs*50) 2017 27994129
OMIA 001309-9615 dog New Zealand Huntaway Dog Mucopolysaccharidosis IIIA SGSH insertion, small (<=20) yes 9 c.708-709insC 2002 11829484
OMIA 001309-9615 dog Dachshund Mucopolysaccharidosis IIIA SGSH deletion, small (<=20) yes 9 c.737-739delCCA 2000 10950929
OMIA 002013-9796 horse Shetland Pony Skeletal atavism SHOX deletion, gross (>20) yes PAR "two partially overlapping large deletions [are] in the pseudoautosomal region (PAR) of chromosome X/Y"; "One of the identified deletions removes the entire coding region of the short stature homeobox (SHOX) gene and both deletions remove parts of the cytokine receptor-like factor 2 (CRLF2) gene located downstream of SHOX." 2016 27207956
OMIA 002208-9615 dog Golden Retriever Eye malformation, congenital SIX6 nonsense (stop-gain) yes CanFam3.1 8 g.35566504C>T c.487C>T p.(Q163*) XM_547840.6:c.487C>T; XP_547840.3:p.(Gln163*) 2019 31207931
OMIA 002053-9913 cattle Japanese Black Hydrallantois SLC12A1 missense yes UMD3.1 10 g.62382825G>A p.(P372L) 2016 27613513
OMIA 002279-9615 dog Malinois Ataxia, spinocerebellar, SLC12A6-related SLC12A6 delins, small (<=20) yes CanFam3.1 30 c.178_181delinsCATCTCACTCAT p.(M60Hfs*14) "The INDEL involves a 12-bp insertion (CATCTCACTCAT) and a 4-bp deletion (ATGA), most probably generated by a template-switch process with an inverted repeat and an inverted spacer (Fig. 2). The variant is located in exon 1a and causes a frameshift at codon 60, leading to a premature stopcodon 14 codons downstream in all transcripts containing exon 1a (Fig. 2). The SLC12A6 NC_006612.3(XM_014109414.2): c.178_181delinsCATCTCACTCAT (p.(Met60Hisfs*14)) variant was deposited in the EVA database (URL: https://www.ebi.ac.uk/eva/; Project: PRJEB30850; Analyses: ERZ802317)" (Van Poucke et al., 2019) 2019 31160700
OMIA 001315-9615 dog Miniature Poodle Osteochondrodysplasia SLC13A1 deletion, gross (>20) yes 14 a 130kb deletion which "ablated all but the first exon of SLC13A1" 2012 23300579
OMIA 001400-9940 sheep Texel Chondrodysplasia, Texel SLC13A1 deletion, small (<=20) yes Oar_rambouillet_v1.0 4 g.95624809del c.334del Published as JN108880: g.25513delT / c.107delT. Position c.334delT based on ENSOARG00020003399 2012 22742499 The genomic location on Oar_rambouillet_v1.0 was determined by Katie Eager, EMAI, NSW Department of Primary Industries: g.95624809delA; c.334delT. 210906 After confirming the g location with NCBI BLAST, FN deleted the A and T, to conform with HGVS notation.
OMIA 001097-9615 dog Alaskan Husky Necrotising encephalopathy, subacute, of Leigh SLC19A3 insertion, small (<=20) yes 25 c.624 insTTGC 2013 23469184
OMIA 001097-9615 dog Yorkshire Terrier Juvenile-onset necrotizing encephalopathy SLC19A3 delins, gross (>20) yes CanFam3.1 25 g.40417857_40417862delins35 c.205_210delins35 p.(P69Ifs*45) "a 35 bp insertion replacing 6 bp and thereby disturbing the correct reading frame"; XM_022409850.1:c.205_210delins35; XP_022265558.1:p.Pro69Ilefs*45 (Drögemüller et al., 2020) 2020 33081289
OMIA 002124-9796 horse Paso Fino Tiger eye SLC24A5 Tiger-eye 2 deletion, gross (>20) yes EquCab2.0 1 g.141660611_141661239del c.875-340_1081+82del 2017 28655738
OMIA 002124-9796 horse Paso Fino Tiger eye SLC24A5 Tiger-eye 1 missense yes EquCab2.0 1 g.141677402A>T c.272A>T p.(F91Y) 2017 28655738 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002294-9615 dog Dutch Shepherd dog Inflammatory myopathy, SLC25A12-related SLC25A12 missense yes CanFam3.1 36 g.16219219A>G c.1046T>C p.(L349P) chr36:g.16,219,219A>G; c.1046T>C; p.L349P (Shelton et al., 2019) 2019 31594244
OMIA 002150-9913 cattle Rouge-des-Prés Syndrome des veaux tourneurs (Turning calves syndrome) SLC25A46 missense yes UMD3.1 7 g.112337413C>T c.376C>T p.(R126C) 2017 28376083
OMIA 001973-9615 dog Great Dane Ichthyosis, SLC27A4-related SLC27A4 splicing yes CanFam3.1 9 g.8684G>A c.1250G>A 2015 26506231
OMIA 002416-8932 rock pigeon pearl-eye SLC2A11B tr nonsense (stop-gain) no AKCR02000030.1 g.1895934G>A p.(W49X) Andrade et al. (2021): "This mutation creates a premature STOP codon in exon 3 of the likely canonical SLC2A11B transcript." 2021 33621224
OMIA 000366-9913 cattle Braunvieh Fleckvieh Fanconi syndrome SLC2A2 delins, small (<=20) yes UMD3.1 1 g.97239973_97239980delinsCATC c.771_778delinsCATC p.(L258fs16) rs379675307 2016 27169150 Some variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446 210909: FN changed c.771_778delTTGAAAAGinsCATC to c.771_778delinsCATC. Also, since the del is of 8 bp, the g. designation has been changed from g.97239973_97239976delTTGAAAAG (which encompasses a deletion of only 4bp) to g.97239973_97239980delinsCATC.
OMIA 001033-9615 dog Dalmatian Urolithiasis SLC2A9 missense yes CanFam3.1 3 g.69456869G>T c.563G>T p.(C188F) rs1152388406 2008 18989453 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001340-9913 cattle Friesian Holstein Complex vertebral malformation SLC35A3 missense yes UMD3.1 3 g.43412427G>T c.538G>T p.(V180F) rs438228855 2006 16344554 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool; Breed information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001340-9913 cattle Montbeliarde de novo mutation in an AI sire SLC35A3 missense yes UMD3.1 3 g.43418851G>T p.(R25S) This variant was detected by Bourneuf et al. (2017) as a de novo mutation from an analysis of whole-genome-sequence of an AI Montbéliarde bull. No information was provided on the descendants of this bull. 2017 28904385
OMIA 001263-9796 horse Coat colour, champagne SLC36A1 missense no EquCab2.0 14 g.26701092C>G c.188C>G p.(T63R) 2008 18802473 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002244-9615 dog Basset Hound Craniomandibular osteopathy SLC37A2 splicing yes CanFam3.1 5 g.9387071C>T c.1446+1G>A NC_006587.3:g.9387071C>T; XM_005619600.3:c.1446+1G>A (Letko et al., 2020) 2020 32033218
OMIA 002244-9615 dog Cairn Terrier Scottish Terrier West Highland White Terrier Craniomandibular osteopathy SLC37A2 splicing yes CanFam3.1 5 g.9387327C>T c.1332C>T XM_005619600.3:c.1332C>T (Letko et al., 2020) 2016 27187611 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001828-9913 cattle Montbeliarde Vorderwald Abortion due to haplotype MH2 SLC37A2 nonsense (stop-gain) yes UMD3.1 29 g.28879810C>T c.34C>T p.(R12*) ss2019324563 2013 23762392 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000593-9913 cattle Holstein Acrodermatitis enteropathica SLC39A4 splicing yes UMD3.1 14 g.1723330G>A c.1645+1G>A "a single nucleotide mutation of the splice donor site in intron 10" 2006 16714095 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 001879-9615 dog Australian Cattle Dog Cystinuria, type II - A SLC3A1 deletion, small (<=20) yes 10 c.1095_1100del p.(T366_T367del) 2013 24001348
OMIA 000256-9615 dog Labrador Cystinuria, type I - A SLC3A1 deletion, small (<=20) yes 10 c.350delG p.(G117Afs*41) 2013 24001348
OMIA 000256-9615 dog Newfoundland Cystinuria, type I -A SLC3A1 nonsense (stop-gain) yes CanFam3.1 10 g.46706001C>T c.586C>T p.(R196*) 2000 11129328 Genomic coordinates obtained from EBI's Variant Effect Predictor
OMIA 000256-9685 domestic cat Domestic Shorthair Cystinuria, type I - A SLC3A1 missense yes Felis_catus_9.0 A3 g.66539609C>T c.1342C>T p.(R448W) XM_003983937.5:c.1342C>T; Felis_catus_6.2: g.66470414C>T 2015 25417848 The genomic location on Felis_catus_9.0 and transcript information is based on Rodney et al. 2021 (PMID: 33785770)
OMIA 000370-93934 Japanese quail Feather colour, albinism, sex-linked, imperfect SLC45A2 splicing yes a splice-site mutation in the SLC45A2 gene: "a G → T transversion at the splice acceptor site just preceding exon 4" 2007 17151254
OMIA 001821-9615 dog Doberman Pinscher Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, gross (>20) yes 4 "a 4,081 base pair deletion resulting in loss of the terminus of exon seven of SLC45A2 (chr4[ratio]77,062,968-77,067,051)" (g.27141_31223del; CanFam2.0) 2014 24647637
OMIA 001821-8090 Japanese medaka Coat colour, albinism, oculocutaneous type IV slc45a2 complex rearrangement yes an inversion of 167 bp, an insertion of 48 bp, and a deletion of 172 bp 2008 18245373
OMIA 000915-9031 chicken Sex-linked imperfect albinism SLC45A2 S*AL deletion, small (<=20) no Z c.106delT 2007 17151254
OMIA 001821-9615 dog Lhasa Apso Mixed breed Pekingese Pomeranian Coat colour, albinism, oculocutaneous type IV SLC45A2 missense yes 4 c.1478G>A p.(G493D) 2015 25790827
OMIA 000370-93934 Japanese quail Feather colour, cinnamon SLC45A2 missense no c.287C>A p.(A72D) 2007 17151254
OMIA 000213-74535 Bengal tiger Coat colour, white SLC45A2 missense no C>T p.(A477V) 2013 23707431
OMIA 001821-9615 dog Bull Mastiff Coat colour, albinism, oculocutaneous type IV SLC45A2 deletion, small (<=20) yes CanFam3.1 4 g.73864860delC c.1287delC p.(M430Cfs*4) 2017 28737247
OMIA 001344-9796 horse Gypsy Coat colour, snowdrop SLC45A2 C^sno missense no EquCab2.0 21 g.30664622G>A c.305G>A p.(R102Q) Bisbee et al. (2020): transcript ENSECAT00000026240.1 in the Ensembl EquCab2.0 assembly 2020 31961951
OMIA 001344-9796 horse Coat colour, cream dilution SLC45A2 C^Cr missense no EquCab3.0 21 g.31690653G>A c.457G>A p.(D153N) 2003 12605854 EquCab3 coordinates obtained from Table S2 of Holl et al. (2019)
OMIA 001344-9796 horse Standardbred x Tennessee Walking Horse cross Coat colour, sunshine SLC45A2 C^sun missense no EquCab3.0 21 g.31705368G>A c.568G>A p.(G190R) Holl et al. (2019): "The exon sequence containing this variant was deposited in Genbank under accession no. MF688761." 2019 31006892
OMIA 001344-9796 horse American Paint Horse Lusitano Purebred Spanish horse Quarter Horse Coat colour, pearl SLC45A2 C^prl missense no EquCab3.0 21 g.31709690G>A c.985G>A p.(A329T) 2019 30968968 EquCab3 g. coordinate kindly provided by Natalia Sevane
OMIA 000915-9031 chicken Feather colour, silver SLC45A2 S*S missense no GalGal5 Z g.10336663C>A c.1039C>A p.(L347M) rs314509501 2007 17151254 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 000915-9031 chicken White Leghorn Feather colour, silver SLC45A2 S*S missense no GalGal5 Z g.10340976A>G c.830A>G p.(Y277C) rs315357427 2007 17151254 Variant coordinates obtained from or confirmed by EBI's Variant Effect Predictor (VEP) tool
OMIA 001821-9593 western gorilla Coat colour, albinism, oculocutaneous type IV SLC45A2 missense yes gorGor3.1 17 g.59753498G>C c.1552G>C p.(G518R) 2013 23721540 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001821-9913 cattle Braunvieh Coat colour, albinism, oculocutaneous type IV SLC45A2 missense yes UMD3.1 20 g.39829806G>A c.134G>A p.(R45Q) Important note by Rothammer et al. (2017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001821-9913 cattle Braunvieh Coat colour, albinism, oculocutaneous type IV SLC45A2 missense yes UMD3.1 20 g.39864148C>T c.1331C>T p.(T444I) Important note by Rothammer et al. 92017): "To determine which of the two mutations or even if the combination of both is causal for oculocutaneous albinism in Braunvieh, it would be necessary to produce additional cases and investigate them more precisely" 2017 28982372 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 001228-9913 cattle Japanese Black Spherocytosis SLC4A1 nonsense (stop-gain) yes UMD3.1 19 g.44695843C>T c.1990C>T p.(R664*) 1996 8621763 Variant information kindly provided or confirmed by Hubert Pausch, including information from Additional Table 6 of Jansen et al. (2013) BMC Genomics201314:446 https://doi.org/10.1186/1471-2164-14-446
OMIA 000755-9913 cattle Angus Friesian Hereford Holstein Simmental Osteopetrosis SLC4A2 deletion, gross (>20) yes UMD3.1 4 g.114437192_114439942del "approximately 2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3" 2010 20507629 Breed and variant information kindly provided or confirmed by Matt McClure and Jennifer McClure from "Understanding Genetics and Complete Genetic Disease and Trait Definition (Expanded 2016 Edition)" (https://www.icbf.com/wp/?page_id=2170)
OMIA 001572-9615 dog Golden Retriever Golden Retriever PRA 1 SLC4A3 insertion, small (<=20) yes 37 c.2601_2602insC 200922: g. info moved here (g.29147633) until it can be standardised 2011 21738669
OMIA 001578-9796 horse Dales Pony Fell Pony Foal immunodeficiency syndrome in the Fell and Dales Pony SLC5A3 missense yes EquCab2.0 26 g.30660224G>T c.1337G>T p.(P446L) 2011 21750681 Variant coordinates obtained from or confirmed by EBI's Some Effect Predictor (VEP) tool
OMIA 002174-9615 dog Shih-Tzu Congenital dyshormonogenic hypothyroidism with goiter SLC5A5 splicing unknown CanFam3.1 20 g.29777899G>A Soler Arias et al. (2018): "The splice site mutation predicts loss of exon 10, at a minimum, and a shift of the translation reading frame that predicts 54 amino acids of altered protein sequence before a premature stop codon (UAG) in exon 12" 2018 29777899
OMIA 001594-9615 dog Irish Wolfhound Hyperekplexia (Startle disease) SLC6A5 deletion, gross (>20) yes 21 "a homozygous 4.2kb microdeletion encompassing exons 2 and 3 " 2011 21420493
OMIA 001594-9615 dog Spanish greyhound Hyperekplexia (Startle disease) SLC6A5 deletion, small (<=20) yes CanFam3.1 21 p.(S460Ffs*47)